ID: 961609217

View in Genome Browser
Species Human (GRCh38)
Location 3:128123444-128123466
Sequence GGCCCATTTTCACTTCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 214}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961609203_961609217 17 Left 961609203 3:128123404-128123426 CCTCACCCAGCTCCAGGGCGGCG 0: 1
1: 0
2: 1
3: 37
4: 426
Right 961609217 3:128123444-128123466 GGCCCATTTTCACTTCCCTGAGG 0: 1
1: 0
2: 0
3: 22
4: 214
961609202_961609217 18 Left 961609202 3:128123403-128123425 CCCTCACCCAGCTCCAGGGCGGC 0: 1
1: 0
2: 2
3: 31
4: 314
Right 961609217 3:128123444-128123466 GGCCCATTTTCACTTCCCTGAGG 0: 1
1: 0
2: 0
3: 22
4: 214
961609210_961609217 -8 Left 961609210 3:128123429-128123451 CCTCCCCGAGCCCCTGGCCCATT 0: 1
1: 0
2: 1
3: 39
4: 417
Right 961609217 3:128123444-128123466 GGCCCATTTTCACTTCCCTGAGG 0: 1
1: 0
2: 0
3: 22
4: 214
961609200_961609217 19 Left 961609200 3:128123402-128123424 CCCCTCACCCAGCTCCAGGGCGG 0: 1
1: 0
2: 0
3: 41
4: 422
Right 961609217 3:128123444-128123466 GGCCCATTTTCACTTCCCTGAGG 0: 1
1: 0
2: 0
3: 22
4: 214
961609197_961609217 29 Left 961609197 3:128123392-128123414 CCTGGGGCGGCCCCTCACCCAGC 0: 1
1: 0
2: 3
3: 58
4: 456
Right 961609217 3:128123444-128123466 GGCCCATTTTCACTTCCCTGAGG 0: 1
1: 0
2: 0
3: 22
4: 214
961609209_961609217 -7 Left 961609209 3:128123428-128123450 CCCTCCCCGAGCCCCTGGCCCAT 0: 1
1: 1
2: 2
3: 77
4: 692
Right 961609217 3:128123444-128123466 GGCCCATTTTCACTTCCCTGAGG 0: 1
1: 0
2: 0
3: 22
4: 214
961609205_961609217 11 Left 961609205 3:128123410-128123432 CCAGCTCCAGGGCGGCGCCCCTC 0: 1
1: 0
2: 3
3: 24
4: 275
Right 961609217 3:128123444-128123466 GGCCCATTTTCACTTCCCTGAGG 0: 1
1: 0
2: 0
3: 22
4: 214
961609206_961609217 5 Left 961609206 3:128123416-128123438 CCAGGGCGGCGCCCCTCCCCGAG 0: 1
1: 0
2: 2
3: 21
4: 238
Right 961609217 3:128123444-128123466 GGCCCATTTTCACTTCCCTGAGG 0: 1
1: 0
2: 0
3: 22
4: 214
961609204_961609217 12 Left 961609204 3:128123409-128123431 CCCAGCTCCAGGGCGGCGCCCCT 0: 1
1: 0
2: 0
3: 12
4: 175
Right 961609217 3:128123444-128123466 GGCCCATTTTCACTTCCCTGAGG 0: 1
1: 0
2: 0
3: 22
4: 214
961609208_961609217 -6 Left 961609208 3:128123427-128123449 CCCCTCCCCGAGCCCCTGGCCCA 0: 1
1: 1
2: 8
3: 123
4: 1561
Right 961609217 3:128123444-128123466 GGCCCATTTTCACTTCCCTGAGG 0: 1
1: 0
2: 0
3: 22
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961609217 Original CRISPR GGCCCATTTTCACTTCCCTG AGG Intronic