ID: 961603732

View in Genome Browser
Species Human (GRCh38)
Location 3:128078521-128078543
Sequence CACCCAATCAGCTCCCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 1, 2: 2, 3: 21, 4: 200}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961603725_961603732 -7 Left 961603725 3:128078505-128078527 CCTCCCTCTCCTCAGCCACCCAA 0: 1
1: 1
2: 11
3: 256
4: 1224
Right 961603732 3:128078521-128078543 CACCCAATCAGCTCCCTGGGTGG 0: 1
1: 1
2: 2
3: 21
4: 200
961603724_961603732 -6 Left 961603724 3:128078504-128078526 CCCTCCCTCTCCTCAGCCACCCA 0: 1
1: 1
2: 13
3: 176
4: 1628
Right 961603732 3:128078521-128078543 CACCCAATCAGCTCCCTGGGTGG 0: 1
1: 1
2: 2
3: 21
4: 200
961603723_961603732 -3 Left 961603723 3:128078501-128078523 CCTCCCTCCCTCTCCTCAGCCAC 0: 1
1: 2
2: 25
3: 234
4: 1727
Right 961603732 3:128078521-128078543 CACCCAATCAGCTCCCTGGGTGG 0: 1
1: 1
2: 2
3: 21
4: 200
961603726_961603732 -10 Left 961603726 3:128078508-128078530 CCCTCTCCTCAGCCACCCAATCA 0: 1
1: 0
2: 5
3: 54
4: 729
Right 961603732 3:128078521-128078543 CACCCAATCAGCTCCCTGGGTGG 0: 1
1: 1
2: 2
3: 21
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961603732 Original CRISPR CACCCAATCAGCTCCCTGGG TGG Intronic
900078080 1:834174-834196 CACACAATGAGTTCCCTGAGAGG + Intergenic
900369194 1:2323923-2323945 TTCCCATTCAGGTCCCTGGGAGG + Intronic
900548798 1:3243318-3243340 CTCCCATCCAGATCCCTGGGAGG - Intronic
902101775 1:13996431-13996453 AACACACTAAGCTCCCTGGGTGG + Intergenic
902186993 1:14733036-14733058 GCTCCAAACAGCTCCCTGGGTGG + Intronic
902279113 1:15361503-15361525 CACTCACTCAGCTCTCTCGGTGG + Intronic
906208637 1:44000209-44000231 CACCAATTCAGCTCCCTGATGGG + Intronic
909577377 1:77189466-77189488 CATCTAATCAGCTGCCAGGGTGG + Intronic
910443952 1:87281875-87281897 CATCCAATCAGCTGCCAGTGTGG + Intergenic
911685774 1:100775513-100775535 CATCCAATCGGCTGCCAGGGTGG + Intergenic
911970259 1:104425910-104425932 CACCTAATCAGCTGCCAGTGTGG + Intergenic
916307902 1:163360267-163360289 CACCAAATCAAATCTCTGGGGGG - Intergenic
918924035 1:190756749-190756771 CATCTAATCAGCTGCCAGGGTGG + Intergenic
921723384 1:218498438-218498460 CACCCATTCATCTCTCTGGTAGG - Intergenic
923046796 1:230361748-230361770 CTCCCAGTCAGCTCCTGGGGAGG - Intronic
923344942 1:233042543-233042565 TATCCAATCTCCTCCCTGGGAGG + Intronic
923407004 1:233671488-233671510 CACCCAGTCATCTGCCTGCGTGG + Exonic
1063438607 10:6054196-6054218 CACCCAACCAGTTCCCCGGGGGG - Intronic
1063447450 10:6128285-6128307 CATCCAAGCAGGGCCCTGGGCGG - Intergenic
1064976862 10:21126061-21126083 TCCCCAACCAGCTTCCTGGGAGG + Exonic
1065864598 10:29903107-29903129 CATCCAATCGGCTCCCAGTGCGG - Intergenic
1067536856 10:47117146-47117168 CAGCCAATCAGATCTTTGGGAGG + Intergenic
1068280701 10:54865197-54865219 CATCCAATCAGCTGCCAGTGTGG + Intronic
1068523907 10:58106464-58106486 CACATAGTCAGCTCCCTGAGGGG - Intergenic
