ID: 961609222

View in Genome Browser
Species Human (GRCh38)
Location 3:128123457-128123479
Sequence TTCCCTGAGGAAATAATGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 220}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961609204_961609222 25 Left 961609204 3:128123409-128123431 CCCAGCTCCAGGGCGGCGCCCCT 0: 1
1: 0
2: 0
3: 12
4: 175
Right 961609222 3:128123457-128123479 TTCCCTGAGGAAATAATGGCGGG 0: 1
1: 0
2: 2
3: 24
4: 220
961609214_961609222 -5 Left 961609214 3:128123439-128123461 CCCCTGGCCCATTTTCACTTCCC 0: 1
1: 1
2: 3
3: 28
4: 312
Right 961609222 3:128123457-128123479 TTCCCTGAGGAAATAATGGCGGG 0: 1
1: 0
2: 2
3: 24
4: 220
961609208_961609222 7 Left 961609208 3:128123427-128123449 CCCCTCCCCGAGCCCCTGGCCCA 0: 1
1: 1
2: 8
3: 123
4: 1561
Right 961609222 3:128123457-128123479 TTCCCTGAGGAAATAATGGCGGG 0: 1
1: 0
2: 2
3: 24
4: 220
961609205_961609222 24 Left 961609205 3:128123410-128123432 CCAGCTCCAGGGCGGCGCCCCTC 0: 1
1: 0
2: 3
3: 24
4: 275
Right 961609222 3:128123457-128123479 TTCCCTGAGGAAATAATGGCGGG 0: 1
1: 0
2: 2
3: 24
4: 220
961609209_961609222 6 Left 961609209 3:128123428-128123450 CCCTCCCCGAGCCCCTGGCCCAT 0: 1
1: 1
2: 2
3: 77
4: 692
Right 961609222 3:128123457-128123479 TTCCCTGAGGAAATAATGGCGGG 0: 1
1: 0
2: 2
3: 24
4: 220
961609213_961609222 0 Left 961609213 3:128123434-128123456 CCGAGCCCCTGGCCCATTTTCAC 0: 1
1: 0
2: 5
3: 34
4: 320
Right 961609222 3:128123457-128123479 TTCCCTGAGGAAATAATGGCGGG 0: 1
1: 0
2: 2
3: 24
4: 220
961609211_961609222 2 Left 961609211 3:128123432-128123454 CCCCGAGCCCCTGGCCCATTTTC 0: 1
1: 0
2: 1
3: 27
4: 225
Right 961609222 3:128123457-128123479 TTCCCTGAGGAAATAATGGCGGG 0: 1
1: 0
2: 2
3: 24
4: 220
961609210_961609222 5 Left 961609210 3:128123429-128123451 CCTCCCCGAGCCCCTGGCCCATT 0: 1
1: 0
2: 1
3: 39
4: 417
Right 961609222 3:128123457-128123479 TTCCCTGAGGAAATAATGGCGGG 0: 1
1: 0
2: 2
3: 24
4: 220
961609203_961609222 30 Left 961609203 3:128123404-128123426 CCTCACCCAGCTCCAGGGCGGCG 0: 1
1: 0
2: 1
3: 37
4: 426
Right 961609222 3:128123457-128123479 TTCCCTGAGGAAATAATGGCGGG 0: 1
1: 0
2: 2
3: 24
4: 220
961609215_961609222 -6 Left 961609215 3:128123440-128123462 CCCTGGCCCATTTTCACTTCCCT 0: 1
1: 1
2: 4
3: 39
4: 363
Right 961609222 3:128123457-128123479 TTCCCTGAGGAAATAATGGCGGG 0: 1
1: 0
2: 2
3: 24
4: 220
961609212_961609222 1 Left 961609212 3:128123433-128123455 CCCGAGCCCCTGGCCCATTTTCA 0: 1
1: 1
2: 7
3: 47
4: 502
Right 961609222 3:128123457-128123479 TTCCCTGAGGAAATAATGGCGGG 0: 1
1: 0
2: 2
3: 24
4: 220
961609206_961609222 18 Left 961609206 3:128123416-128123438 CCAGGGCGGCGCCCCTCCCCGAG 0: 1
1: 0
2: 2
3: 21
4: 238
Right 961609222 3:128123457-128123479 TTCCCTGAGGAAATAATGGCGGG 0: 1
1: 0
2: 2
3: 24
4: 220
961609216_961609222 -7 Left 961609216 3:128123441-128123463 CCTGGCCCATTTTCACTTCCCTG 0: 1
1: 1
2: 2
3: 31
4: 338
Right 961609222 3:128123457-128123479 TTCCCTGAGGAAATAATGGCGGG 0: 1
1: 0
2: 2
3: 24
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961609222 Original CRISPR TTCCCTGAGGAAATAATGGC GGG Intronic