ID: 961610929

View in Genome Browser
Species Human (GRCh38)
Location 3:128137939-128137961
Sequence AGCCATATGGTCATTTCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961610926_961610929 15 Left 961610926 3:128137901-128137923 CCAGTGTGGTACATCATATCAAT 0: 1
1: 1
2: 7
3: 25
4: 128
Right 961610929 3:128137939-128137961 AGCCATATGGTCATTTCAAGTGG 0: 1
1: 0
2: 4
3: 30
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961610929 Original CRISPR AGCCATATGGTCATTTCAAG TGG Intronic
902651850 1:17842559-17842581 AGCCATTAGGACATCTCAAGGGG + Intergenic
903638977 1:24844387-24844409 AACCATAGGATCATTTCAATAGG + Intergenic
906848130 1:49216894-49216916 AGCCATACGGTTATTGCAAGTGG - Intronic
910882613 1:91936011-91936033 AACCACATGGTCATGTCAATAGG - Intergenic
911138048 1:94463997-94464019 AGCCATGTGATTATTTAAAGTGG - Intronic
911343512 1:96669101-96669123 AACTACATGGTCATTTCAATTGG - Intergenic
911750487 1:101491103-101491125 AACCATATGATCATCTCAATAGG - Intergenic
912114377 1:106386975-106386997 AGCCATATGGAAATTTTAAAAGG - Intergenic
916563258 1:165951504-165951526 AGGCATATGATTATTTCAATAGG - Intergenic
917746612 1:178014967-178014989 AACTATATGATCATTTCAATAGG - Intergenic
918767679 1:188509639-188509661 TGCCATTTTGTCATTTCAAAGGG + Intergenic
919337033 1:196249047-196249069 AACCAAATGATCATTTCAATTGG + Intronic
919696766 1:200584602-200584624 AATCATATGATCATTTCAATAGG + Intronic
920594350 1:207254180-207254202 AACCATATGAACATTTCAACTGG - Intergenic
922130059 1:222768802-222768824 AACCATATGGTAATTTGAACAGG + Intergenic
923283779 1:232470828-232470850 AGCCAAATGATCATATCATGTGG - Intronic
924309973 1:242730945-242730967 AGCCACATGCTCATCTCAATAGG - Intergenic
1063572912 10:7232975-7232997 AGCCATATGCCCTTTTCAGGAGG + Intronic
1065415273 10:25478294-25478316 AGCAATAAGGTATTTTCAAGAGG - Intronic
1067228123 10:44388616-44388638 AGCCAAATACTTATTTCAAGAGG - Intergenic
1070640980 10:78169716-78169738 AGCCGTATGGCCATGGCAAGGGG - Intergenic
1071954687 10:90744693-90744715 AGCCATTTGGCCATTTCTGGAGG - Intronic
1075227135 10:120639887-120639909 AGCCATATTGTTATTTTAATTGG - Intergenic
1076094953 10:127725165-127725187 AGCCATATGATCATTTCAATTGG + Intergenic
1078416229 11:11168384-11168406 AACCATATGATTATCTCAAGAGG - Intergenic
1078950678 11:16129694-16129716 AAACATAAGGTCATTTCAATAGG + Intronic
1080093044 11:28372219-28372241 AACCATATGATAATTTCAATAGG - Intergenic
1080342426 11:31281501-31281523 AGCCATATGCTCATTTCAGTAGG - Intronic
1083070197 11:59971028-59971050 ATCCATCTGGTCATATAAAGAGG + Intergenic
1083140457 11:60717242-60717264 AGCCCTGTGGTGATTTCAGGAGG - Intergenic
1084763430 11:71290020-71290042 AACCATATGAGCATTTCAATTGG - Intergenic
1085287251 11:75371566-75371588 ATCCAAATGGTTATTTCAAGAGG - Intergenic
1085790773 11:79495716-79495738 AGCCAGATGGTCATTGCAAACGG + Intergenic
1087532501 11:99402314-99402336 AACCATATGATCATTTTAATTGG - Intronic
1088331026 11:108652000-108652022 AAACATACGGTCATTTCAATTGG + Intergenic
1088602960 11:111499409-111499431 AGCTGTATGATCATTTCAATAGG - Intronic
1090272160 11:125394542-125394564 AGCCTCATTGGCATTTCAAGTGG - Intronic
1095571545 12:43688394-43688416 AACCATATGATCATCTCAATAGG + Intergenic