1069817270 10:71206386-71206408 CATCCAATCAGCTGCCAGTGTGG + Intergenic
1069994437 10:72333788-72333810 CACCCAAGCAGGTCCTTGTGGGG + Exonic
1071134601 10:82438454-82438476 AACACACTAAGCTCCCTGGGTGG - Intronic
1073044061 10:100625895-100625917 AACCCGATCAGTTTCCTGGGAGG + Intergenic
1073066520 10:100762936-100762958 TACCCAATCAGATCCCTGCAAGG - Intronic
1076508106 10:130991958-130991980 CACCCAATCTGCTGCCTGCATGG + Intergenic
1080959488 11:37141731-37141753 CACCTAATCAGCTGCCAGCGTGG + Intergenic
1081710210 11:45211320-45211342 CTCCCCATCACCTTCCTGGGGGG + Intronic
1083477266 11:62922565-62922587 TCCCCAGTCAGCTCCCGGGGAGG - Intergenic
1084419586 11:69053631-69053653 CACCCAATCGGCTCCCCAGAGGG - Intronic
1085371439 11:76010308-76010330 CCCCCAATAAGCTCCATGGAAGG - Intronic
1087483129 11:98727024-98727046 CATCCAATCAACTGCCAGGGTGG - Intergenic
1087578494 11:100022000-100022022 CATCCAATCAGCTGCCAGTGAGG - Intronic
1090481252 11:127070666-127070688 CATCCAATCAGCTGCCAGCGTGG - Intergenic
1091389767 12:118895-118917 CCCCGAGTCAGCTCCCTGGCAGG + Intronic
1094394244 12:29988660-29988682 CACCTAATCAGCTGCCAGAGTGG + Intergenic
1095992340 12:48044556-48044578 CACTGAAACCGCTCCCTGGGTGG + Exonic
1097237354 12:57549577-57549599 AACCCACTCAGCTTTCTGGGGGG - Intergenic
1099921984 12:88970067-88970089 CACCTAATCAGCTGCCAGCGTGG + Intergenic
1101227886 12:102708208-102708230 CACCCAATCAGCTGCCAGCGTGG - Intergenic
1103171915 12:118828131-118828153 CACCTTAGCAGCTCCCTGGGAGG + Intergenic
1104073741 12:125371199-125371221 CATCCAATCAGCTGCCAGTGTGG - Intronic
1104261055 12:127182400-127182422 CATCCAATCAGCTGCCAGTGTGG - Intergenic
1104430255 12:128710455-128710477 CACCCAATCTGCACCCAGGCTGG - Intergenic
1105276517 13:18933459-18933481 CACCTAATCAGCTGCCAGTGTGG + Intergenic
1106890145 13:34236129-34236151 AACACAATAAGCTCCCTGGGCGG - Intergenic
1107783294 13:43927837-43927859 CACCTAATCAGCTGCCAGCGAGG + Intergenic
1108882813 13:55142077-55142099 CATCCAATCAGCTGCCAGTGTGG + Intergenic
1110560250 13:76903769-76903791 CTTCCAGTCAGCTCCCTGGTGGG - Intergenic
1112602781 13:100873126-100873148 CTCCCACTCAGCAGCCTGGGAGG - Intergenic
1113218800 13:108074326-108074348 CATCCAATCAGCTGCCAGTGTGG - Intergenic
1113743112 13:112724693-112724715 GCCCCAAACAGCTTCCTGGGGGG - Intronic
1115391624 14:32860815-32860837 CATCCAATCAGCTGCCAGCGTGG + Intergenic
1115391635 14:32860878-32860900 CATCCAATCAGCTGCCAGCGTGG + Intergenic
1115391647 14:32860941-32860963 CATCCAATCAGCTGCCAGCGTGG + Intergenic
1117072465 14:52069121-52069143 CAGCCAATTAGCTTGCTGGGTGG - Intronic
1117934781 14:60890785-60890807 CACCTAATCAGCTGCCAGTGTGG - Intronic
1119748664 14:77062367-77062389 CACCCAACCAGCTCTCTCAGCGG - Intergenic
1120822102 14:88921484-88921506 CATCCAATCAGCTGCCAGGGTGG + Intergenic
