ID: 961608278

View in Genome Browser
Species Human (GRCh38)
Location 3:128114668-128114690
Sequence GTGCAGATGCCTAATGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 121}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961608278_961608281 10 Left 961608278 3:128114668-128114690 CCTGCCTCATTAGGCATCTGCAC 0: 1
1: 0
2: 0
3: 5
4: 121
Right 961608281 3:128114701-128114723 AAGGCTGACACCTTGAAAACTGG 0: 1
1: 0
2: 0
3: 12
4: 159
961608278_961608280 -9 Left 961608278 3:128114668-128114690 CCTGCCTCATTAGGCATCTGCAC 0: 1
1: 0
2: 0
3: 5
4: 121
Right 961608280 3:128114682-128114704 CATCTGCACTTGTGAGCTCAAGG 0: 1
1: 0
2: 3
3: 14
4: 167
961608278_961608283 30 Left 961608278 3:128114668-128114690 CCTGCCTCATTAGGCATCTGCAC 0: 1
1: 0
2: 0
3: 5
4: 121
Right 961608283 3:128114721-128114743 TGGTATTCTTCTAAGAGCAAAGG 0: 1
1: 0
2: 1
3: 21
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961608278 Original CRISPR GTGCAGATGCCTAATGAGGC AGG (reversed) Intronic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
900874232 1:5330254-5330276 GAGCAGATGTCACATGAGGCTGG + Intergenic
902372714 1:16016106-16016128 GGGCAGATGCCCAATGTGCCCGG - Intronic
902460207 1:16569227-16569249 CTGCAGATTCCTGATGAGCCAGG + Exonic
903159733 1:21478131-21478153 CTGCAGATTCCTGATGAGCCAGG - Exonic
905265946 1:36754499-36754521 GTGCAGATGGCTAAGCTGGCAGG - Intergenic
905919517 1:41710163-41710185 GTGCAGATGAGAAATGTGGCAGG - Intronic
911210238 1:95131427-95131449 GGGCAGGTGCCAACTGAGGCTGG + Intronic
913605210 1:120459354-120459376 CTGCAGATTCCTGATGAGCCAGG - Intergenic
913642077 1:120822091-120822113 CTGCAGATTCCTGATGAGCCAGG - Exonic
913989959 1:143601940-143601962 CTGCAGATTCCTGACGAGGCAGG + Intergenic
914083328 1:144429854-144429876 CTGCAGATTCCTGATGAGCCAGG + Exonic
914189352 1:145395132-145395154 CTGCAGATTCCTGATGAGCCAGG + Exonic
914211200 1:145580844-145580866 CTGCAGATTCCTGATGAGCCAGG + Intergenic
914276404 1:146128273-146128295 CTGCAGATTCCTGATGAGCCAGG + Exonic
914366413 1:146982915-146982937 CTGCAGATTCCTGATGAGCCAGG - Exonic
914380921 1:147115468-147115490 CTGCAGATTCCTGATGAGCCAGG + Intergenic
914486034 1:148110532-148110554 CTGCAGATTCCTGATGAGCCAGG + Exonic
914537448 1:148579228-148579250 CTGCAGATTCCTGATGAGCCAGG + Exonic
914586366 1:149065680-149065702 CTGCAGATTCCTGATGAGCCAGG + Exonic
914628478 1:149486117-149486139 CTGCAGATTCCTGATGAGCCAGG - Intergenic
916950474 1:169775283-169775305 GTACACATGCCTAATTATGCTGG - Intronic
919140007 1:193558691-193558713 GTCCAGATGCCTGGTGATGCTGG - Intergenic
919970456 1:202573634-202573656 GTGCAGATGACTACTTAGGAAGG + Intronic
922343351 1:224675144-224675166 GGGGAGATGCCTGATGAGGGAGG + Intronic
924027428 1:239849769-239849791 TTGCAAATACCTTATGAGGCAGG - Intronic
1063191624 10:3700046-3700068 TTGGAGACGCCTGATGAGGCTGG - Intergenic
1065298547 10:24300122-24300144 CTGCAGATGCCCAGTGAGGAAGG - Intronic
1068343847 10:55744688-55744710 GTGCATATAACTAATGAGGAGGG + Intergenic
1078180669 11:9007411-9007433 GAGCAGAGGCCTGCTGAGGCAGG + Intergenic
1085581635 11:77656256-77656278 GTGAATATGCTTGATGAGGCAGG + Intergenic
1089393201 11:118116019-118116041 GTCCTGATGGCCAATGAGGCCGG - Intronic
1089461799 11:118658236-118658258 GTGCAGAGGTTTAATGGGGCAGG + Exonic
