ID: 961600769

View in Genome Browser
Species Human (GRCh38)
Location 3:128059964-128059986
Sequence GATACTACCTCCAAGGGGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 69}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961600769_961600773 11 Left 961600769 3:128059964-128059986 CCGAGCCCCTTGGAGGTAGTATC 0: 1
1: 0
2: 1
3: 5
4: 69
Right 961600773 3:128059998-128060020 TCTTTGTTCTCCCCCGTGCCTGG 0: 1
1: 0
2: 2
3: 15
4: 170
961600769_961600776 22 Left 961600769 3:128059964-128059986 CCGAGCCCCTTGGAGGTAGTATC 0: 1
1: 0
2: 1
3: 5
4: 69
Right 961600776 3:128060009-128060031 CCCCGTGCCTGGCGTTGAATTGG 0: 1
1: 1
2: 0
3: 18
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961600769 Original CRISPR GATACTACCTCCAAGGGGCT CGG (reversed) Intronic
901133686 1:6979209-6979231 GAAACTTCCTCCAAGGGGGCAGG - Intronic
906582901 1:46951126-46951148 GATAATACTTCCTAGGTGCTGGG + Intergenic
907730311 1:57059656-57059678 GGTATTACCTCCGAGAGGCTTGG + Intronic
916432089 1:164740214-164740236 GAAACTAGATCCAAGGTGCTGGG - Intronic
924651291 1:245929791-245929813 CTAACTACCTCCAAAGGGCTGGG + Intronic
1067146902 10:43700912-43700934 CCCACTACCCCCAAGGGGCTCGG + Intergenic
1069931052 10:71881871-71881893 GATCCTGCCCCCAAGTGGCTGGG + Intergenic
1070515597 10:77203058-77203080 GTTATTACCTGCAAGTGGCTTGG + Intronic
1070671002 10:78377244-78377266 GCCACTGCCTCCAAGGAGCTTGG + Intergenic
1076254838 10:129013850-129013872 GCTTTTTCCTCCAAGGGGCTGGG - Intergenic
1077444458 11:2583850-2583872 GATTCTGCCTCCATGGGGCGTGG - Intronic
1079697159 11:23496104-23496126 GACACTTTCTCCTAGGGGCTAGG + Intergenic
1085441899 11:76572415-76572437 GCTTCTACCTCCAAAGCGCTGGG + Intergenic
1098766795 12:74500395-74500417 ATTACTACCTATAAGGGGCTAGG - Intergenic
1102015635 12:109646115-109646137 GATACACACTTCAAGGGGCTGGG + Intergenic
1102612455 12:114124490-114124512 GATTCTACCTCCTTGTGGCTAGG - Intergenic
1103401655 12:120647236-120647258 GATAATACATGCAAAGGGCTTGG - Intronic
1104968490 12:132520605-132520627 GCTGCTACCTCCTGGGGGCTGGG - Intronic
1106836909 13:33644374-33644396 GATGCTACCCCCAAGGGCCAGGG - Intergenic
1111658559 13:91181007-91181029 GATACTACCACCTATGGGTTTGG + Intergenic
1119146078 14:72315756-72315778 GTTACAACCTCTAAGGGTCTTGG - Intronic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1119370365 14:74135356-74135378 TAAACTACCTCAAAGAGGCTGGG - Intronic
1122271522 14:100570467-100570489 GATACAGCCTCCAAGGGGGAGGG - Intronic
1125513094 15:40303229-40303251 GCTACTAGCTCCATGGGGCAAGG - Intronic
1131507395 15:93030310-93030332 AATACCAACTCCAAGGGGCCAGG - Intergenic
1132564529 16:615444-615466 GACACTTTCTCCAAGGGGCTTGG - Intronic
1134882455 16:17757538-17757560 CATACTACCTCACAGGGTCTTGG + Intergenic
1140514669 16:75533304-75533326 ATTTCTACCTCCAAGGGACTTGG - Intronic
1141809756 16:86367998-86368020 GATGCTGCTTCAAAGGGGCTCGG + Intergenic
1157878323 18:51294369-51294391 CATACCACCTCCAAGGGGTTTGG + Intergenic
1158932797 18:62337542-62337564 CATGCTTCCTCCAAGGGCCTTGG + Intronic