1096134723 12:49189642-49189664 AGCCATACGGTCATTCCAAATGG + Intronic
1096143730 12:49264337-49264359 AGCCAAAGGCTCATTTAAAGAGG + Intronic
1097553749 12:61111252-61111274 ACCCATATGGACATTTTAAATGG - Intergenic
1098927410 12:76365841-76365863 AATCACATGGTCATTTCAATTGG - Intronic
1099763855 12:86956655-86956677 AACCATATGACCATTTCAATTGG - Intergenic
1100370381 12:93964077-93964099 AGCGTTATTGTCCTTTCAAGAGG - Intergenic
1101538868 12:105646113-105646135 AGCCATCTTGTCACATCAAGAGG - Intergenic
1101555827 12:105808360-105808382 AGCCATCTTGTGATTTTAAGGGG + Intergenic
1102485120 12:113250328-113250350 AGGTATATGGTGACTTCAAGGGG - Intronic
1104194058 12:126513918-126513940 AGCCAGATGGACATATTAAGAGG + Intergenic
1104354346 12:128071945-128071967 AGTCATAGGGACATTCCAAGAGG - Intergenic
1107085604 13:36424703-36424725 AACCATATGATCATTTCATATGG + Intergenic
1107224291 13:38028475-38028497 AACCATATGATTATTTCAATTGG - Intergenic
1107442432 13:40440145-40440167 AGCCAATTGGTCAGTTCCAGGGG - Intergenic
1107984100 13:45760131-45760153 AGCCATATGCCCAGATCAAGTGG - Intergenic
1108434450 13:50387998-50388020 AACTTTATGGTCATTTCTAGAGG + Intronic
1108735698 13:53281509-53281531 TGCCATGTGGTCATATCTAGAGG + Intergenic
1108931160 13:55822173-55822195 AACCATGTGATCATTTCAATTGG - Intergenic
1112757038 13:102647688-102647710 AGACTTAGGATCATTTCAAGAGG - Intronic
1115101194 14:29702533-29702555 AACAATATGATCATTTCAATAGG - Intronic
1115475221 14:33806899-33806921 AACCACATGGACATTTCCAGTGG - Intergenic
1117582210 14:57162925-57162947 AACCAGATGGTCAATTCATGTGG + Intergenic
1117597231 14:57335640-57335662 ATCCCTCTGTTCATTTCAAGAGG - Intergenic
1117629533 14:57675758-57675780 AACCATATGATCATCTCAATAGG - Intronic
1118112315 14:62735397-62735419 ATCCATATGTTCAGTTCAAGGGG - Intronic
1119026799 14:71159265-71159287 AGCCATATGACCATTTCAGTAGG + Intergenic
1120133254 14:80832509-80832531 AGACATATGGGCATTTCAATAGG + Intronic
1123983545 15:25624416-25624438 AGACAAATGGTCAAATCAAGAGG - Intergenic
1124243938 15:28054377-28054399 AGCCATTTGGCCATCTCCAGAGG - Intronic
1128401558 15:67287017-67287039 AACCATATGATCATTTCAATTGG - Intronic
1129922932 15:79336037-79336059 AGCCATTTGGTCATCTCAAGAGG + Intronic
1130761882 15:86829574-86829596 AACTATTTGGTCATTTCAAATGG + Intronic
1130965842 15:88696884-88696906 AGGCTTATAGTCATTTCAATTGG + Intergenic
1130995142 15:88899309-88899331 AGCCCTATGGTGATTTAAAGGGG + Exonic
1132975285 16:2708024-2708046 AGCCCTGTGGGCATTTCCAGAGG - Exonic
1134755086 16:16660065-16660087 AGCCAGTTGGTCAGTTCCAGAGG - Intergenic
1134990977 16:18699108-18699130 AGCCAGTTGGTCAGTTCCAGAGG + Intergenic
1137272586 16:46912087-46912109 AGACATATGGTCATCACAGGTGG - Intronic
1137851033 16:51743379-51743401 AACCATGTGATCATTTCAATTGG + Intergenic
1140464818 16:75172848-75172870 TCCCCTATGGTCATTCCAAGTGG + Intergenic
1140666049 16:77228490-77228512 AGCCAAATGGTTATTGCATGTGG - Intergenic
1141038309 16:80648892-80648914 AACCATATGATTATTTCAATTGG + Intronic
1144109023 17:12013994-12014016 AAATATATGTTCATTTCAAGAGG - Intergenic
1145775299 17:27523843-27523865 TGCCACATGGTAATTTCAAAAGG - Intronic
1146118013 17:30160044-30160066 AACCATATGATCATCTCAATTGG - Intronic