1092099742 12:5873379-5873401 GTGCAGATGACAAATGAATCTGG + Intronic
1095232467 12:39757170-39757192 GTCCAAATCCCTATTGAGGCTGG - Exonic
1095940896 12:47726122-47726144 TTTCAGATTCCTTATGAGGCAGG + Intergenic
1096310334 12:50515121-50515143 TTTCAGAAGCTTAATGAGGCAGG - Intronic
1097273378 12:57793516-57793538 TTTAAGATGCCTAATGTGGCCGG - Intronic
1099311483 12:81031345-81031367 GTGAAAATCCCCAATGAGGCAGG - Intronic
1104464990 12:128983095-128983117 GAGCAGGTGTCTGATGAGGCGGG - Exonic
1104494283 12:129222172-129222194 CTGCAGATCCCACATGAGGCTGG + Intronic
1105064612 12:133185586-133185608 GTGCAGAGGCCAGATCAGGCTGG + Intronic
1106179847 13:27361290-27361312 GAGCAGCTGTCCAATGAGGCTGG + Intergenic
1112503724 13:99960945-99960967 CTGCAAGTGCCTAATCAGGCAGG - Intergenic
1112593954 13:100790966-100790988 TCACAGAAGCCTAATGAGGCAGG + Intergenic
1113665152 13:112136276-112136298 GTGAAGTTGCCAACTGAGGCAGG - Intergenic
1115678805 14:35712984-35713006 GGGCAGAGGCCTAATCATGCAGG + Intronic
1119523149 14:75301272-75301294 GTGGAGATGGTAAATGAGGCTGG + Intergenic
1125108538 15:36003334-36003356 TTGCAGAAGGTTAATGAGGCTGG - Intergenic
1128749378 15:70138091-70138113 GCCCAGCTGCCTAAGGAGGCAGG + Intergenic
1132413406 15:101603003-101603025 GGGCAGGTGCCAAATCAGGCTGG + Intergenic
1133336858 16:5011958-5011980 GTGCAGATCCATCATGAAGCAGG - Intronic
1133446857 16:5868653-5868675 TTTCAGATGCCTAGTGAGGCAGG + Intergenic
1134625027 16:15717421-15717443 GTGCAGAGGCCAAACAAGGCAGG - Intronic
1135617774 16:23927065-23927087 ATGCAGATGGCTAACCAGGCAGG + Intronic
1135858566 16:26034251-26034273 GTGCAGATGCCCAGTGACCCAGG + Intronic
1137637700 16:50001397-50001419 GTGCACATGATTATTGAGGCTGG - Intergenic
1138412420 16:56850930-56850952 GTGCAGATGGCTAAGGAGGTAGG + Intergenic
1142806936 17:2376256-2376278 GTGCAGGTGCCTTGTGGGGCGGG + Exonic
1146212425 17:30952893-30952915 CTTCAGATGTGTAATGAGGCTGG + Intronic
1146561080 17:33871201-33871223 GTTCAGAAGCTGAATGAGGCTGG + Intronic
1155237487 18:23835287-23835309 GTGGAGATGGCTAAGGGGGCAGG + Intronic
1156406649 18:36789015-36789037 GTGCAGAGACCTAGAGAGGCTGG + Intronic
1156958726 18:42996930-42996952 GTGCAGAAGCCTAAAGAAGGAGG - Intronic
1161233056 19:3184985-3185007 GTACAGCTGCCTAAGGAGTCAGG - Intergenic
1163126481 19:15246877-15246899 GACCAGATGCCTAAAGGGGCTGG + Intronic
1167036150 19:46996058-46996080 GTGCATATGCAGAAGGAGGCTGG + Intronic
1168496691 19:56857966-56857988 GTGCACAAGGCTTATGAGGCTGG + Intergenic
1202676639 1_KI270711v1_random:12955-12977 CTGCAGATTCCTGATGAGCCAGG + Intergenic
925222625 2:2154168-2154190 GGGCTGATGCCCAATGACGCTGG + Intronic
925317235 2:2935854-2935876 GTGCAGATGTTTAGTGAGGTCGG - Intergenic
931896499 2:66736820-66736842 CTGCAGATGTCCCATGAGGCAGG - Intergenic
932772526 2:74508340-74508362 GAGCAGATGCCGAAGGAGGAGGG + Exonic
939564584 2:143772037-143772059 ATTCAGATGCCTAGTGGGGCCGG + Intergenic
940608574 2:155960796-155960818 GGTCAGATGGCTAATGGGGCTGG + Intergenic
941347509 2:164388590-164388612 GGGCAGAGGCCTAATGACACCGG - Intergenic
946844422 2:223846767-223846789 GGGCAGAAGCCTAATGAGAATGG - Intergenic
1173280689 20:41624560-41624582 GGGTAGATGCCTAAGGAGACTGG + Intergenic
1174086207 20:48009580-48009602 GTGCAGATGACTTATGAACCTGG + Intergenic
1176416473 21:6478370-6478392 TTTCTGATGACTAATGAGGCCGG - Intergenic
