ID: 961609311

View in Genome Browser
Species Human (GRCh38)
Location 3:128123929-128123951
Sequence CCGGAGACACAGACGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 108}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961609311_961609329 24 Left 961609311 3:128123929-128123951 CCCACTTCCGTCTGTGTCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 108
Right 961609329 3:128123976-128123998 TTCCTGCCGAGGCTGGGGTCGGG 0: 1
1: 0
2: 1
3: 16
4: 275
961609311_961609325 17 Left 961609311 3:128123929-128123951 CCCACTTCCGTCTGTGTCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 108
Right 961609325 3:128123969-128123991 CCGGCGCTTCCTGCCGAGGCTGG 0: 1
1: 0
2: 1
3: 7
4: 131
961609311_961609323 13 Left 961609311 3:128123929-128123951 CCCACTTCCGTCTGTGTCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 108
Right 961609323 3:128123965-128123987 GTAGCCGGCGCTTCCTGCCGAGG 0: 1
1: 0
2: 1
3: 4
4: 64
961609311_961609327 19 Left 961609311 3:128123929-128123951 CCCACTTCCGTCTGTGTCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 108
Right 961609327 3:128123971-128123993 GGCGCTTCCTGCCGAGGCTGGGG 0: 1
1: 0
2: 2
3: 20
4: 257
961609311_961609318 -2 Left 961609311 3:128123929-128123951 CCCACTTCCGTCTGTGTCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 108
Right 961609318 3:128123950-128123972 GGGTTGGCTTCCCCCGTAGCCGG 0: 1
1: 0
2: 0
3: 11
4: 250
961609311_961609326 18 Left 961609311 3:128123929-128123951 CCCACTTCCGTCTGTGTCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 108
Right 961609326 3:128123970-128123992 CGGCGCTTCCTGCCGAGGCTGGG 0: 1
1: 0
2: 3
3: 6
4: 89
961609311_961609328 23 Left 961609311 3:128123929-128123951 CCCACTTCCGTCTGTGTCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 108
Right 961609328 3:128123975-128123997 CTTCCTGCCGAGGCTGGGGTCGG 0: 1
1: 0
2: 2
3: 33
4: 380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961609311 Original CRISPR CCGGAGACACAGACGGAAGT GGG (reversed) Intronic
900333044 1:2146091-2146113 CCGAGGAGACAGATGGAAGTAGG + Exonic
900887662 1:5426815-5426837 CCGCAGAGACAGAAGCAAGTTGG - Intergenic
901776132 1:11561462-11561484 GCGGAGACACAGAGGGGAATCGG - Intergenic
902939688 1:19791760-19791782 CAGGAGTCACTGACGGAAGGAGG + Intronic
903146012 1:21372429-21372451 TCAGAGACACAGACAGAAGCTGG - Intergenic
903149646 1:21397803-21397825 CCGGAAGCAGAGCCGGAAGTGGG + Intergenic
903744388 1:25576909-25576931 CCTGAGACACAGACCCAAGGAGG + Intergenic
907403241 1:54238549-54238571 CAGGGGACACAGGAGGAAGTGGG + Intronic
907618911 1:55955491-55955513 CTGGAGAGAGAGACGGCAGTGGG + Intergenic
910769593 1:90817498-90817520 AGGGAGACACAGAGGGGAGTAGG - Intergenic
919661724 1:200254233-200254255 CCAGAGCCACAGAGGGAAGGGGG + Intergenic
924607991 1:245551699-245551721 CCGGAAGCCCAGAAGGAAGTTGG + Intronic
1065511335 10:26481174-26481196 CCAGACAGACAGATGGAAGTGGG + Intronic
1068253579 10:54476977-54476999 CTGGAGGCAAAGAAGGAAGTTGG - Intronic
1068520635 10:58073468-58073490 CCGGAGACTCAGAAGGAGGGAGG - Intergenic
1069906307 10:71734551-71734573 CCAGAGACACTGCCGGGAGTGGG + Intronic
1089849363 11:121482953-121482975 CAGGAGACCAAGAAGGAAGTGGG - Intronic
1091036564 11:132239106-132239128 CCAGAGACACTGCCGTAAGTCGG + Intronic
1093428270 12:19054073-19054095 CCAGAGAGAAAGATGGAAGTTGG + Intergenic
1099188117 12:79537906-79537928 AATGAGACACAGAAGGAAGTGGG + Intergenic
