ID: 961591849

View in Genome Browser
Species Human (GRCh38)
Location 3:127987073-127987095
Sequence TGACCTCTGCTGGAGCCAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 281}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961591841_961591849 11 Left 961591841 3:127987039-127987061 CCAGAGAGTGCCAAGGGAGGACC 0: 1
1: 0
2: 1
3: 24
4: 159
Right 961591849 3:127987073-127987095 TGACCTCTGCTGGAGCCAGGAGG 0: 1
1: 0
2: 3
3: 28
4: 281
961591845_961591849 1 Left 961591845 3:127987049-127987071 CCAAGGGAGGACCGAGAAGGGGC 0: 1
1: 0
2: 0
3: 28
4: 200
Right 961591849 3:127987073-127987095 TGACCTCTGCTGGAGCCAGGAGG 0: 1
1: 0
2: 3
3: 28
4: 281
961591836_961591849 25 Left 961591836 3:127987025-127987047 CCCAGTGGAACTTTCCAGAGAGT 0: 1
1: 0
2: 1
3: 20
4: 170
Right 961591849 3:127987073-127987095 TGACCTCTGCTGGAGCCAGGAGG 0: 1
1: 0
2: 3
3: 28
4: 281
961591846_961591849 -10 Left 961591846 3:127987060-127987082 CCGAGAAGGGGCATGACCTCTGC 0: 1
1: 0
2: 1
3: 18
4: 265
Right 961591849 3:127987073-127987095 TGACCTCTGCTGGAGCCAGGAGG 0: 1
1: 0
2: 3
3: 28
4: 281
961591837_961591849 24 Left 961591837 3:127987026-127987048 CCAGTGGAACTTTCCAGAGAGTG 0: 1
1: 0
2: 1
3: 15
4: 146
Right 961591849 3:127987073-127987095 TGACCTCTGCTGGAGCCAGGAGG 0: 1
1: 0
2: 3
3: 28
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961591849 Original CRISPR TGACCTCTGCTGGAGCCAGG AGG Exonic
900291579 1:1925969-1925991 CGATGTCTGCTGGAGCCACGAGG + Intronic
900295640 1:1947786-1947808 AGAGCTCTTCAGGAGCCAGGTGG + Intronic
902334447 1:15747036-15747058 TGACCTCTGCCAGATACAGGTGG + Exonic
902722964 1:18316278-18316300 TGACCACTGCTGAGGCCAGAGGG + Intronic
902734100 1:18388651-18388673 AGGCGTCTGCTGGAGCCCGGTGG + Intergenic
904193878 1:28769928-28769950 TGACCTCTGCAAAAGCAAGGTGG + Intergenic
906096139 1:43225284-43225306 TGACCCCTGCTGTAGCAATGGGG - Intronic
906776086 1:48530917-48530939 CGCCCCCTGCTGGAGCCAGGTGG + Intergenic
909329859 1:74398040-74398062 TTACCTCTGCTGGAAGCAGGAGG - Intronic
909881568 1:80886235-80886257 TGACCTTTAGTTGAGCCAGGTGG - Intergenic
910240440 1:85080292-85080314 TGACACCTGCTCGAGGCAGGCGG - Intronic
910409669 1:86927026-86927048 AAACCTCTTCTGGAGCCAGATGG - Intronic
913685169 1:121224948-121224970 TGCCCTATGCTAGAGCCAAGAGG + Intronic
914037015 1:144012553-144012575 TGCCCTATGCTAGAGCCAAGAGG + Intergenic
914152440 1:145055379-145055401 TGCCCTATGCTAGAGCCAAGAGG - Intronic
915594787 1:156890294-156890316 TGCCCTCTGCTGGAGCCTCTTGG + Intergenic
915598946 1:156910403-156910425 TGCCCCCTGCTGGTGGCAGGTGG - Intronic
917433962 1:175000177-175000199 TTACCTCTTCTGAAGCCATGGGG - Exonic
919121185 1:193342220-193342242 GGAGCTCAGCAGGAGCCAGGTGG - Intergenic
919586640 1:199447973-199447995 TTTCCCCTGCTGGAGCCAGGGGG - Intergenic
919907341 1:202087035-202087057 TGACCTCTCCTGGGGTCAGCTGG - Intergenic
921001801 1:211051607-211051629 TGACCTCAGCATCAGCCAGGAGG - Intronic
