ID: 961604177

View in Genome Browser
Species Human (GRCh38)
Location 3:128081593-128081615
Sequence GGCTCCTGGACCCTCTCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 2, 2: 1, 3: 22, 4: 197}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961604177 Original CRISPR GGCTCCTGGACCCTCTCTGA TGG (reversed) Intronic
900195833 1:1375064-1375086 GGCGCCCGGACCCTCTCGGCTGG + Exonic
900315171 1:2052660-2052682 GGCACCCGGTGCCTCTCTGAGGG + Intronic
900605058 1:3520157-3520179 CACTCCTGGGCCCTGTCTGAGGG - Intronic
901712715 1:11128293-11128315 GGCTCCCGGGCCCTCTGGGACGG + Intronic
901808712 1:11753631-11753653 AACTCTTGGACACTCTCTGAAGG + Intronic
902627379 1:17684491-17684513 TGCACCTGGGCCTTCTCTGAGGG + Intronic
903832310 1:26182639-26182661 GGATCCTGGACCCTATTTCAGGG - Intronic
903958113 1:27039247-27039269 GGCTCATTGAGCCTCTCTGATGG + Intergenic
905216095 1:36408779-36408801 GGTTCCTGGACATTTTCTGATGG + Intergenic
905351029 1:37346591-37346613 GGCTCCTCGTCCCTCTATAAAGG + Intergenic
906204239 1:43978847-43978869 GGGTCCTGCCCCCTCTCTGCTGG + Intergenic
907317252 1:53580239-53580261 GGTTCCTGCACCCTCTTTCAGGG + Intronic
907983217 1:59505422-59505444 GACTCCAGGACCCTCTCTGCTGG + Intronic
911101215 1:94097178-94097200 GGGTCCTGGGCTCTCACTGATGG + Intronic
912582990 1:110736900-110736922 GGCTCCTGGACTCCATCTGAGGG + Intergenic
914881102 1:151547785-151547807 AGCTCCTGAACCAACTCTGAAGG - Intronic
915931657 1:160064192-160064214 GGTCCCTGGACCCTTTCGGAGGG + Intronic
917971356 1:180210104-180210126 AGTGCCTGGACCCTCCCTGATGG - Intergenic
918154145 1:181829652-181829674 GCCTTCTCGACCTTCTCTGAGGG - Intergenic
920347550 1:205316424-205316446 TGCTCTTGGAGCCTCTCTGCAGG - Intronic
920379205 1:205526168-205526190 GGATGCTGTACCCTCTCGGATGG - Exonic
920390055 1:205594207-205594229 GGCTCCTGGGCCCTCGCCCATGG - Intronic
920766078 1:208835179-208835201 GGCTCCTGGACTCCCTTTTAGGG + Intergenic
921395255 1:214662361-214662383 GTGTCCTGGACACACTCTGAGGG + Intronic
922011431 1:221592653-221592675 AGCTCTTGGATCCTTTCTGATGG + Intergenic
922354328 1:224761682-224761704 GGCTCCTGTACCCTAAATGATGG + Intergenic
922465732 1:225844792-225844814 GGCACCTGGTCCCTCCATGAGGG - Intronic
1062970055 10:1640457-1640479 GGCCCCTGGAGCCCCTCTAATGG - Intronic
1063137897 10:3233158-3233180 GGCACCTGGAGCCCCACTGATGG + Intergenic
1065731653 10:28714798-28714820 GGATCTTGGACCATTTCTGAGGG - Intergenic
1066255009 10:33670249-33670271 GGCCCCTGGATCCTCTCAGTGGG - Intergenic
1071392748 10:85191787-85191809 GGCCTTTGGTCCCTCTCTGAAGG + Intergenic
1072527024 10:96281195-96281217 GTCTACTGGACCCTCTTTCAAGG - Intergenic