1120948768 14:90022081-90022103 TAGCCTATGAGCTCCCTGGGAGG - Intronic
1122122148 14:99560389-99560411 CACTCAACGAGATCCCTGGGAGG + Intronic
1122182794 14:99968061-99968083 AACCCAAGCAGTGCCCTGGGAGG - Intergenic
1131232636 15:90670801-90670823 CATCCAACCAGGTCCCTGGGTGG - Intergenic
1131398999 15:92109789-92109811 CACCCCATCAGCCACCTGTGGGG - Intronic
1133125539 16:3643534-3643556 CACCCACTCCGCTCCGTGGTGGG - Intronic
1134817025 16:17214140-17214162 GAACCACTCATCTCCCTGGGAGG + Intronic
1135280165 16:21147339-21147361 CACCCATCCAGCTTCTTGGGAGG - Intronic
1136692254 16:32040296-32040318 CTCCAAATCAGGTCCCTGAGTGG + Intergenic
1136792750 16:32983525-32983547 CTCCAAATCAGTTCCCTGAGTGG + Intergenic
1136877105 16:33870529-33870551 CTCCAAATCAGGTCCCTGAGTGG - Intergenic
1139671737 16:68497054-68497076 CACTCACTTAGCTCCCTGGAGGG + Intergenic
1140658664 16:77166158-77166180 CATCCAATCAGCTCCCAGTGGGG - Intergenic
1141135667 16:81463665-81463687 CACTTATTCAGCCCCCTGGGTGG + Intronic
1141187468 16:81798176-81798198 TACCCCATCAGATCACTGGGAGG + Intronic
1142251199 16:88992834-88992856 CCCCCCATCAGCTGCCTGGGTGG + Intergenic
1203095007 16_KI270728v1_random:1245213-1245235 CTCCAAATCAGGTCCCTGAGTGG + Intergenic
1142895585 17:2975715-2975737 CACCTGAGCAGCTCCATGGGAGG + Intronic
1143780108 17:9224823-9224845 GCCCCCATCAGCTCCCAGGGGGG - Intronic
1144684249 17:17215759-17215781 CCCCCAATCAGCACCCAGGCTGG - Intronic
1144781737 17:17811773-17811795 GTCCCCATCAGGTCCCTGGGTGG - Intronic
1148395063 17:47301370-47301392 CAGCCAGTCAGCTTCCTGGTGGG + Intronic
1148481107 17:47960013-47960035 CATGCTATCATCTCCCTGGGGGG + Intergenic
1150122446 17:62615535-62615557 CTCCCAATCTGCACCCTAGGTGG - Intergenic
1151504263 17:74516210-74516232 CATCCAATCAGCTGCCAGTGTGG - Intergenic
1152945110 17:83193849-83193871 CACCCCATCAGCCCTCAGGGTGG + Intergenic
1155775239 18:29752991-29753013 CATCCAATCAGCTGCCAGTGAGG + Intergenic
1155856424 18:30839548-30839570 CACCCACTCAGCTTGCAGGGAGG - Intergenic
1156606081 18:38668787-38668809 CACCTAATCAGCTGCCAGTGAGG + Intergenic
1158073376 18:53499683-53499705 CAACCAATCAGTTGCTTGGGAGG - Intronic
1158456064 18:57608868-57608890 CACCCAATCAGCTACCAGCCTGG + Intronic
1158477341 18:57791897-57791919 AACCCCATAAGCTCCCTGAGGGG + Intronic
1160513774 18:79467246-79467268 CTCCCAAGCAGCCACCTGGGCGG - Intronic
1160935582 19:1592925-1592947 CCGCCAATCAGCGCGCTGGGAGG + Intergenic
1161821160 19:6531892-6531914 CACCCCATCTGCACCCTGGACGG + Intronic
1162683878 19:12365766-12365788 CTGTCAATCAGTTCCCTGGGGGG - Intronic
1163553984 19:17982414-17982436 CAGCCCCTCGGCTCCCTGGGAGG + Intronic
1163600802 19:18248042-18248064 GACCCATTCAGCTCCCAGAGTGG + Intronic
1166292025 19:41869508-41869530 CACCCCGTCAGCTCCCAGGGGGG + Intronic
1167455058 19:49593484-49593506 CAGCCAATCAGCTGCCTCGGGGG - Intronic
1168297626 19:55385091-55385113 CACCCCATCAGCTCCCTGGGAGG - Intergenic
