ID: 961609205

View in Genome Browser
Species Human (GRCh38)
Location 3:128123410-128123432
Sequence GAGGGGCGCCGCCCTGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 275}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961609205_961609220 20 Left 961609205 3:128123410-128123432 CCAGCTCCAGGGCGGCGCCCCTC 0: 1
1: 0
2: 3
3: 24
4: 275
Right 961609220 3:128123453-128123475 TCACTTCCCTGAGGAAATAATGG 0: 1
1: 0
2: 1
3: 22
4: 264
961609205_961609222 24 Left 961609205 3:128123410-128123432 CCAGCTCCAGGGCGGCGCCCCTC 0: 1
1: 0
2: 3
3: 24
4: 275
Right 961609222 3:128123457-128123479 TTCCCTGAGGAAATAATGGCGGG 0: 1
1: 0
2: 2
3: 24
4: 220
961609205_961609207 -10 Left 961609205 3:128123410-128123432 CCAGCTCCAGGGCGGCGCCCCTC 0: 1
1: 0
2: 3
3: 24
4: 275
Right 961609207 3:128123423-128123445 GGCGCCCCTCCCCGAGCCCCTGG 0: 1
1: 0
2: 3
3: 62
4: 1133
961609205_961609217 11 Left 961609205 3:128123410-128123432 CCAGCTCCAGGGCGGCGCCCCTC 0: 1
1: 0
2: 3
3: 24
4: 275
Right 961609217 3:128123444-128123466 GGCCCATTTTCACTTCCCTGAGG 0: 1
1: 0
2: 0
3: 22
4: 214
961609205_961609221 23 Left 961609205 3:128123410-128123432 CCAGCTCCAGGGCGGCGCCCCTC 0: 1
1: 0
2: 3
3: 24
4: 275
Right 961609221 3:128123456-128123478 CTTCCCTGAGGAAATAATGGCGG 0: 1
1: 0
2: 2
3: 36
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961609205 Original CRISPR GAGGGGCGCCGCCCTGGAGC TGG (reversed) Intronic