921326853 1:213994018-213994040 TGCCCCATGCTGGAGCCAAGAGG - Intronic
921948325 1:220904326-220904348 TGACCTACGCTGTACCCAGGGGG - Intergenic
1063734696 10:8739831-8739853 TCATTTCTGCTGGTGCCAGGTGG - Intergenic
1063931170 10:11029617-11029639 GGAACTTTGCTGGAGGCAGGGGG + Intronic
1064428845 10:15254263-15254285 CCACCTATGCTGCAGCCAGGAGG - Intronic
1065822967 10:29543347-29543369 TGACCACTGCAGGACGCAGGGGG + Intronic
1065876252 10:30000051-30000073 TGGCATCTGCTGGGGGCAGGAGG - Intergenic
1066422361 10:35274926-35274948 TGGCCCCTGCAGAAGCCAGGGGG - Intronic
1067582849 10:47456383-47456405 TGGTCTCTGCAGAAGCCAGGAGG + Intergenic
1067713845 10:48671853-48671875 TTATCTCTGCAGGAGCCGGGAGG + Intergenic
1070329325 10:75406443-75406465 CGGCCACTGCCGGAGCCAGGTGG + Intergenic
1070671663 10:78381608-78381630 TGTTCTCTGCTGGCGACAGGAGG - Intergenic
1070701364 10:78603969-78603991 TGTGCTCTTCAGGAGCCAGGTGG + Intergenic
1070787248 10:79169064-79169086 GGACCTCTGTTGGAGCCTAGGGG + Intronic
1073070967 10:100793118-100793140 TGGCCCCTGCTGGAGCCAAACGG + Intronic
1075075363 10:119346758-119346780 TTGCCTCTGCCGGAGCCTGGGGG - Intronic
1075568380 10:123520842-123520864 TGGCATCTGTTGGAGCCTGGGGG - Intergenic
1075602275 10:123778507-123778529 TGATCACTACTGGAGCCAAGAGG - Intronic
1076229460 10:128808059-128808081 TGGCCTCGGGTGGAGCCTGGGGG - Intergenic
1076484976 10:130810101-130810123 TGACCTCTGGTGATGCCAGAAGG + Intergenic
1076495323 10:130893341-130893363 TGATCTCTGGTGTTGCCAGGCGG - Intergenic
1077960998 11:7077003-7077025 TGACTTCTGCTGGAGTCTGCGGG - Intergenic
1078470664 11:11583561-11583583 TATCCTTTGCTGGGGCCAGGTGG - Intronic
1078488025 11:11742045-11742067 TCTCCTCTGCTGGAACCAGAAGG + Intergenic
1084195586 11:67522417-67522439 TTGCCTCTCCTGGAGCTAGGGGG - Intronic
1084424952 11:69079501-69079523 TGACGTTTGCTGTAGCCAGCAGG + Intronic
1085028899 11:73257921-73257943 TGACCTCTCCTGGGGCCAGTGGG + Intergenic
1085424409 11:76391244-76391266 TGACCTTTTCTGGAGCCAGTTGG + Intronic
1087065304 11:94022283-94022305 TGACATCTTCTGGAGTCAGGAGG - Intronic
1089260714 11:117222123-117222145 GGAGCTGGGCTGGAGCCAGGTGG - Intronic
1090247105 11:125224377-125224399 TGTCCTCTGCTGGAGCCCCTCGG + Intronic
1090657930 11:128860027-128860049 TGCCCTCGGCAGGCGCCAGGGGG - Intronic
1091165086 11:133468440-133468462 TGACTGCTGCGGCAGCCAGGAGG + Intronic
1091388150 12:108173-108195 CTACCTCTGCTGGAAGCAGGAGG + Intronic
1091779675 12:3205807-3205829 TGGCCTCTGCTGGGGGAAGGGGG + Intronic
1091852775 12:3713618-3713640 GGAGCTCTGCTGGGGGCAGGGGG - Intronic
1092381270 12:7998949-7998971 TGGCCTCTGCAGAAGACAGGTGG + Intergenic
1092461694 12:8692810-8692832 TTTCCTCTCCTGGAGCCAGCCGG - Intronic
1092492247 12:8956205-8956227 TGCCCTCTCCTGGCACCAGGCGG + Intronic
1096025918 12:48360899-48360921 TGAGCTTTGCTGGACTCAGGTGG + Intergenic
1096464803 12:51842403-51842425 TGCCTTCTGCTGGAGCAAAGGGG - Intergenic