925406190 2:3606651-3606673 CACCTGATCTGCTCCCTGGTCGG - Intronic
928415957 2:31091920-31091942 CATCCAATCAGCTGCCAGTGCGG + Intronic
929743697 2:44632739-44632761 CATCTAATCAGCTCCCAGTGTGG + Intronic
930456339 2:51612058-51612080 CACCTAATCAGCTGCCAGTGTGG - Intergenic
931920811 2:67013650-67013672 CACCTAATCAGCTGCCAGCGTGG - Intergenic
935943923 2:108269277-108269299 CTCCCAATGTGCCCCCTGGGTGG - Intergenic
937036642 2:118787629-118787651 CACCCCATCCCATCCCTGGGAGG - Intergenic
937096941 2:119241708-119241730 CTCCATATCAGCTCCCTGGAAGG + Intronic
938136852 2:128766007-128766029 AACACACTAAGCTCCCTGGGTGG - Intergenic
938193237 2:129301318-129301340 CCCCCACACAGCTCACTGGGAGG + Intergenic
940319218 2:152358017-152358039 CATCCAATCAGCTGCCAGTGTGG + Intronic
941989714 2:171543230-171543252 CTCCCAATCAGAGCCCTGGAAGG - Intronic
942108602 2:172658080-172658102 CACCCCACCACCTCCCAGGGAGG + Intergenic
942924047 2:181411321-181411343 AACACACTAAGCTCCCTGGGTGG + Intergenic
945772874 2:214066975-214066997 CACCCAGTATGCTCTCTGGGGGG + Intronic
948334546 2:237197246-237197268 CCCCCATCCAGCTCCTTGGGAGG + Intergenic
948721027 2:239899979-239900001 CATCTAATCAGCTCCCAGAGAGG + Intronic
1169263398 20:4153523-4153545 CAGCCAGCCAGGTCCCTGGGAGG - Intronic
1171207932 20:23295617-23295639 CACCCAGTTAGCTCCCTGGAGGG + Intergenic
1171296245 20:24019540-24019562 CATCCAATCAGCTGCCAGCGAGG + Intergenic
1171390593 20:24799245-24799267 CATCGGATCAGCTCCCTGGTGGG - Intergenic
1173709579 20:45142792-45142814 CAACTAATCAGCTGCCTGTGTGG - Intergenic
1174125183 20:48299109-48299131 CCCTCAATCAGCTCCCCGGCAGG - Intergenic
1175626016 20:60488878-60488900 CACCCAATCAGCTGCCAGGGTGG - Intergenic
1175642349 20:60641529-60641551 AACCCAATATGCTCCCTGTGTGG + Intergenic
1176108066 20:63398925-63398947 CACCCGACCTGCACCCTGGGCGG - Intergenic
1177300355 21:19236391-19236413 CATCCAATCAGCTGCCAGCGCGG + Intergenic
1178885531 21:36482004-36482026 CTCCCAATCCTCTCCCTGAGTGG + Intronic
1179480180 21:41671977-41671999 GCCCCCAGCAGCTCCCTGGGCGG - Intergenic
1180833698 22:18919320-18919342 CATCCCATGAGCTCCCTGGTGGG + Intronic
1181031071 22:20149122-20149144 CGCCCAAGCAGGGCCCTGGGTGG + Intronic
1181033526 22:20159278-20159300 CAACCCAGCAGCTCCTTGGGTGG + Intergenic
1181509782 22:23383966-23383988 CAACCCAGCAGCTCCTTGGGTGG - Intergenic
1182376049 22:29848895-29848917 CACCCTTTCATCTCCCTGGGTGG - Intergenic
1182696870 22:32204062-32204084 CACCCAATCCACTCCCTGCCAGG + Intergenic
1184741198 22:46429970-46429992 CACCCCATCTGCTTCCTGTGGGG + Intronic
1203283784 22_KI270734v1_random:144618-144640 CATCCCATGAGCTCCCTGGTGGG + Intergenic
950706253 3:14784337-14784359 CACCCAATCTCCTTCCTGGAAGG - Intergenic
952503816 3:33989363-33989385 AACACACTAAGCTCCCTGGGTGG - Intergenic
953427295 3:42805422-42805444 CATCCATTCCGCTCCCAGGGCGG + Intronic
