ID: 961589335

View in Genome Browser
Species Human (GRCh38)
Location 3:127964309-127964331
Sequence ATCATGTGCTTAAAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 206}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961589335_961589340 9 Left 961589335 3:127964309-127964331 CCTTCACTCTTTAAGCACATGAT 0: 1
1: 0
2: 0
3: 12
4: 206
Right 961589340 3:127964341-127964363 AATAAGATGGTGGCTGGGCGCGG 0: 1
1: 1
2: 24
3: 263
4: 1827
961589335_961589339 4 Left 961589335 3:127964309-127964331 CCTTCACTCTTTAAGCACATGAT 0: 1
1: 0
2: 0
3: 12
4: 206
Right 961589339 3:127964336-127964358 TAAAGAATAAGATGGTGGCTGGG 0: 1
1: 0
2: 6
3: 58
4: 575
961589335_961589337 -1 Left 961589335 3:127964309-127964331 CCTTCACTCTTTAAGCACATGAT 0: 1
1: 0
2: 0
3: 12
4: 206
Right 961589337 3:127964331-127964353 TATGTTAAAGAATAAGATGGTGG 0: 1
1: 0
2: 0
3: 33
4: 394
961589335_961589338 3 Left 961589335 3:127964309-127964331 CCTTCACTCTTTAAGCACATGAT 0: 1
1: 0
2: 0
3: 12
4: 206
Right 961589338 3:127964335-127964357 TTAAAGAATAAGATGGTGGCTGG 0: 1
1: 0
2: 6
3: 65
4: 520
961589335_961589336 -4 Left 961589335 3:127964309-127964331 CCTTCACTCTTTAAGCACATGAT 0: 1
1: 0
2: 0
3: 12
4: 206
Right 961589336 3:127964328-127964350 TGATATGTTAAAGAATAAGATGG 0: 1
1: 0
2: 4
3: 37
4: 421
961589335_961589341 12 Left 961589335 3:127964309-127964331 CCTTCACTCTTTAAGCACATGAT 0: 1
1: 0
2: 0
3: 12
4: 206
Right 961589341 3:127964344-127964366 AAGATGGTGGCTGGGCGCGGTGG 0: 1
1: 19
2: 203
3: 1603
4: 8188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961589335 Original CRISPR ATCATGTGCTTAAAGAGTGA AGG (reversed) Intronic
900016786 1:156685-156707 ATTATGGGTCTAAAGAGTGAAGG + Intergenic
900047046 1:515277-515299 ATTATGGGTCTAAAGAGTGAAGG + Intergenic
900069250 1:756992-757014 ATTATGGGTCTAAAGAGTGAAGG + Intergenic
901740925 1:11341314-11341336 ATAAGGGGCATAAAGAGTGATGG + Intergenic
902586498 1:17442085-17442107 AAGATGAGGTTAAAGAGTGACGG - Intergenic
903793591 1:25911432-25911454 ATCATGTGTGTAAAAAGAGAGGG - Intergenic
904488854 1:30845766-30845788 ATTATGTGCTAAACGAGGGATGG - Intergenic
905311977 1:37055577-37055599 ATCATGTTATTAAAATGTGAAGG - Intergenic
906067275 1:42990889-42990911 ATCATGTGCTTTGGGAGGGACGG - Intergenic
906453659 1:45974900-45974922 ATAAAATCCTTAAAGAGTGAAGG + Intronic
908309645 1:62866559-62866581 ATAATTTGCTGAATGAGTGAAGG + Intergenic
908905846 1:69007833-69007855 ATCATACTCTTAAAGAGAGAAGG + Intergenic
910293245 1:85618738-85618760 ATTATGAACTTAAAGAGTCACGG - Intergenic
910998552 1:93136078-93136100 TTCATGAACTTAATGAGTGAAGG - Intronic
911215895 1:95193395-95193417 CTCAAGTGCTTAAAGAATAAAGG - Exonic
911899936 1:103490116-103490138 ATCATTAGCATAAAGATTGAAGG - Intergenic
912183253 1:107243866-107243888 ATAATATATTTAAAGAGTGAGGG - Intronic
912848514 1:113100537-113100559 TTGTTGTGCTTAAAGTGTGATGG + Intronic
