ID: 961609207

View in Genome Browser
Species Human (GRCh38)
Location 3:128123423-128123445
Sequence GGCGCCCCTCCCCGAGCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1199
Summary {0: 1, 1: 0, 2: 3, 3: 62, 4: 1133}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961609192_961609207 30 Left 961609192 3:128123370-128123392 CCAGTGGATCGTCACTAGGTATC 0: 1
1: 0
2: 0
3: 1
4: 18
Right 961609207 3:128123423-128123445 GGCGCCCCTCCCCGAGCCCCTGG 0: 1
1: 0
2: 3
3: 62
4: 1133
961609197_961609207 8 Left 961609197 3:128123392-128123414 CCTGGGGCGGCCCCTCACCCAGC 0: 1
1: 0
2: 3
3: 58
4: 456
Right 961609207 3:128123423-128123445 GGCGCCCCTCCCCGAGCCCCTGG 0: 1
1: 0
2: 3
3: 62
4: 1133
961609203_961609207 -4 Left 961609203 3:128123404-128123426 CCTCACCCAGCTCCAGGGCGGCG 0: 1
1: 0
2: 1
3: 37
4: 426
Right 961609207 3:128123423-128123445 GGCGCCCCTCCCCGAGCCCCTGG 0: 1
1: 0
2: 3
3: 62
4: 1133
961609202_961609207 -3 Left 961609202 3:128123403-128123425 CCCTCACCCAGCTCCAGGGCGGC 0: 1
1: 0
2: 2
3: 31
4: 314
Right 961609207 3:128123423-128123445 GGCGCCCCTCCCCGAGCCCCTGG 0: 1
1: 0
2: 3
3: 62
4: 1133
961609205_961609207 -10 Left 961609205 3:128123410-128123432 CCAGCTCCAGGGCGGCGCCCCTC 0: 1
1: 0
2: 3
3: 24
4: 275
Right 961609207 3:128123423-128123445 GGCGCCCCTCCCCGAGCCCCTGG 0: 1
1: 0
2: 3
3: 62
4: 1133
961609200_961609207 -2 Left 961609200 3:128123402-128123424 CCCCTCACCCAGCTCCAGGGCGG 0: 1
1: 0
2: 0
3: 41
4: 422
Right 961609207 3:128123423-128123445 GGCGCCCCTCCCCGAGCCCCTGG 0: 1
1: 0
2: 3
3: 62
4: 1133
961609204_961609207 -9 Left 961609204 3:128123409-128123431 CCCAGCTCCAGGGCGGCGCCCCT 0: 1
1: 0
2: 0
3: 12
4: 175
Right 961609207 3:128123423-128123445 GGCGCCCCTCCCCGAGCCCCTGG 0: 1
1: 0
2: 3
3: 62
4: 1133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961609207 Original CRISPR GGCGCCCCTCCCCGAGCCCC TGG Intronic