ID: 961594755

View in Genome Browser
Species Human (GRCh38)
Location 3:128007204-128007226
Sequence CTGGAAGGCAGTCACTGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961594755_961594765 22 Left 961594755 3:128007204-128007226 CCCACACAGTGACTGCCTTCCAG No data
Right 961594765 3:128007249-128007271 CTGTTCCTAGCGGTTTCCGTGGG No data
961594755_961594769 30 Left 961594755 3:128007204-128007226 CCCACACAGTGACTGCCTTCCAG No data
Right 961594769 3:128007257-128007279 AGCGGTTTCCGTGGGGAAGGAGG No data
961594755_961594766 23 Left 961594755 3:128007204-128007226 CCCACACAGTGACTGCCTTCCAG No data
Right 961594766 3:128007250-128007272 TGTTCCTAGCGGTTTCCGTGGGG No data
961594755_961594763 12 Left 961594755 3:128007204-128007226 CCCACACAGTGACTGCCTTCCAG No data
Right 961594763 3:128007239-128007261 CTATTTCAGGCTGTTCCTAGCGG No data
961594755_961594768 27 Left 961594755 3:128007204-128007226 CCCACACAGTGACTGCCTTCCAG No data
Right 961594768 3:128007254-128007276 CCTAGCGGTTTCCGTGGGGAAGG No data
961594755_961594764 21 Left 961594755 3:128007204-128007226 CCCACACAGTGACTGCCTTCCAG No data
Right 961594764 3:128007248-128007270 GCTGTTCCTAGCGGTTTCCGTGG No data
961594755_961594760 -1 Left 961594755 3:128007204-128007226 CCCACACAGTGACTGCCTTCCAG No data
Right 961594760 3:128007226-128007248 GAGTGCCCGGTAGCTATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961594755 Original CRISPR CTGGAAGGCAGTCACTGTGT GGG (reversed) Intergenic
No off target data available for this crispr