916326004 1:163560741-163560763 AAAATGTTCTCAAAGAGTGAAGG + Intergenic
917504831 1:175618271-175618293 ACCATGTGATTAAGGAGTAATGG + Intronic
919473993 1:198011889-198011911 TTATTGTGCCTAAAGAGTGAAGG + Intergenic
921855357 1:219976059-219976081 AGGAAGTGCTTAAAGAATGATGG + Intronic
922104614 1:222502387-222502409 ATTATGGGTCTAAAGAGTGAAGG + Intergenic
922194149 1:223345392-223345414 ATCATGTGCTTATTAAGAGATGG + Intronic
922264927 1:223974900-223974922 ATTATGGGTCTAAAGAGTGAAGG + Intergenic
924077312 1:240353805-240353827 ATCTTGTGCATACAGAGTTAAGG - Intronic
924346786 1:243079914-243079936 ATTATGGGTCTAAAGAGTGAAGG + Intergenic
1064430794 10:15268260-15268282 ATCAAGTGTTTACAAAGTGAGGG - Intronic
1066729561 10:38424948-38424970 ATTATGGGTCTAAAGAGTGAAGG - Intergenic
1067775243 10:49159840-49159862 AGCATGTGCTCAAAGACTAATGG + Intronic
1069534667 10:69244220-69244242 AGGAAGTACTTAAAGAGTGATGG - Intronic
1072798120 10:98372191-98372213 ATCATGTCCTTATAAAATGAGGG - Intergenic
1073059806 10:100726669-100726691 AGCATATGCTTAAAGAGTGTAGG + Intergenic
1073713000 10:106066830-106066852 ATCATCTACATAAAGGGTGAGGG - Intergenic
1073899203 10:108199973-108199995 TTCATATGCATAAAGAGTTAAGG - Intergenic
1074592477 10:114826125-114826147 GACATGTGCTGAATGAGTGAAGG - Intronic
1074988172 10:118675703-118675725 ATCACTGGCTTAAACAGTGAGGG - Intronic
1075841354 10:125507082-125507104 GTCATGTACTTCAAGAGTGTGGG + Intergenic
1076061603 10:127417874-127417896 ATCATGTGAAGGAAGAGTGATGG - Intronic
1076973376 11:151758-151780 ATTATGGGTCTAAAGAGTGAAGG + Intergenic
1077604658 11:3600942-3600964 ATCTTTTTCTTAAAGAGAGAAGG - Intergenic
1080370561 11:31635686-31635708 AACATGTACTTAAACAGTGCTGG + Intronic
1081027391 11:38032724-38032746 ATCATGTTTTTAAAGGGTGAAGG - Intergenic
1081507640 11:43734672-43734694 ATGATTGGCTTAAAAAGTGAAGG + Intronic
1084808077 11:71593098-71593120 ATCTTTTTCTTAAAGAGAGAAGG + Intronic
1087744141 11:101923748-101923770 ATCATATGTTGAAAGAGTAATGG + Intronic
1087757497 11:102070121-102070143 ATCATTTTCTTACAGAGGGAGGG + Intronic
1088118611 11:106340995-106341017 ATCCTGTGCTTTAAGAGACAAGG - Intergenic
1089150015 11:116357255-116357277 ACCACCTGCTTAAAGAGTGGTGG - Intergenic
1090420937 11:126574477-126574499 TTCATGTTCTTATTGAGTGATGG - Intronic
1090999126 11:131893696-131893718 AGCAGATGCTTAAAAAGTGAGGG + Intronic
1094110265 12:26854698-26854720 ACCACATGCTTATAGAGTGACGG - Intergenic
1094166486 12:27448816-27448838 ATCATGTGGTTGGAGAATGAGGG - Intergenic
1095717989 12:45369446-45369468 GTCATGTGCTTAAGGAGGGTAGG - Intronic
1097725958 12:63076242-63076264 ATCATGGGCCTACGGAGTGATGG - Intergenic
1098966891 12:76800042-76800064 ATCATGTGCTCAAAAAGTTTAGG + Intronic
1099409096 12:82302388-82302410 ATAACATGATTAAAGAGTGAGGG - Intronic