1096469602 12:51868025-51868047 TGACTTCTGCAGGGGTCAGGAGG - Intergenic
1096493496 12:52025817-52025839 TGCCCTCTGCTGGTAACAGGAGG - Intronic
1097176724 12:57147571-57147593 TGACCTCTGTTGGACCCCTGGGG + Intronic
1097754807 12:63397804-63397826 AGACATTTGCTGTAGCCAGGCGG + Intergenic
1098303367 12:69077262-69077284 TGACTGCTGCTGCAGCCATGAGG + Intergenic
1100217730 12:92469899-92469921 TGACCTCTCTTGGAACCTGGCGG - Intergenic
1101246211 12:102886178-102886200 TGACCACTGCTGTCTCCAGGAGG - Intronic
1102714714 12:114960357-114960379 TGAACTCTGCTTGGGCAAGGGGG + Intergenic
1103717317 12:122952489-122952511 TGCCCTCTGCTGGGACCATGAGG + Intronic
1104762396 12:131305299-131305321 TGCCCTCTGGCTGAGCCAGGGGG + Intergenic
1104817381 12:131655497-131655519 TGCCCTCTGGCTGAGCCAGGGGG - Intergenic
1104915365 12:132261699-132261721 TGACCCCTCGTGGAGGCAGGAGG - Intronic
1105218535 13:18304710-18304732 AGACCTCTGCTGCAGACAGTTGG - Intergenic
1106069139 13:26390085-26390107 CTACCTCTGCAGGAGACAGGAGG - Intronic
1106101654 13:26698572-26698594 TGTCCTCTTCAGGAGCCCGGGGG - Intergenic
1106923475 13:34588991-34589013 TGACCCAGGCTGGTGCCAGGAGG + Intergenic
1107396842 13:40026941-40026963 TGTCCTCAGCTGGAGCCATGGGG - Intergenic
1107574968 13:41708672-41708694 TGATCTCTGCAGGACCTAGGTGG - Intronic
1108712370 13:53046186-53046208 TGAACTTTGTTTGAGCCAGGAGG - Intronic
1110103785 13:71644499-71644521 TGAACTCTGTTGGTGACAGGAGG - Intronic
1110249243 13:73363421-73363443 TAACCTCTGCTGAAACCACGTGG + Intergenic
1110561409 13:76914294-76914316 TCACCTCTGTTGTAGCCAGATGG - Intergenic
1110730724 13:78876400-78876422 TGCCCTCTGCTGGCACCAGGTGG - Intergenic
1113958199 13:114110684-114110706 TGCCCTGTGCAGGTGCCAGGAGG - Intronic
1115907185 14:38212420-38212442 TCACCTCTGCTGGAACCCAGAGG - Exonic
1118256037 14:64206783-64206805 TGACCTCATCTGGCTCCAGGTGG - Intronic
1118333258 14:64830816-64830838 TGAACTCTGCTCTAGTCAGGAGG + Intronic
1119260560 14:73235927-73235949 AGGCAGCTGCTGGAGCCAGGGGG + Intergenic
1119475054 14:74922439-74922461 TGCTCTCTGCTGGCTCCAGGAGG - Exonic
1121274150 14:92656477-92656499 GGACCTCTGCTGGAAACAGCAGG + Intronic
1122204849 14:100143254-100143276 TGACCCCTGCAGGAGCTGGGAGG + Intronic
1122534832 14:102454936-102454958 TGAGCTGTGCTGGAGGCAGGAGG - Intronic
1122921290 14:104881371-104881393 TGACCCCTCCTGGACCGAGGTGG - Intronic
1124614106 15:31229286-31229308 TGCCCTCTGGTGGGGCCGGGGGG + Intergenic
1125524924 15:40368677-40368699 TGACCTCTGCTGCGGCCACTCGG + Exonic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1128662447 15:69512370-69512392 TGACCTCTGATGTGACCAGGAGG + Intergenic
1128881645 15:71248438-71248460 TGACCTCTTCTGGAGGAGGGAGG + Intronic
1129934059 15:79434588-79434610 TGCTCTCTGCTCCAGCCAGGTGG + Intronic
1131553990 15:93380842-93380864 TGTCCTAGGCTGGAGACAGGTGG + Intergenic
1133088896 16:3388253-3388275 TGACTTGGGCTGGAGCGAGGTGG - Intronic
1133862835 16:9612502-9612524 TCAGCTCTGCTAGAGTCAGGGGG - Intergenic