1164993809 19:32704553-32704575 AATATTACCTGCAAGAGGCTGGG - Intronic
926315695 2:11708074-11708096 GAGATGACCTCCAAGGGTCTAGG - Intronic
931559291 2:63540857-63540879 GATCCTCCCTCCAAGTAGCTGGG + Intronic
937255444 2:120552224-120552246 GGCGCTACCTCCAGGGGGCTGGG + Intergenic
943077418 2:183212088-183212110 CATACTACATCCAAGTGGCTGGG - Intergenic
945512119 2:210715375-210715397 GCTTCTTCCTCCAAGGGGTTGGG + Intergenic
1169297804 20:4414961-4414983 GATATCACCTCCAGGGGGCAGGG - Intergenic
1178104476 21:29302298-29302320 TTTACTCCCTCCAAGGGGCACGG - Intronic
1178460248 21:32796182-32796204 GATTCTGCTTCCAATGGGCTGGG + Intronic
1185376316 22:50484110-50484132 GTTCCTACCTCCAAGGGGGAGGG + Exonic
949555818 3:5151722-5151744 GATCCTATCTCCAAGGGGGGGGG - Intronic
949869549 3:8576383-8576405 GAGACTACCTGGGAGGGGCTGGG + Intergenic
952524505 3:34196235-34196257 GAAACTACCTACATGGGGCAGGG - Intergenic
960629906 3:119719668-119719690 GATGCTTCCTACAAGAGGCTTGG - Intronic
961600769 3:128059964-128059986 GATACTACCTCCAAGGGGCTCGG - Intronic
962750678 3:138432933-138432955 GATCCTGTCTCCAAGGGGTTTGG + Intergenic
965459709 3:168946909-168946931 CATAGTAACTCCAAAGGGCTTGG - Intergenic
966218698 3:177528992-177529014 GATACTCTCTTCAAGGGACTTGG + Intergenic
991192970 5:63897421-63897443 AATACCACCTCTAAGAGGCTTGG - Intergenic
993710448 5:91219538-91219560 AAAATTACCTCCATGGGGCTTGG + Intergenic
999381417 5:151124037-151124059 GATACTGCTTCCAGGAGGCTGGG + Intronic
999696039 5:154189929-154189951 CATTCTAACTCCAAGGGGGTTGG + Intronic
1000833706 5:166131806-166131828 GAGCCTCCCTCCAAGGGGATTGG - Intergenic
1005640797 6:27794226-27794248 GTTACTACCTTCCAGAGGCTAGG + Intergenic
1006638038 6:35474369-35474391 TATACTACCTCCCTGGGGCGGGG - Exonic
1007418215 6:41704451-41704473 CAGACCACCTCCAAGGTGCTAGG - Intronic
1017047734 6:150363338-150363360 GAAACTACTCCCAAGGGGCATGG + Intergenic
1018727050 6:166620997-166621019 AATCCTACCTCCACGGGGCAAGG + Intronic
1021120959 7:16795174-16795196 GCTACTAACTGCCAGGGGCTGGG - Intronic
1022574963 7:31488739-31488761 CATACTAACTCCAAGGAGCCCGG + Intergenic
1023319719 7:38981116-38981138 CATCCTACCTTCAAGGGGTTAGG - Intronic
1029572373 7:101378813-101378835 GGGACATCCTCCAAGGGGCTGGG - Intronic
1030068257 7:105677029-105677051 GATCCTCCCTCCACGGGGCCTGG - Intronic
1033110890 7:138574817-138574839 GATATTTGCTTCAAGGGGCTTGG + Intronic
1040533661 8:48287019-48287041 AATAGTACTTGCAAGGGGCTAGG - Intergenic
1045959200 8:107947328-107947350 AATACTACATCCAAGGATCTTGG + Intronic
1048329673 8:133463292-133463314 GATGCTACCTCCAGCGGCCTGGG + Intronic
1048846191 8:138605549-138605571 GCTACCACCTCCAACGGGCTGGG + Intronic
1060009563 9:120031772-120031794 GAGGCAACCACCAAGGGGCTGGG - Intergenic
1062055580 9:134468288-134468310 GGTAATACCTGCAAAGGGCTCGG - Intergenic
1190481254 X:50879188-50879210 GATAGTACCTCCACTGGCCTGGG + Intergenic
1193216366 X:78869025-78869047 GGTACTACCTCCAATGGACAAGG - Intergenic
1195786363 X:108527884-108527906 GATAGTAGCTGCAATGGGCTGGG - Intronic
1198385895 X:136129160-136129182 GAAACCACCTCCAAGGGGATGGG + Intergenic