ID: 961609220

View in Genome Browser
Species Human (GRCh38)
Location 3:128123453-128123475
Sequence TCACTTCCCTGAGGAAATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 264}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961609200_961609220 28 Left 961609200 3:128123402-128123424 CCCCTCACCCAGCTCCAGGGCGG 0: 1
1: 0
2: 0
3: 41
4: 422
Right 961609220 3:128123453-128123475 TCACTTCCCTGAGGAAATAATGG 0: 1
1: 0
2: 1
3: 22
4: 264
961609202_961609220 27 Left 961609202 3:128123403-128123425 CCCTCACCCAGCTCCAGGGCGGC 0: 1
1: 0
2: 2
3: 31
4: 314
Right 961609220 3:128123453-128123475 TCACTTCCCTGAGGAAATAATGG 0: 1
1: 0
2: 1
3: 22
4: 264
961609214_961609220 -9 Left 961609214 3:128123439-128123461 CCCCTGGCCCATTTTCACTTCCC 0: 1
1: 1
2: 3
3: 28
4: 312
Right 961609220 3:128123453-128123475 TCACTTCCCTGAGGAAATAATGG 0: 1
1: 0
2: 1
3: 22
4: 264
961609203_961609220 26 Left 961609203 3:128123404-128123426 CCTCACCCAGCTCCAGGGCGGCG 0: 1
1: 0
2: 1
3: 37
4: 426
Right 961609220 3:128123453-128123475 TCACTTCCCTGAGGAAATAATGG 0: 1
1: 0
2: 1
3: 22
4: 264
961609211_961609220 -2 Left 961609211 3:128123432-128123454 CCCCGAGCCCCTGGCCCATTTTC 0: 1
1: 0
2: 1
3: 27
4: 225
Right 961609220 3:128123453-128123475 TCACTTCCCTGAGGAAATAATGG 0: 1
1: 0
2: 1
3: 22
4: 264
961609215_961609220 -10 Left 961609215 3:128123440-128123462 CCCTGGCCCATTTTCACTTCCCT 0: 1
1: 1
2: 4
3: 39
4: 363
Right 961609220 3:128123453-128123475 TCACTTCCCTGAGGAAATAATGG 0: 1
1: 0
2: 1
3: 22
4: 264
961609212_961609220 -3 Left 961609212 3:128123433-128123455 CCCGAGCCCCTGGCCCATTTTCA 0: 1
1: 1
2: 7
3: 47
4: 502
Right 961609220 3:128123453-128123475 TCACTTCCCTGAGGAAATAATGG 0: 1
1: 0
2: 1
3: 22
4: 264
961609213_961609220 -4 Left 961609213 3:128123434-128123456 CCGAGCCCCTGGCCCATTTTCAC 0: 1
1: 0
2: 5
3: 34
4: 320
Right 961609220 3:128123453-128123475 TCACTTCCCTGAGGAAATAATGG 0: 1
1: 0
2: 1
3: 22
4: 264
961609204_961609220 21 Left 961609204 3:128123409-128123431 CCCAGCTCCAGGGCGGCGCCCCT 0: 1
1: 0
2: 0
3: 12
4: 175
Right 961609220 3:128123453-128123475 TCACTTCCCTGAGGAAATAATGG 0: 1
1: 0
2: 1
3: 22
4: 264
961609209_961609220 2 Left 961609209 3:128123428-128123450 CCCTCCCCGAGCCCCTGGCCCAT 0: 1
1: 1
2: 2
3: 77
4: 692
Right 961609220 3:128123453-128123475 TCACTTCCCTGAGGAAATAATGG 0: 1
1: 0
2: 1
3: 22
4: 264
961609208_961609220 3 Left 961609208 3:128123427-128123449 CCCCTCCCCGAGCCCCTGGCCCA 0: 1
1: 1
2: 8
3: 123
4: 1561
Right 961609220 3:128123453-128123475 TCACTTCCCTGAGGAAATAATGG 0: 1
1: 0
2: 1
3: 22
4: 264
961609205_961609220 20 Left 961609205 3:128123410-128123432 CCAGCTCCAGGGCGGCGCCCCTC 0: 1
1: 0
2: 3
3: 24
4: 275
Right 961609220 3:128123453-128123475 TCACTTCCCTGAGGAAATAATGG 0: 1
1: 0
2: 1
3: 22
4: 264
961609206_961609220 14 Left 961609206 3:128123416-128123438 CCAGGGCGGCGCCCCTCCCCGAG 0: 1
1: 0
2: 2
3: 21
4: 238
Right 961609220 3:128123453-128123475 TCACTTCCCTGAGGAAATAATGG 0: 1
1: 0
2: 1
3: 22
4: 264
961609210_961609220 1 Left 961609210 3:128123429-128123451 CCTCCCCGAGCCCCTGGCCCATT 0: 1
1: 0
2: 1
3: 39
4: 417
Right 961609220 3:128123453-128123475 TCACTTCCCTGAGGAAATAATGG 0: 1
1: 0
2: 1
3: 22
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961609220 Original CRISPR TCACTTCCCTGAGGAAATAA TGG Intronic