1103706959 12:122880403-122880425 ACGGAGACACAGACACAAGCTGG + Intronic
1104129410 12:125878650-125878672 CTGGAGACAGAGACGTTAGTGGG - Intergenic
1105502906 13:20988404-20988426 CCGGAGCCGCAGACGGCTGTGGG - Exonic
1108689899 13:52850761-52850783 CCGGAGACCCAGACGGGAACAGG + Intergenic
1111533042 13:89565073-89565095 CCGAAGAGACAGAGGGGAGTAGG - Intergenic
1112105318 13:96233608-96233630 CCGAAAACACAGAAGGAAATTGG + Intronic
1115762737 14:36591445-36591467 ACGGAGGCACAGAGGGAGGTTGG + Intergenic
1127188068 15:56500761-56500783 CCAGAGACAAAGGGGGAAGTGGG + Intergenic
1128355140 15:66921074-66921096 CCAGAGACGCAGAGGGAAGATGG + Intergenic
1128480289 15:68031551-68031573 CTGGAGGCAGAGAGGGAAGTTGG - Intergenic
1128664837 15:69530544-69530566 GCTGAGACACAGAAGGAAGTGGG + Intergenic
1129224150 15:74156684-74156706 CAGGAGACAGAGAAGGAAGCTGG + Intergenic
1130106295 15:80931139-80931161 CCTGAGACCCAGAAGGAGGTGGG - Intronic
1130911833 15:88276179-88276201 GCAGAGACCCAGAAGGAAGTTGG + Intergenic
1132545070 16:529148-529170 CCTCAGACACAGACAGAAGCAGG - Intronic
1132787640 16:1666772-1666794 CCGGAGCCACTGACGAAAGGTGG + Intronic
1134079856 16:11317206-11317228 CAGGAGACACAGCTGGAAGGAGG + Intronic
1134419591 16:14072695-14072717 GCAGAGATACAGACGGAGGTTGG + Intronic
1141392786 16:83678476-83678498 CCGGAACCACAGACGGGAGGTGG + Intronic
1142304403 16:89277608-89277630 CAGAAGACAGAGACGGCAGTTGG - Intronic
1144161668 17:12566269-12566291 CCAGGGACACAGACAAAAGTGGG + Intergenic
1146761474 17:35482724-35482746 CCGGAGACATAAATGGCAGTGGG + Intronic
1146890117 17:36501450-36501472 CAGGACACACAGGCGCAAGTGGG - Intronic
1147833731 17:43315365-43315387 CCGGGGCCACAGAGAGAAGTCGG - Intergenic
1149867289 17:60157893-60157915 CCAGAAACAGAGGCGGAAGTTGG - Intronic
1151512668 17:74570832-74570854 CCGGAGACGCAGACAGAGCTCGG + Intergenic
1152021137 17:77780943-77780965 CCGGAGAGACACACAGAAGCGGG - Intergenic
1158565755 18:58553009-58553031 ACAGAGACACAGAGGGAAGAAGG + Intronic
1160134543 18:76261362-76261384 CCGGAGACACAGGCCCCAGTGGG - Intergenic
1161227734 19:3154971-3154993 CTGGAGACTGAGACGGGAGTGGG - Intronic
1161448909 19:4333715-4333737 CCGGAGAATCAGGCTGAAGTGGG + Exonic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1165067648 19:33238444-33238466 CTGCAGACACAGACGGGAGCAGG + Intergenic
1166032396 19:40142088-40142110 CCAAAGACACAGACAGAAATAGG + Intergenic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1166714897 19:44960723-44960745 CTGGAGCCTCAGAGGGAAGTGGG + Intronic
1168296017 19:55377653-55377675 CCGGAGACGCAGGCAGAGGTTGG - Exonic
925720479 2:6821892-6821914 CAGGAAACAAAGACGGAAGGAGG - Intergenic
947073258 2:226315025-226315047 CCTGAGACCCAGAAGGAAGAAGG - Intergenic
947442812 2:230138009-230138031 CAGAAGACACAGAGGGAGGTAGG - Intergenic
948056307 2:235011331-235011353 ACAGAGACACAGACAGAAGAGGG - Intronic
948454695 2:238099548-238099570 CCGGAGACACAGCCTCAAGCTGG - Intergenic
1174339927 20:49889210-49889232 CCAGAACCACATACGGAAGTTGG - Exonic
1175859571 20:62143160-62143182 CCGGGGACGCGGGCGGAAGTGGG - Intronic
1177595980 21:23243762-23243784 GCGGAGACTCAGCTGGAAGTAGG + Intergenic
1179167168 21:38944242-38944264 CTGGAGTCACAGAGGGCAGTGGG - Intergenic
1181430385 22:22877944-22877966 CCAGAAACACAGACAGCAGTGGG + Intronic
1184813910 22:46856005-46856027 CCGGAGCCACAGAAGGAAAGTGG + Intronic