953916728 3:46925190-46925212 ACCCCACTCAGATCCCTGGGAGG + Intronic
957070493 3:75564349-75564371 CACCCAAGCAGCTAACTAGGAGG + Intergenic
957568723 3:81918327-81918349 CAACCAATCACATTCCTGGGGGG + Intergenic
961603732 3:128078521-128078543 CACCCAATCAGCTCCCTGGGTGG + Intronic
963089721 3:141471730-141471752 CACTCCATCAGCTTCCGGGGTGG - Intergenic
964821552 3:160775884-160775906 AACCATATCAGCTGCCTGGGGGG + Intronic
966025140 3:175270143-175270165 CACTCAATCAGCTCCCATGGGGG - Intronic
966079821 3:175987669-175987691 TATCCAATCAGCTCCCAGTGTGG + Intergenic
966850257 3:184160571-184160593 CAGCCATTCAGCTCCATGGTGGG + Intronic
969583239 4:8077555-8077577 CTCCCAGTCAACTCCCAGGGGGG + Intronic
969636889 4:8374498-8374520 CACCTAAAAAGCTTCCTGGGGGG + Intronic
970928731 4:21483933-21483955 CATCTACTCAGCTTCCTGGGAGG - Intronic
971326958 4:25652509-25652531 CACACAATCACCTCCCAGGAAGG + Intergenic
974115860 4:57578536-57578558 CATCCAATCAGCTGCCAGTGTGG + Intergenic
979160894 4:117459777-117459799 CATCCAATCAGCTGCCAGTGTGG - Intergenic
983844079 4:172494821-172494843 CACCTAATCAGCTGCCAGTGCGG - Intronic
984850769 4:184150614-184150636 CACCCTCTCATCTTCCTGGGGGG - Intronic
984852057 4:184162934-184162956 CACCCACTCCGCTCCCCGAGTGG + Intronic
985476525 5:82410-82432 CTCCCACTGAGCTCCCTGGAGGG + Intergenic
985933213 5:3075491-3075513 TACCCAATCTGCTCACTAGGTGG - Intergenic
986708684 5:10471739-10471761 CCCCCAGTCACCTCCCTGGGGGG - Intronic
987467939 5:18294851-18294873 CATCCAATCAGCTGCCAGTGTGG - Intergenic
987805985 5:22769250-22769272 CATCCAATCAGCTGCCAGCGCGG + Intronic
988226081 5:28412644-28412666 CATCCAATCAGCTGCCAGCGTGG + Intergenic
988405174 5:30815083-30815105 CACCTAATCAGCTGCCAGTGTGG - Intergenic
996021117 5:118591803-118591825 CACCCAATTTGCTCCATGGGAGG + Intergenic
1001761897 5:174214372-174214394 CACCCACACAGCTCCCTGGGAGG - Intronic
1002104712 5:176874380-176874402 CACCTGCTCAGCCCCCTGGGTGG + Exonic
1202773412 5_GL000208v1_random:35183-35205 CACCCGAGCAGCTAACTGGGAGG - Intergenic
1004509193 6:16270811-16270833 CATCCCATCAGCTACCTGTGTGG - Intronic
1007521629 6:42454561-42454583 CTCCCGCTCAGGTCCCTGGGCGG - Intergenic
1007657110 6:43456972-43456994 CACCCACTCAGCTCCCTAGCTGG + Intergenic
1007750298 6:44067132-44067154 CACCCACTCACCCCTCTGGGTGG + Intergenic
1008325720 6:50178903-50178925 CATCCAATCGGCTGCCAGGGTGG - Intergenic
1010563827 6:77384272-77384294 CATCCAATCAGCTGCCAGTGTGG - Intergenic
1011044040 6:83062398-83062420 CACCCAACCATCTCCATGGGAGG + Intronic
1012260286 6:97080731-97080753 CCCCCAGTAAGCTCCATGGGAGG - Intronic
1014389303 6:120841260-120841282 CACCTAATCAGCTGCCAGAGTGG + Intergenic
1016495555 6:144657798-144657820 CAGCCATCCAGCACCCTGGGTGG + Intronic
1019218010 6:170455853-170455875 CACCAGATCAGCTCTGTGGGAGG + Intergenic
1021848435 7:24784873-24784895 CATCCAATCAGCTGCCAGTGAGG - Intergenic