1099692705 12:85979788-85979810 CCCATGTGCTGAAAGAGAGATGG + Exonic
1100185453 12:92134168-92134190 GTCCTGTGCTTAATGAGTGATGG + Intronic
1100255723 12:92881046-92881068 ATCATGTGCCTAGAGAGAGCAGG - Intronic
1100456019 12:94752406-94752428 ATCCTGTACTTCAAGGGTGATGG + Intergenic
1101467964 12:104967405-104967427 AGGAAGTGCTTAAAGAATGATGG + Intergenic
1102313921 12:111870783-111870805 GTGATGGGCTTATAGAGTGAAGG + Intronic
1102419929 12:112795443-112795465 TTGATGTGCTGAAAGAGTGAAGG + Intronic
1103824798 12:123729222-123729244 AACAAGTGCTCAAAAAGTGATGG - Intronic
1105988957 13:25599162-25599184 AGCATTTGCTTAAAGAGCCAAGG + Intronic
1107565875 13:41603806-41603828 CCCATGTGCTTAAGGAGTCAGGG - Intronic
1108430113 13:50344889-50344911 GCCATGTGGTTAGAGAGTGACGG + Intronic
1110099661 13:71581774-71581796 ATCATGTACTTAAAATGTGTTGG + Intronic
1112768177 13:102768485-102768507 AACATGTGATTTAATAGTGAAGG - Intronic
1114794144 14:25693400-25693422 ATCATGTACTTAACTGGTGATGG + Intergenic
1116848394 14:49885443-49885465 ATCATTTGGCTAAAGAGAGAAGG + Intergenic
1117039505 14:51756652-51756674 ATCTTTTTCTTAAAGAGAGAAGG + Intergenic
1117390673 14:55259521-55259543 ATAATTTGTTTAGAGAGTGAGGG + Intergenic
1117642479 14:57814672-57814694 ACCATTTACTTAAAGAGTAATGG - Intronic
1117941709 14:60973733-60973755 AACAGTTGCTTAAAGAGTTAAGG - Exonic
1118400076 14:65371697-65371719 AGAAAGTGCTTAAAGAATGATGG - Intergenic
1119647755 14:76360650-76360672 AACACATGCTTAAAGAGAGAGGG - Intronic
1120202316 14:81551034-81551056 AGGATGTGCTCAAAGAATGATGG - Intergenic
1121977706 14:98421174-98421196 TTCATGTAATTAAGGAGTGAAGG - Intergenic
1122312016 14:100803438-100803460 ATCTTGTGAGTAAAAAGTGAAGG - Intergenic
1123459777 15:20459406-20459428 GTCCTGTGCTTAAAGAGAGGGGG - Intergenic
1123658285 15:22541014-22541036 GTCCTGTGCTTAAAGAGAGGGGG + Intergenic
1124266007 15:28235243-28235265 GTCCTGTGCTTAAAGAGAGGGGG - Intronic
1124312150 15:28635506-28635528 GTCCTGTGCTTAAAGAGAGGGGG + Intergenic
1126901163 15:53315913-53315935 AACCTGTTCTTAAAGACTGATGG + Intergenic
1128172477 15:65525184-65525206 ATAATGTGTTTAAAGACTGATGG - Intergenic
1128892874 15:71346523-71346545 AAGAAGTGCTCAAAGAGTGATGG - Intronic
1131909267 15:97178643-97178665 ATGGTGAGGTTAAAGAGTGAAGG + Intergenic
1133561983 16:6958743-6958765 ATCATATGCTTAAAAATTTATGG + Intronic
1138531602 16:57637497-57637519 ATCCTGTGCTTAAAGGGAGCTGG - Intronic
1139397973 16:66655720-66655742 ATCTTGTGCTCAGAGAATGAAGG + Intronic
1142446874 16:90145772-90145794 ATTATGGGTCTAAAGAGTGAAGG - Intergenic
1142460615 17:89553-89575 ATTATGGGTCTAAAGAGTGAAGG + Intergenic
1142732634 17:1871681-1871703 AACATTTGTGTAAAGAGTGATGG + Intronic
1146542546 17:33710139-33710161 ATAATGTGGTTAGAGAGGGATGG - Intronic
1153470326 18:5437277-5437299 CTCATGTGGTGAAAGGGTGAGGG - Intronic
1156609668 18:38711603-38711625 ATCCTGTGTTTAAGGAGTGGGGG - Intergenic