1179486008 21:41711160-41711182 GTGCAGATGCCTGCTGTGGAAGG - Intergenic
1179630742 21:42676989-42677011 GGGCAGCTGGTTAATGAGGCCGG - Intronic
1179691973 21:43086705-43086727 TTTCTGATGACTAATGAGGCCGG - Intergenic
1184028947 22:41879563-41879585 TTGCAGATTCCAAAGGAGGCAGG - Intronic
949143490 3:664957-664979 GTGCAGATGCCCTATGAGGATGG - Intergenic
949411248 3:3766807-3766829 GTGAAGATGGATAATCAGGCAGG + Intronic
949566097 3:5246165-5246187 TTGCAGATGGCTTAGGAGGCTGG - Intergenic
953519824 3:43631259-43631281 TTGCAGATCTCAAATGAGGCTGG - Intronic
953949739 3:47179843-47179865 TTGAAGATGCCCACTGAGGCAGG - Intergenic
954834695 3:53455602-53455624 GTGGAGCTGCATAATGAGGATGG - Intergenic
955567265 3:60260776-60260798 ATGCAGATGCGTAAAGAAGCTGG + Intronic
961608278 3:128114668-128114690 GTGCAGATGCCTAATGAGGCAGG - Intronic
962709875 3:138077354-138077376 GTGCAGATGCCAGAGGAGCCCGG + Intronic
964169046 3:153745253-153745275 GGGCAGATCCCTGATGATGCTGG + Intergenic
964282720 3:155084082-155084104 GTCCAAATGCTTAATGTGGCTGG - Intronic
966344517 3:178963790-178963812 GATCAGAGGCCTAAGGAGGCAGG - Intergenic
966797179 3:183726661-183726683 GGGAATATGCCTAATGAGGGAGG - Intronic
967442722 3:189527647-189527669 AGGCAGATGCATAATGAGGTGGG - Intergenic
968810898 4:2799288-2799310 CTGCAGCTGCCTAATGAGGTGGG + Intronic
968981335 4:3851336-3851358 GCACAGATGTCTGATGAGGCGGG - Intergenic
973010465 4:45066431-45066453 GTGCAGATAATTAATGAGGTGGG + Intergenic
974958516 4:68672612-68672634 TTGCAGATTTTTAATGAGGCAGG - Intergenic
979748674 4:124248483-124248505 GTGCAAATGCCTGATGAGAAGGG + Intergenic
980243110 4:130202336-130202358 GGGCAGATCCCTGGTGAGGCAGG + Intergenic
982873877 4:160620001-160620023 GTGCAGATGCAGAAAGAGGGTGG - Intergenic
995178283 5:109204687-109204709 GTGCAGATGCCCTTTGTGGCTGG - Intergenic
997592912 5:135086586-135086608 GTGCAGAGGCCTTATGATGGGGG + Intronic
998228055 5:140341968-140341990 GGGCTGATGCCTAATGGGTCAGG + Intronic
1001486735 5:172125176-172125198 ATGCAGATGCCGAAAGAGCCAGG - Intronic
1002885059 6:1286120-1286142 GTGCTGATGCCTCATGCAGCAGG + Intergenic
1004191374 6:13466709-13466731 CTGCAGATGCCTCGTGAAGCAGG - Intronic
1006425008 6:33958388-33958410 GTGCACTTTCCTAATGAGCCTGG + Intergenic
1006860985 6:37171186-37171208 GTCCAGGAGCCTAATGACGCCGG - Exonic
1017453167 6:154573606-154573628 GTGGAAATAGCTAATGAGGCCGG - Intergenic
1020097535 7:5377159-5377181 GGGCAGATGCCCAATGCGGGTGG - Intronic
1020124681 7:5526852-5526874 GTGCAGATGCTTGAGGAGGTGGG - Intergenic
1020905592 7:14060553-14060575 ATGTATATGCTTAATGAGGCTGG + Intergenic
1021109176 7:16674456-16674478 GTCCAGGGGCTTAATGAGGCTGG + Exonic
1034492738 7:151402657-151402679 GTAGAGATGACTGATGAGGCCGG + Intronic
1037646602 8:20798124-20798146 CAGCAGATGCCTAGTGAGGCAGG - Intergenic
1041625071 8:60016084-60016106 TTACAGATGCCAGATGAGGCTGG + Intergenic
1048216211 8:132498070-132498092 GTGCAGATGTCTCAGGTGGCAGG - Intergenic
1051616622 9:19012994-19013016 TGGCAGAGGCCTGATGAGGCAGG - Intronic
1058426937 9:104883408-104883430 GTGCACATGCATGATGAGCCGGG - Intronic
1058835381 9:108855209-108855231 ATGCAGCTGCTCAATGAGGCGGG - Exonic
1188743237 X:33811072-33811094 GTACAGGTGCCTGATGTGGCAGG + Intergenic
1201613223 Y:15866266-15866288 GTGCAGTTGGGCAATGAGGCAGG - Intergenic