1024259897 7:47566243-47566265 CACCCAAGCAGCTGCCCGGCTGG + Intronic
1024934864 7:54701938-54701960 CACCCCACCATCGCCCTGGGTGG - Intergenic
1025284504 7:57651119-57651141 CACCCAAGCACCTCCATGGAGGG + Intergenic
1029353264 7:100030642-100030664 CAGCCACTCAGTTGCCTGGGAGG + Intronic
1030506997 7:110437173-110437195 CATCCAATCAGCTGCCAGCGTGG + Intergenic
1030559389 7:111065584-111065606 CATCTAATCAGCTGCCTGTGTGG + Intronic
1030701593 7:112647001-112647023 AACACGCTCAGCTCCCTGGGAGG - Intergenic
1032419166 7:131764241-131764263 CACCCACTGTGCTCCCTGGCTGG - Intergenic
1032776785 7:135122125-135122147 AACACACTAAGCTCCCTGGGTGG + Intronic
1033586734 7:142779873-142779895 GACCGAATCAGCTTCCTCGGAGG + Intergenic
1033707333 7:143902211-143902233 CGACCAATCAGCTCCCTGGAAGG - Intergenic
1035125889 7:156607598-156607620 CACCCACTCAGCTCCCAGCGCGG + Intergenic
1035352818 7:158258489-158258511 CACCCAGGCAGCTCCCTCCGTGG - Intronic
1035527539 8:325495-325517 CACACAATGAGTTCCCTGAGAGG - Intergenic
1037177767 8:15967069-15967091 CACCTAATCAGCTGCCAGTGTGG + Intergenic
1039467421 8:37794724-37794746 CACTTCATCACCTCCCTGGGTGG + Intronic
1039843495 8:41309511-41309533 CAGCCAATCAGCTCCCGGCGGGG + Intergenic
1043001790 8:74768634-74768656 CATCCAATCAGCTGCCTGTAGGG - Intronic
1044613781 8:94119580-94119602 CACCCAGCCAGCTCGGTGGGGGG - Intergenic
1047031216 8:120883292-120883314 GACCCAATTAGCTCCCAGAGAGG + Intergenic
1047535632 8:125717246-125717268 CACCCCAGCAGCTCCTTGGAGGG - Intergenic
1048427693 8:134338132-134338154 CACCAAATCAGAATCCTGGGTGG - Intergenic
1049372328 8:142273767-142273789 CACCCAGTCAGGCCCCTGCGTGG + Intronic
1049758360 8:144320738-144320760 CATCTAATCACCTTCCTGGGGGG + Intronic
1050520937 9:6498914-6498936 CACACACTCACCTGCCTGGGTGG - Intronic
1053262992 9:36686934-36686956 CATCTAATCAGCTGCCAGGGTGG - Intergenic
1059562160 9:115346355-115346377 CATCTAATCAGCTGCCTGCGAGG + Intronic
1061014131 9:127972196-127972218 CAGCCAAGCATCTCCCTGTGGGG + Intronic
1061095745 9:128456056-128456078 AACCCAAGCGGCTCCCGGGGGGG + Intronic
1061488560 9:130933044-130933066 CACCCAAGCCCCTCCCTGGTGGG + Intronic
1062669633 9:137700269-137700291 TACACAAGCAGCTCCCGGGGAGG - Intronic
1185934198 X:4237210-4237232 CACCCACTCTGCTCCTTGGAGGG - Intergenic
1186794423 X:13030589-13030611 CAACCAGTCAGCTCCCAGAGCGG + Intergenic
1187405504 X:19000435-19000457 CACACACCCAGCTGCCTGGGAGG - Intronic
1188163667 X:26834338-26834360 CATCCAATCAGCTACCAGGGTGG + Intergenic
1189064816 X:37796126-37796148 CACTCACTCAGCTCCATGGATGG - Exonic
1189091929 X:38092607-38092629 CATCCAATCAGCTGCCAGTGTGG - Intronic
1192312340 X:70027450-70027472 CACAAAGTCAGCTCTCTGGGAGG - Intronic
1196737207 X:118990337-118990359 CACTAAATCAACTCTCTGGGAGG + Intronic
1197049590 X:122042589-122042611 AACCCATTAAGCTCCCGGGGTGG - Intergenic