1134254341 16:12599320-12599342 TGTCCTCTGATGGAGCCTGTAGG - Intergenic
1134420498 16:14083445-14083467 AGACCTGTCCTGGAGCCAGGTGG - Intronic
1134801236 16:17086654-17086676 TGAGCTTTTCTGGAGCCATGGGG + Intergenic
1135546734 16:23371657-23371679 GGACCCCTGCAGGTGCCAGGGGG - Intronic
1136029172 16:27490211-27490233 TGGCTGCTCCTGGAGCCAGGTGG - Intronic
1137716252 16:50600074-50600096 TGACCACTGTGGGGGCCAGGGGG + Intronic
1138658604 16:58504480-58504502 AGCCCTCAGCTGGAGCCAGGTGG - Intronic
1141000183 16:80300484-80300506 TGGCCCCTGCTGGAGCCAGGTGG - Intergenic
1141788511 16:86217394-86217416 GTCCCTCTGCTGTAGCCAGGAGG - Intergenic
1143501483 17:7342037-7342059 TGGGCTCTGGTGGACCCAGGCGG - Exonic
1144419259 17:15081124-15081146 AGAGCTGTGCTGGAGCCAGGTGG - Intergenic
1144841002 17:18185603-18185625 TGGGCTCTTCTGCAGCCAGGAGG - Intronic
1145736570 17:27236877-27236899 TGACCTCTGCTGGACACATTTGG - Intergenic
1145750055 17:27349224-27349246 TGCCCGCTGCTGCCGCCAGGAGG + Intergenic
1147819444 17:43232942-43232964 TGACCTCTGCGGGAACGTGGAGG + Intergenic
1148126087 17:45237711-45237733 TGGCCTTTGCTGGAGGCAGCTGG + Intronic
1148325975 17:46783739-46783761 GGCCCTCAGGTGGAGCCAGGTGG + Intronic
1148853987 17:50568763-50568785 TAGCCTCAGATGGAGCCAGGAGG + Intronic
1148957159 17:51363370-51363392 TGACAGCTGCTGGGGCCACGCGG + Intergenic
1149377958 17:56064574-56064596 TTTCCCCTGCTGGAGCCAGGGGG - Intergenic
1150294898 17:64002354-64002376 TGAGGTCTCCTGGGGCCAGGTGG + Exonic
1150520899 17:65865972-65865994 TGACCACAGCTGCACCCAGGAGG - Intronic
1151365357 17:73613253-73613275 TGACCTTTGGAGGAGCCAAGGGG + Intronic
1151960624 17:77403573-77403595 CGATCCCTGCTGGGGCCAGGGGG - Intronic
1152612956 17:81324447-81324469 TGACTTCTCCCGGAGCCTGGGGG + Intronic
1152800924 17:82330291-82330313 TGCCCTCACCTGGAGCCTGGAGG + Intronic
1152875111 17:82781944-82781966 TGCCCTCTGCTGGCAACAGGTGG - Intronic
1153117980 18:1684110-1684132 AGATCTCTGCTTGAGCCAGAGGG + Intergenic
1156872883 18:41967884-41967906 GGGCCTCTGCTGGAGTCAGAAGG + Intronic
1156954703 18:42948380-42948402 TGAGTTCTGCAGGAGCAAGGAGG + Intronic
1157230421 18:45910597-45910619 TGCCCTCTGCTGGAACACGGAGG + Exonic
1157367167 18:47075695-47075717 TGGCCTCCTCTGGAGCCAGAGGG + Intronic
1157379959 18:47205093-47205115 TGACCTCTGCTGTCCCCTGGTGG + Intergenic
1160970969 19:1767618-1767640 TGCCCTCTGCTGGACACAGCGGG + Intronic
1161862613 19:6809517-6809539 CCACCTCTGCTCCAGCCAGGTGG - Intronic
1161864895 19:6826624-6826646 TGGCCGCTACTGCAGCCAGGTGG + Exonic
1162356177 19:10186393-10186415 TCACACCTGCTGAAGCCAGGAGG + Intronic
1162554506 19:11378432-11378454 GGCCCCCTGCTGGAGCCAGTGGG - Exonic
1162925114 19:13926961-13926983 TGAACTCTGCAGGAGGAAGGAGG - Exonic
1163152896 19:15425313-15425335 TGACCTCTGCTGGGAGGAGGCGG + Exonic
1164861807 19:31567577-31567599 TGACCTCTGCTAGAGAAAGCTGG - Intergenic