1156908747 18:42385586-42385608 AGAATGTGCTTGAAGAATGATGG - Intergenic
1157316564 18:46594731-46594753 ATGATGTGCTTAAAGAAATACGG - Intronic
1158016940 18:52794279-52794301 ATCACATGCTCAAAGATTGAAGG - Intronic
1158078235 18:53556982-53557004 ATGATATGCTTAAAGAGTGCAGG + Intergenic
1159142829 18:64418258-64418280 ATCATCTTCCTAAAGAGTGTGGG - Intergenic
1160650332 19:222059-222081 ATTATGGGTCTAAAGAGTGAAGG + Intergenic
1162348917 19:10137273-10137295 CTCATGTCCTGAAAGAGTGTGGG + Exonic
1162782025 19:13011486-13011508 ATCATGGACTTCAGGAGTGAGGG + Intronic
925853529 2:8107443-8107465 ATCATATGCTAAATAAGTGATGG - Intergenic
926138590 2:10355051-10355073 ACCATGTGTTTAAAGCCTGAGGG + Intronic
926445965 2:12943441-12943463 ATCATGTGGTTTCAGTGTGAAGG + Intergenic
926821119 2:16852838-16852860 ACCATGTGCTCCTAGAGTGAGGG - Intergenic
929329872 2:40669433-40669455 ACCATGTGCTATAAGACTGATGG - Intergenic
929894358 2:45945590-45945612 AGCATGTGCTCAACCAGTGACGG - Intronic
930495163 2:52132162-52132184 ATTATGAGCATAAAGAATGAAGG - Intergenic
936959900 2:118061997-118062019 ATCATGTGATTTAAGGGGGAGGG - Intergenic
940870179 2:158853272-158853294 ATCTTTTTCTTAAAGAGAGAAGG + Intronic
940872888 2:158874331-158874353 ATCTTTTTCTTAAAGAGAGAAGG + Intergenic
941389177 2:164890616-164890638 ATCATCTGCTTTATGAGTGAGGG - Intergenic
942031426 2:171965324-171965346 ATCATCTGCCTAAAGAATAAAGG - Exonic
942139957 2:172967851-172967873 AGCATGTGCTGAATGAGTGAAGG - Intronic
944448804 2:199819926-199819948 ATCATGTGCTTTAGTGGTGATGG - Intronic
1169582910 20:7045118-7045140 ATTATGTGGATAAAGAGAGAGGG - Intergenic
1170451225 20:16486264-16486286 AACATGTGCTTAATGAAGGAGGG + Intronic
1170464840 20:16613080-16613102 ATCTGGTGCTTGAAGACTGAAGG - Intergenic
1170485863 20:16816009-16816031 ACCATGTTCTTAAAGTGAGATGG - Intergenic
1174643292 20:52063712-52063734 AGAATGTGCTTAAAAAATGATGG + Intronic
1179143390 21:38747035-38747057 ATCATGTGGTTCAGGAATGAGGG - Intergenic
1180119385 21:45736738-45736760 AACATGTGCTGAACGAATGAAGG - Intronic
949869174 3:8572776-8572798 AAAATGTGTTTAAAGAATGATGG - Intergenic
950297463 3:11844425-11844447 ATAAAGTGTTTAAAGAGTGCTGG - Intronic
952202268 3:31142809-31142831 AAGCTTTGCTTAAAGAGTGAAGG - Intergenic
954358175 3:50100128-50100150 TTCATGTGCTTGAAGACTGGGGG - Intronic
955112644 3:55964273-55964295 ATCATATACTTAAAAAGTTAGGG + Intronic
955272473 3:57515355-57515377 AGGATGTGCTCAAAGAATGATGG + Intronic
957075505 3:75599950-75599972 ATCTTTTTCTTAAAGAGAGAAGG - Intergenic
958009768 3:87862225-87862247 AAAATGTTCTTAAAGAGTGAAGG - Intergenic
961015338 3:123464167-123464189 AAGATGTGCTCAAAGATTGATGG + Intergenic
961275679 3:125724185-125724207 ATCTTTTTCTTAAAGAGAGAAGG + Intergenic
961278593 3:125746780-125746802 ATCTTTTTCTTAAAGAGAGAAGG + Intergenic