1073478846 10:103772768-103772790 GGCTCCTCGCCCCTCCCAGAGGG + Intronic
1073957926 10:108893606-108893628 GTCTTCTGGACCCTCTCAGCTGG + Intergenic
1074141748 10:110679672-110679694 AGCCCCTGGATCCTCTCTGAAGG + Intronic
1075120291 10:119659601-119659623 GGCAAGGGGACCCTCTCTGATGG - Intronic
1075325254 10:121526634-121526656 GGCACCTGGGCTCTTTCTGAAGG - Intronic
1075867715 10:125741176-125741198 GGCAACTGGACTCTCTGTGAAGG - Exonic
1076888453 10:133273062-133273084 GGGGCCTGGACCCTCCCTCAGGG + Intronic
1077105369 11:839964-839986 GGCTCCTGTACCCTCTCTCTCGG - Exonic
1078355690 11:10629920-10629942 GGCTCCAGGACCATTTGTGACGG - Intronic
1083623131 11:64058789-64058811 AGGGCCTGGATCCTCTCTGACGG + Intronic
1084502998 11:69545878-69545900 TCCTCCTGGAGGCTCTCTGAGGG - Intergenic
1085208061 11:74749003-74749025 GGCTTCTGGACCTTCGCTGTTGG + Exonic
1086935654 11:92743219-92743241 GGATCCTGGCCCCTCTTTTAAGG + Intronic
1089740115 11:120576708-120576730 ACCTCTTGGGCCCTCTCTGAGGG - Intronic
1089747522 11:120627643-120627665 GGCTGCTGCCCCCTCCCTGAAGG + Intronic
1090943610 11:131410187-131410209 GGCTTCTGCACCCTCCTTGATGG - Intronic
1095812737 12:46387755-46387777 TGCTGATGGAGCCTCTCTGAAGG + Intergenic
1096784517 12:54009368-54009390 GGCTCCTGCCCACGCTCTGAGGG - Exonic
1096882920 12:54687218-54687240 GGACCCTGGACCCACTCTGAAGG + Intergenic
1101268571 12:103118424-103118446 GAATCTTGGACCATCTCTGATGG - Intergenic
1102148366 12:110671458-110671480 GGCTCCTGGACGCTTTGGGATGG - Intronic
1102520808 12:113476635-113476657 GGCTCCGGGCCGCTCTCAGACGG - Intergenic
1104866408 12:131958253-131958275 GTCCCCTGCACCCACTCTGATGG + Intronic
1108021924 13:46136373-46136395 GGCACATGGACCCTGTCCGAGGG - Intronic
1111449083 13:88390765-88390787 GGCCTCTGGACCCTGTCTGGTGG - Intergenic
1114627045 14:24136603-24136625 GGCCCCGGGACCCTCCCTGAGGG - Intronic
1119181011 14:72605274-72605296 TGCTCCTGCTCCCTCTCTGCTGG - Intergenic
1120347471 14:83308811-83308833 AGCTTCTGTACCCTCTCTGCTGG - Intergenic
1120766761 14:88334514-88334536 GGCTCGTGCACCATCTGTGAGGG - Intergenic
1121220473 14:92281176-92281198 GGCTCCTGGGGCCCCTCTCAAGG + Intergenic
1121446992 14:93985124-93985146 GGCTCGTAAACCCGCTCTGAAGG + Intergenic
1121457620 14:94048748-94048770 TGCTCCTAGACTCTCTCTCATGG - Exonic
1122282857 14:100634492-100634514 GGCTCCAGCATCCTCTCTGTAGG - Intergenic
1122437182 14:101708189-101708211 GGGTCCTGGGCCCTATCTGGGGG + Intergenic
1123990970 15:25683058-25683080 GGCTCCTGGAGACTCTTGGAGGG + Intronic
1124211842 15:27770494-27770516 GGCTCCAGGACCCTCCCCGCAGG + Intronic
1128555805 15:68631009-68631031 GGGTCTTGGACCCTCTCCCAAGG + Intronic
1129140890 15:73597007-73597029 GGGTGCTGGACTCACTCTGAAGG + Exonic