1165069052 19:33245019-33245041 TGGCCTCTGCTGGAGATGGGTGG - Intergenic
1165124162 19:33582233-33582255 TAACCTCTTCTGGAGCCCTGGGG - Intergenic
1165867835 19:38949850-38949872 AGACCGCTGGAGGAGCCAGGGGG - Exonic
1167377758 19:49120513-49120535 ACACCTCTGCTGGCCCCAGGTGG + Intronic
1168062523 19:53900887-53900909 TCACCTGTGCTGGAGGCTGGAGG - Intronic
925031218 2:651146-651168 TGACATCTGCTGCAGCCACAAGG - Intergenic
925254271 2:2468872-2468894 TGACCTCTGCTTGATCTAGGTGG + Intergenic
925311545 2:2887915-2887937 TGTATTCTGATGGAGCCAGGTGG - Intergenic
925408840 2:3627151-3627173 TGACCTCTGCGGGAACTTGGGGG + Intronic
925903919 2:8527828-8527850 TGGCCTCTGGAGGAGCCAGCAGG - Intergenic
926056074 2:9774820-9774842 TGGTCTCTTCTGGGGCCAGGTGG - Intergenic
926145715 2:10396221-10396243 TGCCCTGTGCTGGGCCCAGGAGG + Intronic
926781860 2:16480303-16480325 TGACCTGTTCTGTGGCCAGGTGG - Intergenic
927091699 2:19717377-19717399 TGGCCTCTTCTGGAGACTGGAGG - Intergenic
927096650 2:19752324-19752346 TGGCACCTGCTGGAGCCAGAAGG - Intergenic
928914907 2:36460131-36460153 TAACCACAGCTGCAGCCAGGTGG - Intronic
929816731 2:45238415-45238437 TGTACTCTGCTGGGGCCAGTAGG - Intergenic
933420927 2:82043980-82044002 TGCCCTCTGCCAGTGCCAGGTGG + Intergenic
933747990 2:85584623-85584645 TGACCACTGCTGGAGCAGGACGG + Intronic
934295771 2:91741919-91741941 AGACCTCTGCTGCAGACAGTTGG + Intergenic
935125493 2:100218940-100218962 TGGCCTTTGCTGGAGGGAGGAGG - Intergenic
935596261 2:104880388-104880410 TGAGCTCAGCTGGGGCCAGCTGG + Intergenic
936069091 2:109353497-109353519 TGCCCTATGTTGGGGCCAGGCGG - Intronic
937893979 2:126963458-126963480 TTTCCCCTGCTGGAGCCAGGGGG - Intergenic
938721452 2:134070688-134070710 TCCACTCTGCTGGGGCCAGGAGG + Intergenic
939267378 2:139891407-139891429 TGTCCTCTGCTGGTGCTAGCAGG + Intergenic
940987200 2:160062053-160062075 CGACCCCCGCAGGAGCCAGGAGG + Intronic
942387219 2:175455274-175455296 TGATCTCTTCTGGAGCCAGTGGG + Intergenic
943564877 2:189505576-189505598 TGGCCTCTGCTGCAGCCACCAGG - Intergenic
944201181 2:197108937-197108959 TGGCCTCTGCAAGAGCCATGTGG - Intronic
946990895 2:225328357-225328379 TTACGGCTGGTGGAGCCAGGGGG + Intergenic
948499320 2:238380282-238380304 TGAGCCCTGCAGGAGCCACGTGG + Intronic
1169114390 20:3054028-3054050 TGCCCTCTGCTGGAGATAAGGGG - Intergenic
1172490611 20:35333942-35333964 TGACCTCTCCTGAAGGCCGGGGG + Intronic
1172974274 20:38894647-38894669 TGACCTCTGCGAAAGCCAGCAGG - Intronic
1173231408 20:41201909-41201931 TGTCCTCTGAAGCAGCCAGGCGG + Intronic
1176092506 20:63325434-63325456 TGACCCCTGGTGGACCCTGGAGG - Exonic
1178582783 21:33850340-33850362 TGAGCTCTGCTGGACCCACGAGG + Intronic
1179146505 21:38773135-38773157 AGAGCTCTGCTGGATTCAGGAGG - Intergenic
1179198043 21:39183826-39183848 TGAGCCCTGCGGGCGCCAGGAGG + Exonic
1179251335 21:39673827-39673849 TGAGATGTCCTGGAGCCAGGAGG - Intergenic
1181029155 22:20141632-20141654 TGGCCTCTGCTGGAGAGATGGGG - Intronic