950643248 3:14361760-14361782 CCAGAGACAGAGACAGGAGTTGG - Intergenic
952557719 3:34552053-34552075 ACGGAGACAGAGAAGGAGGTAGG - Intergenic
952821793 3:37492304-37492326 CCTGGGACACACATGGAAGTCGG - Intronic
952881533 3:37989038-37989060 CCAGAGACACAGAGGGAGGCTGG + Intronic
955514535 3:59713655-59713677 CAGGAGACAGAGAGGGAAGTAGG + Intergenic
961609311 3:128123929-128123951 CCGGAGACACAGACGGAAGTGGG - Intronic
968699397 4:2047471-2047493 CAGGAGACAGAGGCGGAGGTGGG + Intergenic
971243311 4:24907953-24907975 GTGAAGACACAGACGGAAGAAGG - Intronic
977200239 4:94106697-94106719 ACAGAGACACAGAGGGAAGATGG - Intergenic
980410546 4:132413116-132413138 CAGGAGACACAGAGTGAAGGGGG - Intergenic
980767952 4:137332536-137332558 CAAGAGAGACAGAGGGAAGTTGG + Intergenic
985096406 4:186416933-186416955 CAGGAGACAGAGAAGGAAGCTGG + Intergenic
985723476 5:1502715-1502737 CAGGAGACACAGATCGCAGTTGG + Intronic
986454985 5:7909206-7909228 CCAGAGACAAAGAGGGAAGGTGG - Intergenic
986775023 5:11006423-11006445 CCAGAGCCACAGATGGAAGGAGG + Intronic
987212821 5:15701218-15701240 CCAGAGACACAGAAAGTAGTCGG - Intronic
999694680 5:154178631-154178653 CCAGTGACACAGAGGGAAGAAGG - Intronic
1000181966 5:158820279-158820301 GCGGAGACACAGAGGGATGAGGG + Intronic
1000821935 5:165995487-165995509 CCGGAGACACAGAGGGGAGAAGG + Intergenic
1001293777 5:170484809-170484831 CCAGAGACACGGAAGGAAGAAGG - Intronic
1001542991 5:172552147-172552169 CCTGAGACACAGCAGGAAGGTGG - Intergenic
1001907286 5:175483727-175483749 CCAGAGACACAGAGGGACCTAGG - Intronic
1003747765 6:9022447-9022469 CCAGAGACACAGAAGGGAGGGGG - Intergenic
1004143749 6:13045875-13045897 CCAGAGACAAAGGAGGAAGTTGG + Intronic
1006375753 6:33670916-33670938 CTGGGGACACAGAAGGAAGTGGG - Intronic
1015347141 6:132174004-132174026 CAGGAGAGAGAGACGGAAGGGGG + Intergenic
1016264192 6:142212761-142212783 CAGGAGACAGAGAGGGAAGGGGG + Intronic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1034405865 7:150902105-150902127 CAGGACACACAGAAGGAAGGAGG + Intergenic
1035954901 8:4066224-4066246 CAGGAGACAAAGAAGGAAGGAGG - Intronic
1039890479 8:41682348-41682370 CAGGAGAAACAGACCGGAGTCGG - Intronic
1042765416 8:72315850-72315872 CAGGAGACAGAGAGGGAAGAGGG + Intergenic
1045054901 8:98360381-98360403 ATGGAGACACAGAGGGAAGAAGG - Intergenic
1045719517 8:105091821-105091843 ACAGATACACAGACGGCAGTAGG + Intronic
1048100717 8:131348326-131348348 TCGGAGACACATTAGGAAGTAGG + Intergenic
1048386041 8:133913395-133913417 ATGGAGCCACAGACTGAAGTTGG - Intergenic
1049324419 8:142014618-142014640 ACGGAGACACAGACAGGAGCAGG - Intergenic
1049427976 8:142545721-142545743 CTGGAGACACAGAGGGAAGCAGG - Intergenic
1049441760 8:142612842-142612864 CCGGAAAGACAGACGGAGGGAGG + Exonic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1061835095 9:133323477-133323499 GCGGAAACACACACGGAAGTGGG + Intergenic
1061964830 9:134007310-134007332 GAGGAGAGACAGACGGAAGAGGG + Intergenic
1062144723 9:134982706-134982728 CCGGAGACACACGCGGAAGATGG - Intergenic
1203768259 EBV:37567-37589 CCGCAGACTTAGACGAAAGTTGG + Intergenic
1185484165 X:469575-469597 CCGCAGACACAGAGGGAAGGCGG - Intergenic
1186161999 X:6787016-6787038 CCGGAGACAGAGACAAAGGTCGG - Intergenic
1186410378 X:9341046-9341068 CCGTGGACACAGACGGGTGTAGG - Intergenic
1195996048 X:110732605-110732627 GCTGAAACACTGACGGAAGTGGG - Intronic
1200136807 X:153879230-153879252 CAGGAGACAAAGACAGACGTAGG + Intronic