961545674 3:127631135-127631157 CTCAGGTGCTTACAGAGTGGAGG + Intronic
961589335 3:127964309-127964331 ATCATGTGCTTAAAGAGTGAAGG - Intronic
961875807 3:130022853-130022875 ATCTTTTTCTTAAAGAGAGAAGG - Intergenic
964314184 3:155425726-155425748 ATCAGGTGCTCAACAAGTGATGG - Intronic
964428989 3:156584041-156584063 ATCACGTGCTAAAACAGAGAAGG - Intergenic
964710876 3:159670065-159670087 ATCATTTTCTTAAAGAGTTTTGG - Intronic
967424081 3:189306089-189306111 ATCATGGGCTTACAGAGTTCAGG + Intronic
967832764 3:193935096-193935118 CTCATGTGCTTACAGAGGGCAGG - Intergenic
968367514 3:198198070-198198092 ATTATGGGTCTAAAGAGTGAAGG - Intergenic
969023799 4:4157776-4157798 ATCTTTTTCTTAAAGAGAGAAGG - Intergenic
969786188 4:9458924-9458946 ATCTTTTTCTTAAAGAGAGAAGG + Intergenic
970292243 4:14585919-14585941 ATCATGTCCTTTAAGAGATATGG + Intergenic
970882590 4:20949056-20949078 ATCATGTGCTCAAAAAATCACGG - Intronic
971072787 4:23113732-23113754 ATCAACTGCTTAATGAATGAGGG - Intergenic
971415032 4:26417647-26417669 ATCATGTGCTTAGAGCATAAAGG + Intronic
976180577 4:82395128-82395150 ATCATGTGATTACAGAGTTGGGG - Intergenic
980183217 4:129427853-129427875 ACCATCTGCTTAAAGACAGAAGG - Intergenic
980885359 4:138756791-138756813 AATATTTGCTGAAAGAGTGAAGG - Intergenic
984315459 4:178124511-178124533 ATCATGTTCTTAAGCAGTAAGGG + Intergenic
987963791 5:24846310-24846332 ATTAAGTGCTCAAAGAATGATGG - Intergenic
988687052 5:33535535-33535557 AGCATGTGCTTAGAGAGGAACGG + Intronic
989598924 5:43183738-43183760 ATGATGTCCTAGAAGAGTGAAGG + Intronic
989727983 5:44610300-44610322 AGGATGTGCTTCAAGAGGGAAGG + Intergenic
990209246 5:53464590-53464612 AGCATGTACTTGAAAAGTGATGG - Intergenic
991080307 5:62591745-62591767 ATACTGTGCTTATAGAGTGATGG - Intronic
994471858 5:100217295-100217317 CTCATGTGCTGAAAGTGTCAAGG - Intergenic
994753360 5:103764961-103764983 ATCATTTTCTAAAAGAGTTAGGG - Intergenic
996789274 5:127275299-127275321 ATCAGGTGCTTAAATAATCAAGG + Intergenic
1001258945 5:170209501-170209523 ATCAACTGCTTAAAGGGTGTGGG - Intergenic
1001463633 5:171941897-171941919 ATCATGTGATTAAAATGTGGTGG + Intronic
1001762165 5:174216914-174216936 ATTACGGGCTTAACGAGTGAAGG - Intronic
1002726738 5:181303297-181303319 ATTATGGGTCTAAAGAGTGAAGG - Intergenic
1002948944 6:1789317-1789339 ACCATGGGCTTAGAGAGTCAGGG - Intronic
1005886798 6:30103196-30103218 AACAGCTGCTTAAAGAGTGCGGG + Exonic
1007326087 6:41061043-41061065 ATGTTGTGCTGGAAGAGTGATGG + Intronic
1010225949 6:73489231-73489253 ATCATTTGATTATATAGTGAGGG + Intronic
1011138476 6:84126127-84126149 ATCATGTTCTTAATTATTGATGG - Intronic
1012106668 6:95169994-95170016 ATCATGTGATTAAAGGGTTGGGG + Intergenic
1013226447 6:108122213-108122235 AGTATGTGCTTAATGAGTTATGG - Intronic
1016854702 6:148655577-148655599 ATGATGTCCTAGAAGAGTGAAGG - Intergenic
1017923395 6:158890256-158890278 ATCATTTGCATGAACAGTGAAGG + Intronic