1183610663 22:38901878-38901900 TGACCTATGCTAGGTCCAGGTGG - Intergenic
1184191180 22:42895750-42895772 TGACCACTGCTGGGGACAAGAGG + Intronic
1184275575 22:43407786-43407808 TGCAGTCTGCAGGAGCCAGGAGG - Intergenic
1184649040 22:45911272-45911294 GGTCCTCCCCTGGAGCCAGGAGG + Intergenic
1184755322 22:46512613-46512635 TGACATCTGCTGAAGCCAGGAGG + Intronic
1185196458 22:49473510-49473532 TGCCCTTCACTGGAGCCAGGAGG + Intronic
949583076 3:5410533-5410555 GGCCCTCAGCTGTAGCCAGGAGG + Intergenic
954379810 3:50213442-50213464 GGCCCTTTGCTGCAGCCAGGCGG + Intronic
959056738 3:101574498-101574520 GGGCCTCCGCTGGGGCCAGGAGG - Intronic
959254900 3:103996770-103996792 TGAGCTCTGATGAAGCCAGCTGG + Intergenic
959936180 3:112031616-112031638 ATACTTCTGCTGGAGCCAAGTGG - Intergenic
960413722 3:117359025-117359047 TTTCCCCTGCTGGAGCCAGAGGG + Intergenic
960659359 3:120041204-120041226 TTACTTCTGCTGGGGCCAAGTGG + Intronic
960951606 3:123002201-123002223 AGCCCTATGCTGGAGTCAGGTGG + Intronic
961550704 3:127669178-127669200 TGACATCCGCAGGAGCCTGGAGG + Exonic
961591849 3:127987073-127987095 TGACCTCTGCTGGAGCCAGGAGG + Exonic
965999641 3:174932114-174932136 TGACCCCTGATGGAGGCATGTGG + Intronic
966254251 3:177899450-177899472 TGCCCTCTGCTGGTGCTGGGTGG + Intergenic
967929746 3:194682358-194682380 TAGCCTCTGGTGGAGGCAGGAGG - Intergenic
968292203 3:197547483-197547505 TGCACTCTGCTGGAAGCAGGTGG + Intronic
968490224 4:886196-886218 TGCCCTCAGCTGGAACCTGGGGG + Intronic
968871265 4:3243793-3243815 TGAGCTCCCCTGGAGCCAGCAGG + Exonic
969447959 4:7256114-7256136 GGACCTCTTCAGGTGCCAGGAGG + Intronic
969489199 4:7489533-7489555 TAACATCTGCAGGGGCCAGGAGG - Intronic
969582953 4:8076421-8076443 TGGCCTCTGCGGCAGCCAGTGGG + Intronic
971101132 4:23467331-23467353 TGGCCTCTGCAGAAGACAGGTGG - Intergenic
972877480 4:43381520-43381542 TGAGTAGTGCTGGAGCCAGGAGG - Intergenic
974469726 4:62302819-62302841 TGAACCCAGCTGGAGCCTGGGGG + Intergenic
977637911 4:99321988-99322010 TGACCTCTGCCTGTGCCAAGAGG + Intergenic
980522407 4:133950821-133950843 TTACCTCTGCTGGAAGCAAGAGG + Intergenic
980539723 4:134177733-134177755 TTACCTCTGGTAGGGCCAGGTGG - Intergenic
980744978 4:137001240-137001262 AAACCTCTGCTGGGTCCAGGGGG - Intergenic
981176845 4:141691941-141691963 GAACCTCTGCTGGAGCAGGGTGG - Intronic
983079513 4:163367908-163367930 GGGGCTCTGCTGGAGCAAGGAGG - Intergenic
986225313 5:5806794-5806816 TGGCCTATGATGGAGGCAGGTGG - Intergenic
989496819 5:42118439-42118461 TGTCCTCTAATGGAGCCTGGTGG + Intergenic
991651772 5:68862937-68862959 TGACCTCTGCTTTAGGCAGAGGG - Intergenic
996655031 5:125925359-125925381 TTATCTCTGCTGGAAACAGGAGG - Intergenic
997782913 5:136678074-136678096 TGACATCTGGTGTAACCAGGAGG + Intergenic
998755629 5:145375816-145375838 TTTCCCCTGCTGGAGCCAAGGGG - Intergenic
999674325 5:153983681-153983703 TGAACTCTGCTGGAGAGAGCAGG + Intergenic
1000009830 5:157220534-157220556 GGACCTCTGCTGGCCCCAGGTGG - Intronic