1132639901 16:973054-973076 GGCTCCTGGATTCTTTTTGATGG - Intronic
1132770223 16:1558062-1558084 GTCTCCTGGACACCATCTGAGGG + Exonic
1132933505 16:2470221-2470243 TGTTCCTGGACCCTCTTTGGTGG + Intergenic
1133254278 16:4507084-4507106 TGCCCCTGGAGCCACTCTGAGGG + Intronic
1134234102 16:12452085-12452107 GGGTGCTGGACCCACCCTGAGGG + Intronic
1136662574 16:31777222-31777244 GGCTACTAGACCTTCTCAGATGG - Intronic
1136671478 16:31862418-31862440 GCCTCCTGGACGCTCTCTGCAGG + Intergenic
1137728365 16:50672174-50672196 TGATCCTGGAACTTCTCTGATGG - Exonic
1137737182 16:50733592-50733614 GACTCCTGGAGCCACTTTGAGGG - Intergenic
1138138621 16:54546751-54546773 GGCTCCTGGAGCCTCTTTGCTGG - Intergenic
1139354981 16:66362187-66362209 GGATCCTCAACCCTCTCTCAAGG + Intergenic
1140025812 16:71289376-71289398 GCCTCCTGGTCCCTGTCTGCCGG - Exonic
1140755866 16:78066119-78066141 GGCTCCTGCACGAGCTCTGAGGG - Intronic
1141733739 16:85839100-85839122 GGCTTCTGGACCTGCTCTGCTGG - Intergenic
1142138756 16:88463279-88463301 GGCACCTGGTCCCTCACTGGGGG - Intronic
1144430062 17:15183142-15183164 GGCTCCTGAACCTTCTTCGAGGG + Intergenic
1144628738 17:16858810-16858832 GGGTCCAGGACCCTTTCTGAAGG - Intergenic
1144736176 17:17556733-17556755 GGCTCATGTGGCCTCTCTGAAGG - Intronic
1145747883 17:27333271-27333293 GGCCCCGGGTCCCTCTCTGGAGG - Intergenic
1146695124 17:34903066-34903088 AGCTCCTGTTCCCTGTCTGAAGG - Intergenic
1148587437 17:48790956-48790978 GGCCCCAGGACGCTCTCTGCTGG + Intronic
1148873972 17:50675698-50675720 GTCACCTGCACCTTCTCTGATGG - Exonic
1151318022 17:73335802-73335824 GACTCCTGAACTCCCTCTGATGG - Exonic
1151733370 17:75923768-75923790 GGCTCCTGGACCGGCTCAGGTGG + Intronic
1151830519 17:76546592-76546614 GGCTCCCGTAGCCTCTCTGTGGG + Intronic
1151902543 17:77026196-77026218 GACTCCTGGACCCACAATGAGGG + Intergenic
1154410092 18:14135460-14135482 GTCTCATGGACCCTCTCTTCAGG + Intergenic
1156239553 18:35240192-35240214 GACTCCTGGAGCCTATCTTAGGG - Intergenic
1157484073 18:48074516-48074538 AGCTGCTGGGCTCTCTCTGATGG - Intronic
1161068753 19:2250354-2250376 GGCTCCTGGAACCTCAGCGAGGG - Exonic
1161306627 19:3572623-3572645 GACTCCTCCTCCCTCTCTGAAGG - Intronic
1161319377 19:3633923-3633945 GGCTCCTGGAAGCTCTCTATGGG + Intronic
1161800615 19:6415270-6415292 AGCTCCTGGACCCCCTCCGGTGG + Exonic
1162644025 19:12035608-12035630 GGCACCTGAACCCTCTCGGAGGG + Exonic
1162899460 19:13786006-13786028 GGCTCCTGAACTCACACTGAGGG - Intergenic
1162968850 19:14168181-14168203 CTCTCCTGGCCCCTCTCTGAAGG + Intronic
1163233810 19:16019956-16019978 GGATCCAGGGCCCTCTCTCAAGG + Intergenic
1163538705 19:17893815-17893837 GGCTCTTGGACCCCCTGTGTTGG + Exonic