1018354847 6:163001956-163001978 ATAATGTGTTTAAAGAGTTAGGG + Intronic
1019650726 7:2156511-2156533 ATCATCTGCATAAATAGAGAGGG + Intronic
1020830811 7:13092754-13092776 ATTATTTCCTTAAAGAGTAAAGG + Intergenic
1021077738 7:16325727-16325749 ATCATCTGCTTGAACTGTGATGG + Intronic
1022691764 7:32662881-32662903 GTCATTTGCTGAGAGAGTGAAGG + Intergenic
1023398057 7:39770153-39770175 ATTATGGGTCTAAAGAGTGAAGG - Intergenic
1024071628 7:45790923-45790945 ATTATGGGTCTAAAGAGTGAAGG - Intergenic
1025134600 7:56400344-56400366 ATTATGGGTCTAAAGAGTGAAGG + Intergenic
1027903093 7:84143547-84143569 AACATGTCCATAAAGAGTGGAGG + Intronic
1028482627 7:91324328-91324350 AACATGTGCTGAATGAGCGAAGG + Intergenic
1028851101 7:95538588-95538610 AGCATGAAGTTAAAGAGTGAAGG + Exonic
1029539944 7:101176768-101176790 ATCATTGGCTGAAAGAGAGAGGG - Intronic
1032048251 7:128628501-128628523 ATTATGGGTCTAAAGAGTGAAGG - Intergenic
1032674010 7:134111465-134111487 ATCAGGTGCTTTAACAGGGAAGG - Intergenic
1034525483 7:151657852-151657874 ATATTGTGTTTAAAGAATGATGG + Intronic
1038238295 8:25783765-25783787 TTCATGTGAAGAAAGAGTGATGG - Intergenic
1041215675 8:55597463-55597485 AACAGAGGCTTAAAGAGTGAAGG - Intergenic
1043786708 8:84411433-84411455 ATCATCTGGTTAAAGGGAGAGGG - Intronic
1043795845 8:84537807-84537829 ATAATGTACTTAAAGAGAGCAGG + Intronic
1045052487 8:98339826-98339848 AGCATGGGCTTAAAGAGCAAAGG + Intergenic
1045643995 8:104282485-104282507 ATCCTGTGCTTTGAGAGAGATGG - Intergenic
1046729208 8:117707242-117707264 CTCATGTGGTGAAAGAGTTAAGG + Intergenic
1047026062 8:120825932-120825954 CTCATGTTCTGATAGAGTGAAGG + Intergenic
1047185094 8:122625891-122625913 ATCATGTGCTCACACATTGATGG + Intergenic
1047337522 8:123950924-123950946 ATCCTGTGCATAAATAGAGAAGG + Intronic
1051365923 9:16321379-16321401 CTCATGGCCTCAAAGAGTGAAGG + Intergenic
1053051266 9:34962518-34962540 ATCAGGTGCTTAATAACTGATGG - Intronic
1054852829 9:69866256-69866278 ATCATGTGCTTACATGGTTATGG + Intronic
1058135000 9:101297217-101297239 ATAATTTTTTTAAAGAGTGAGGG + Intronic
1062751855 9:138260775-138260797 ATTATGGGTCTAAAGAGTGAAGG - Intergenic
1189194079 X:39137565-39137587 TTCATGCACTTAAAGAGAGAGGG - Intergenic
1190508605 X:51154515-51154537 TTAAGGTACTTAAAGAGTGATGG + Intergenic
1194092006 X:89589625-89589647 ATCCTGTGCTTTGGGAGTGATGG - Intergenic
1194808000 X:98353927-98353949 ATTATGTGCTTACACAGTGAAGG - Intergenic
1197117273 X:122848583-122848605 AACATGGGCTAGAAGAGTGAGGG - Intergenic
1197718870 X:129731121-129731143 ATCAGGTGCAGTAAGAGTGAAGG + Intergenic
1197923204 X:131618258-131618280 AACAAGAGCTTAAAGGGTGATGG - Intergenic
1198620830 X:138507702-138507724 ATGCTGTGCATAAAGCGTGATGG + Intergenic
1200444640 Y:3245689-3245711 ATCCTGTGCTTTGGGAGTGATGG - Intergenic
1201589093 Y:15593836-15593858 GTGCTGTGCTAAAAGAGTGAGGG - Intergenic