1002181740 5:177434286-177434308 TGGGCTCTGCTGGACCCACGGGG + Intronic
1002484513 5:179524909-179524931 GGGCCTCTCCTGGAGGCAGGAGG + Intergenic
1002500066 5:179642579-179642601 GGGCCTCTCCTGGAGGCAGGAGG - Intronic
1002501905 5:179652182-179652204 GGGCCTCTCCTGGAGGCAGGAGG + Intergenic
1002908355 6:1469158-1469180 TTACCTGTGGTGGAGACAGGGGG - Intergenic
1003483822 6:6557152-6557174 TAACATCTGCCTGAGCCAGGGGG + Intergenic
1003557985 6:7157836-7157858 AGCCCTCTTCTGGAGTCAGGAGG - Intronic
1005323779 6:24680202-24680224 TGACCTCTTCTGTAGAAAGGAGG - Intronic
1006443065 6:34063900-34063922 TTCCCGCTCCTGGAGCCAGGTGG - Intronic
1008047245 6:46863890-46863912 TGACCTTTGCTGCACCCTGGAGG + Intronic
1013009334 6:106105569-106105591 TGCCCTCAGATGGAGCCCGGAGG + Exonic
1013658277 6:112268233-112268255 TGACAACTCCAGGAGCCAGGAGG - Intergenic
1014817662 6:125953219-125953241 TGCCCTCTGCTGGTGCCAGGTGG + Intergenic
1016982584 6:149866377-149866399 TGACATCTGCTTCAGCCAGGAGG + Intergenic
1018170305 6:161139044-161139066 AGCCCTGTGCTGGAGCCTGGCGG - Intronic
1018301385 6:162406255-162406277 TGACCTTTGCTGAAGTCAGATGG + Intronic
1018796746 6:167191763-167191785 TGACCTCTGCAGTCTCCAGGAGG - Intronic
1018819576 6:167363350-167363372 TGACCTCTGCAGTCTCCAGGAGG + Intronic
1018848363 6:167570770-167570792 TGACCTCTGATGGAGTCTGGTGG - Intergenic
1018972303 6:168538001-168538023 TGAGCTCTGCTGGAATCTGGGGG + Intronic
1018972344 6:168538153-168538175 TGACCCCTGCTGGAATCTGGGGG + Intronic
1018972365 6:168538212-168538234 TGACCGCTGCTGGAATCTGGGGG + Intronic
1018972549 6:168538811-168538833 TGACCCCTGCTGGAATCTGGGGG + Intronic
1019131519 6:169880563-169880585 AGTGCTCTGCAGGAGCCAGGTGG + Intergenic
1019647681 7:2139722-2139744 TGGCCCCTGCTGGAGCCATCTGG - Intronic
1020278734 7:6639171-6639193 TGACCACTGCTGGGGGTAGGGGG - Intronic
1020859816 7:13477547-13477569 TGACCTCTGCTGTAGACAAGAGG - Intergenic
1021522452 7:21551368-21551390 TTACCTCTGCTGGAAGCAGGAGG + Intronic
1023860751 7:44216526-44216548 TGGCCTCTGCTGGAGCCTCCTGG + Intergenic
1024409964 7:49029027-49029049 TGACCTCTGCCTGTGCCATGTGG - Intergenic
1026739311 7:72968978-72969000 TGAACCCTGCTGGTGGCAGGTGG + Intronic
1026790336 7:73327593-73327615 TGAACCCTGCTGGTGGCAGGTGG + Intronic
1027104420 7:75396095-75396117 TGAACCCTGCTGGTGGCAGGTGG - Intronic
1029433047 7:100544590-100544612 TGACCTCTGCTGGGCAGAGGTGG + Intronic
1029787672 7:102808922-102808944 TGACTTCTTCTGCAGCCAGCTGG + Intronic
1031248783 7:119351568-119351590 TGACCTTTGCTCGAGCCACTGGG - Intergenic
1032325888 7:130927811-130927833 AGACCTCTGCTGGAGCCACTAGG - Intergenic
1033222848 7:139540179-139540201 TGTCCTCTCCTGGTGCCTGGAGG - Intronic
1033894605 7:146055109-146055131 CTACCCCTGCTGGAGGCAGGAGG + Intergenic
1036821567 8:11943826-11943848 TGACATCTACTGGAGCAAGCAGG + Intergenic
1037950173 8:23014525-23014547 TGACGTCTGCTGCCACCAGGGGG - Intronic
1040416904 8:47203347-47203369 TGCCCTCTGCTGGAGGAAGGAGG - Intergenic