1163698262 19:18774791-18774813 GGCCCCTGGAACCTCCCAGACGG - Intronic
1164508472 19:28878425-28878447 GGCTTCTGGCAGCTCTCTGAAGG + Intergenic
1165110328 19:33498593-33498615 GCCTCCAGGACCCTGTCTCAAGG - Intronic
1165110350 19:33498681-33498703 GTCTCCAGGACCCTGTCTCAAGG - Intronic
1165110362 19:33498725-33498747 GCCTCCAGGACCCTGTCTCAAGG - Intronic
1165110397 19:33498857-33498879 GCCTCCAGGACCCTGTCTCAGGG - Intronic
1165711346 19:38013003-38013025 GCCTCCTTTACCCTTTCTGAGGG + Intronic
1166094365 19:40530159-40530181 GCCTCCTGAACCATCTCTAATGG - Intronic
1166391234 19:42409952-42409974 GGCTCCAGATCCCTCCCTGAGGG + Intronic
1166682427 19:44777320-44777342 AGCCCCTTGCCCCTCTCTGAAGG + Intergenic
1166740088 19:45109360-45109382 GCCTCCTCTGCCCTCTCTGAGGG - Intronic
1166803089 19:45469890-45469912 GACTCCTGGAACTGCTCTGAAGG - Intronic
1168245618 19:55111999-55112021 GGCTCCTGGACCCCATATGAAGG + Intronic
1168249886 19:55135874-55135896 GGCTCCTGGAAGCCCTCTGGGGG - Intronic
1168323064 19:55521770-55521792 GGCTCCCAGCCCCTCTCTGCAGG + Intergenic
1168676874 19:58284973-58284995 GGAGCATGGACCCTGTCTGAAGG - Intronic
926840489 2:17074325-17074347 GACTTCTGGACCCACTATGATGG - Intergenic
933691815 2:85184687-85184709 AGCACTTGGACCCTCTCTCAGGG + Intronic
933694354 2:85206100-85206122 GGCTCCTGTACCCTGTCTGCAGG + Intronic
934180350 2:89613371-89613393 GCCTCCTGCACCCTGTTTGAAGG + Intergenic
937004305 2:118497227-118497249 GCCTCCTTGCTCCTCTCTGAAGG + Intergenic
937061414 2:118982750-118982772 GACTCTTGGACCCCCTCTTAGGG - Intronic
937284974 2:120744864-120744886 GATTCCTGGACCCACTCTGCAGG - Intronic
938120062 2:128626913-128626935 GGCTCCTGAGCCCTCTCTGTGGG + Intergenic
939805986 2:146776492-146776514 GTCTTCTGGACCCTCTCAGTTGG - Intergenic
940765895 2:157789181-157789203 GGCACCTGGAGCCTTTCTGTGGG - Intronic
943006313 2:182391499-182391521 GTCTTCTGGACCCTCTCAGCTGG - Intronic
943384277 2:187182857-187182879 AGCTTCTGGACCCTCTCAGCTGG + Intergenic
945186313 2:207143631-207143653 GGCTCGTGGAGGCTCTCTCAAGG + Intronic
945758102 2:213875338-213875360 GCTTCCTGGAACCTCTTTGATGG - Intronic
946252321 2:218421238-218421260 GCCCCCTGGCCCCTCTCTGCTGG - Intronic
948125795 2:235563989-235564011 GCCTCCTGGAGCCTCTTTGTGGG + Intronic
1170923775 20:20704113-20704135 GGCTTCTGTACCCTCTGTGAAGG - Intronic
1172747428 20:37223058-37223080 TGCTCCAGGACCCTGGCTGAAGG + Intronic
1173284475 20:41657738-41657760 GGCAACTGGACCCTCTCCGCAGG + Intergenic
1174814873 20:53678037-53678059 TGCTCCTGAACCTTCTGTGATGG + Intergenic
1175399765 20:58693429-58693451 GGCCCCTGCCCCCTCTCTGGTGG + Intronic
1175795090 20:61766114-61766136 GGCTCCTGGACCCAGACCGAGGG - Intronic