1041244173 8:55875105-55875127 GGAGATCTGCTGGTGCCAGGTGG + Intergenic
1042467571 8:69145373-69145395 TTACCTCTGCTGGACCCCAGAGG + Intergenic
1044666435 8:94639062-94639084 TCAGCTCTGCTGGGCCCAGGAGG - Intergenic
1046780741 8:118211825-118211847 TGAAGTTTGCTGGAGACAGGAGG + Intronic
1047155551 8:122313617-122313639 TGACCTCAACTGAAGCAAGGAGG - Intergenic
1047561359 8:125990899-125990921 CTACCTCTGCTGGAAGCAGGAGG - Intergenic
1048518057 8:135128492-135128514 TGACCTCTGATGTTGCCATGTGG - Intergenic
1049124246 8:140772336-140772358 GGAGGACTGCTGGAGCCAGGAGG + Intronic
1049324216 8:142013649-142013671 TGGCCTCGGGTGGAGCCGGGAGG - Intergenic
1049424319 8:142531372-142531394 TGTCCGCTGCTGCAGCCTGGAGG + Intronic
1049438639 8:142599174-142599196 TGACCTCTGCGGGAGGGAGCTGG - Intergenic
1049979837 9:893938-893960 TGCCCTCTGCTGGTGACAGCAGG - Exonic
1051342921 9:16128237-16128259 TGAGCTGAGCTGGAACCAGGTGG - Intergenic
1052225297 9:26077983-26078005 TTTCCCCTGCTGGAGCCAGGAGG - Intergenic
1052923078 9:33988669-33988691 TGACCTGGGCTGTAGGCAGGTGG - Intronic
1053175534 9:35920194-35920216 TCACCTCTGTAGAAGCCAGGAGG - Intergenic
1054812135 9:69443319-69443341 TGACCTCATCTGCATCCAGGTGG + Intronic
1056679254 9:88702817-88702839 TGACCACTGCTAGAGCATGGAGG + Intergenic
1056755930 9:89382115-89382137 TGGGCACTGCTGGTGCCAGGTGG - Intronic
1057040273 9:91842898-91842920 TCACCTCTGCTCGAGAGAGGGGG - Intronic
1057222006 9:93262522-93262544 TGCTCTCTTCTGCAGCCAGGTGG - Intronic
1058895983 9:109400997-109401019 TGACCTGTGATGGAACCAGTAGG - Intronic
1059344010 9:113616165-113616187 TGAGCTCTGCTGGACGGAGGCGG + Intergenic
1059515323 9:114889223-114889245 GGGTCTCTTCTGGAGCCAGGAGG - Intergenic
1059725283 9:117002777-117002799 TAAACTTTGCTGGAGCAAGGCGG - Intronic
1060736025 9:126067033-126067055 TGAGCTCTGCTGGGGGCTGGGGG + Intergenic
1061243819 9:129391025-129391047 TCACCTCTGCTAGAGGCAGACGG + Intergenic
1061923976 9:133797051-133797073 CCACCACTGCTAGAGCCAGGGGG + Intronic
1062056992 9:134473945-134473967 TGACCTGGGCTGGCGCCTGGGGG + Intergenic
1062199179 9:135292336-135292358 CTACCTCTGCTGGAAGCAGGAGG - Intergenic
1188167238 X:26876837-26876859 CTCCCTCTGCTTGAGCCAGGAGG + Intergenic
1189252949 X:39615020-39615042 TCAGCGCTGCTGGAACCAGGTGG + Intergenic
1189713169 X:43836598-43836620 TGACCTCTGCTGGAGGAAATGGG - Intronic
1189714699 X:43853411-43853433 TGCCCTCAGCTAGAGCAAGGAGG + Intronic
1190176351 X:48153826-48153848 TGGTCTCTGCTGGAGACAGGTGG - Intergenic
1192584654 X:72309421-72309443 TGAGCTCTGCTGGAGCCAACGGG - Intergenic
1193039295 X:76987641-76987663 TCTCCCCTGCTGGAGCCAGAGGG + Intergenic
1195520541 X:105823232-105823254 TGACCTCTGTTGGAACGAGCGGG - Intronic
1199976019 X:152895356-152895378 AGAACTCTGCCAGAGCCAGGGGG + Intergenic
1200274354 X:154717786-154717808 TGCCCTCTCATGGAGCCAGGGGG + Intronic
1201565894 Y:15365110-15365132 TGTCCACTGCTGGCGCCAGAAGG + Intergenic