1176022014 20:62966818-62966840 GACACCCGGACCCCCTCTGAAGG - Intronic
1176362166 21:6006696-6006718 GGCTCCTGGACCCTCCCTGAGGG + Intergenic
1176862971 21:14022951-14022973 GTCTCATGGACCCTCTCTTCAGG - Intergenic
1177363477 21:20103870-20103892 GTCTCCTGGACCCTCCCAGCTGG - Intergenic
1179761352 21:43531849-43531871 GGCTCCTGGACCCTCCCTGAGGG - Intronic
1179803759 21:43824518-43824540 GGCTCCTCTCCCCTCGCTGATGG + Intergenic
1181047368 22:20221975-20221997 GCCTCCTGGCATCTCTCTGAGGG + Intergenic
1182298937 22:29327364-29327386 GGCCCCTGGAGCCTCCCAGATGG + Intergenic
1183234927 22:36610016-36610038 TGCTCCGGGAGGCTCTCTGAGGG - Intronic
1183267318 22:36836690-36836712 AGCTCCTGGACCCTTTCAGCTGG + Intergenic
1183485299 22:38085039-38085061 GGCTCCAGGACTCTCCCTGGGGG - Exonic
1184892572 22:47388942-47388964 GGCTCAAGGACCCCCACTGAGGG + Intergenic
1185155693 22:49192172-49192194 AGCTCCAGGTCCCTCTCTGGTGG + Intergenic
950517195 3:13475021-13475043 GGCTGCAGGGGCCTCTCTGAAGG + Intergenic
950707589 3:14792697-14792719 GGCTGCTGGAACCTCTGAGATGG + Intergenic
953160489 3:40415158-40415180 TGGTCATGGAGCCTCTCTGAAGG - Intronic
954292401 3:49656509-49656531 GGCTCCTGCAGCCTCCTTGATGG - Exonic
956702402 3:71970011-71970033 CACACCTGCACCCTCTCTGAAGG + Intergenic
961328574 3:126125955-126125977 GGATACTGGACCATTTCTGATGG + Intronic
961604177 3:128081593-128081615 GGCTCCTGGACCCTCTCTGATGG - Intronic
964483942 3:157168044-157168066 GGGCCCTGGACCCTCTATTAGGG - Intergenic
968858564 4:3148186-3148208 GGCTCCTGGACCCGCAATAAAGG + Exonic
970320642 4:14872264-14872286 GGCTCCTGAACCCTCACTGAGGG + Intergenic
973965290 4:56155656-56155678 AGCTCCTGGGCCCTCACTCAAGG + Intergenic
979349307 4:119627427-119627449 GGCTCCTCGACCATCACTGCCGG + Intronic
985166155 4:187096757-187096779 AGCTCATGGACCCTGTCTCAGGG - Intergenic
985558431 5:569485-569507 GGCCCCGGGGCCCTCTCTGATGG + Intergenic
985676530 5:1234376-1234398 GCCTCCTGGCACCTCTCTGAGGG + Intronic
986525052 5:8664675-8664697 GTCTTCTGGACCCTCCCAGATGG - Intergenic
986605979 5:9523306-9523328 AGCTCCTGGTCTCTCTTTGAAGG + Intronic
994893478 5:105669898-105669920 AGCTTGTGTACCCTCTCTGATGG + Intergenic
1000384238 5:160658675-160658697 GGTTGCTAGACCCTCTCTGGGGG + Intronic
1001137251 5:169112784-169112806 ATCTCCTGGATCCTCTCTGCTGG + Intronic
1002922290 6:1581198-1581220 GACTCCCGGGCCCTCTCTGTGGG + Intergenic
1003128760 6:3377447-3377469 GCCTCCTGGACCCTCTGGCAGGG + Intronic
1005952240 6:30640536-30640558 GCCCCCTGCTCCCTCTCTGAGGG + Exonic
1007772366 6:44201904-44201926 GGCTCTGGGACCCTCTCTCAGGG - Intergenic
1008864721 6:56195747-56195769 TGCTCCTGGACCTTTTCTGTTGG - Intronic
1016838113 6:148499610-148499632 GGCTCCCAGACCCTCTTTGCTGG - Intronic
1024238371 7:47414980-47415002 AGATCCTGGGCCCTCTCGGAAGG + Intronic
1028048879 7:86158321-86158343 GGCTGCTGCACCCTCCCTCAAGG - Intergenic
1033213085 7:139474982-139475004 GGGTCCTGGCCCATCTCTGAAGG + Intronic
1034042792 7:147897052-147897074 GGCTTCTGAGCACTCTCTGAAGG + Intronic
1034387821 7:150755119-150755141 GGCTGCTGCACCCTCTATGTGGG - Intergenic
1036092394 8:5681608-5681630 GGCTCCAGGAGCCTCTCAAAAGG - Intergenic
1038054250 8:23843335-23843357 GGCAGCTGGACCATCTCTGTAGG - Exonic
1038145010 8:24887409-24887431 GGCTCCTGGTCTCCCTCTGAGGG - Intergenic
1041938380 8:63359874-63359896 GACTGCTGGGCCTTCTCTGAGGG + Intergenic
1043289077 8:78573271-78573293 GTCTCCGTGACCCTCTGTGAAGG + Intronic
1045426650 8:102073722-102073744 AGCTTCAGGACCCTTTCTGAGGG + Intronic
1046417905 8:113939797-113939819 GTCTTCTGGACCCTCTCAGCTGG + Intergenic
1047499476 8:125430629-125430651 GGCTCCCGGAGCCTCGCTGGGGG - Exonic
1048976222 8:139674486-139674508 GTCTCCTGCAACCTCTGTGAGGG + Intronic
1049192348 8:141295291-141295313 GGATCCTGGTGCCTCTCTCAGGG - Intronic
1049956234 9:695638-695660 GGGTTCTGGATCCTCTCTGGGGG + Intronic
1050326326 9:4501376-4501398 GCCATGTGGACCCTCTCTGAGGG - Intronic
1057231668 9:93325131-93325153 GGCACCAGCACCCTCGCTGATGG + Intronic
1057972137 9:99568486-99568508 GGCTCTTGGGCCCTCCCTTAGGG - Intergenic
1058711555 9:107683606-107683628 GGCTCCAGGACCCTCTCATCTGG + Intergenic
1059251436 9:112890675-112890697 GGCTCATGTGACCTCTCTGATGG + Exonic
1059333061 9:113548641-113548663 GGCTCCAGGACTCTCCCAGATGG - Intronic
1061132050 9:128713771-128713793 GGCTCCTAGCCGCTCTCTCAGGG + Intronic
1062149346 9:135009525-135009547 TGCTCATGGCCCCTCTCTGCAGG - Intergenic
1062303511 9:135889016-135889038 GGATCCTCTCCCCTCTCTGAGGG - Intronic
1062684296 9:137802277-137802299 GGCTTCTGAACCCTCTGTGACGG - Intronic
1185642632 X:1597053-1597075 GGCTCCTGGACAGCCTCTGGTGG + Intronic
1187129583 X:16489476-16489498 GGCTAATGGACTCCCTCTGAAGG + Intergenic
1189232813 X:39465558-39465580 CCCTGCTGGCCCCTCTCTGATGG - Intergenic
1189734517 X:44056093-44056115 GGCTCCAGGACCTGCTCTCAAGG - Intergenic
1195064988 X:101232476-101232498 GTCTCCTGGAGCCTCACAGATGG + Intronic
1198215270 X:134549640-134549662 GGCTCCGGGAGCCTCTCCGCCGG - Intergenic
1199765290 X:150936843-150936865 GGCCTCTCGCCCCTCTCTGAAGG - Intergenic
1200109421 X:153732763-153732785 GGCTCCTGGCCCTGCTCTGGTGG + Intronic
1200225007 X:154412369-154412391 GGCTCCTGCAGCATCCCTGAGGG + Intronic
1202373638 Y:24214435-24214457 GGCTCCTGGCCCCTTTCTTCAGG + Intergenic
1202497143 Y:25455685-25455707 GGCTCCTGGCCCCTTTCTTCAGG - Intergenic