1149147183 17:53508574-53508596 AACCATATGATCATTTCAATTGG + Intergenic
1151957987 17:77389971-77389993 AGCCACAGGGTCATTCCAGGCGG - Intronic
1153056005 18:946967-946989 AGTCATATGATCATCTCAATAGG - Intergenic
1153387911 18:4520103-4520125 AACCCTTTGGTGATTTCAAGAGG + Intergenic
1155387312 18:25292666-25292688 AGCCACATGGTCATGTCTAATGG - Intronic
1155731771 18:29168468-29168490 AACCATATGATTATTTCAATTGG - Intergenic
1156970205 18:43145147-43145169 AGCCAGATACTCATTGCAAGTGG + Intergenic
1159182018 18:64919986-64920008 ATCCATATAGTAAATTCAAGAGG - Intergenic
1159885783 18:73903933-73903955 ACCAATATGGTCATATCATGAGG - Intergenic
1162995119 19:14329817-14329839 AGCCATGTGGTCAGGACAAGAGG + Intergenic
1163491633 19:17620316-17620338 GGCCATCTGGTCATTCCTAGAGG + Intronic
1165645949 19:37437228-37437250 AACCATATGATCATTTCAACTGG + Intronic
1166176590 19:41076760-41076782 AGCCATATGATTATCTCAATAGG - Intergenic
1166439994 19:42805064-42805086 AGCCATATGAGCACTGCAAGTGG + Intronic
1166458032 19:42960595-42960617 AGCCATATGAGCACTGCAAGTGG + Intronic
1166474971 19:43115827-43115849 AGCCATATGAGCACTGCAAGTGG + Intronic
927039972 2:19219127-19219149 AGCCACATGGTCCTTTCCACAGG + Intergenic
928609587 2:32978447-32978469 AACCATGTGATCATTTCAATTGG - Intronic
929348088 2:40911813-40911835 AGCCATAATTTCATTTAAAGTGG - Intergenic
929887999 2:45895488-45895510 AGCCATGTGGTGATTTAAAAAGG + Intronic
930948067 2:57100242-57100264 AATCATATGGTCATTTAAATTGG - Intergenic
931505878 2:62925106-62925128 AACCATATGATCATCTCAATAGG + Intronic
932982950 2:76692180-76692202 AGCCACATTGTAATTTCAAATGG + Intergenic
933053835 2:77635980-77636002 ACCCATATGATCATGTCAATAGG - Intergenic
935120383 2:100178997-100179019 AGCCATCTGGCTATTTCAACAGG - Intergenic
936776501 2:115980497-115980519 AACCATATGATCATCTCAATAGG - Intergenic
937823479 2:126338586-126338608 AACCATATGATCATCTCAATAGG + Intergenic
938309166 2:130275377-130275399 AGCCATATAGTCATTCTAAGTGG - Intergenic
940101087 2:150039293-150039315 AACCATATGATCATCTTAAGAGG + Intergenic
943064884 2:183075240-183075262 AGCCAAATGGAGATATCAAGTGG - Intergenic
943392093 2:187283018-187283040 AACTATATGATCATTTCAATTGG - Intergenic
943714785 2:191138999-191139021 AACCATATGATCATCTCAATAGG + Intronic
943936671 2:193926917-193926939 TGTCATATCGTCATCTCAAGTGG + Intergenic
945161995 2:206901085-206901107 AACCATATGATCATTTCAACTGG - Intergenic
945542309 2:211104201-211104223 AGCCACATGATCATTTTATGAGG - Intergenic
945559756 2:211325202-211325224 AGCCAAATGATCATCTCAACAGG + Intergenic
945616114 2:212069317-212069339 ATCAATATGGTCATCTCAATTGG + Intronic
947678648 2:232009036-232009058 AGCCAAATGGAAATTTCAAGTGG - Intronic
948775019 2:240281970-240281992 AACCATATGACCATTTCAATTGG + Intergenic
1169325331 20:4671033-4671055 AGCCAGAGATTCATTTCAAGAGG + Intergenic
1169736865 20:8847047-8847069 CTTGATATGGTCATTTCAAGGGG + Intronic
1169969675 20:11256031-11256053 AGTCATTTTGTCATGTCAAGAGG + Intergenic
1171166675 20:22978063-22978085 AATCACATGGTCATATCAAGGGG + Intergenic
1172023504 20:31932688-31932710 GGTCTTATGGTCATTTCATGAGG + Intronic
1175635803 20:60581996-60582018 ATCCATATCTTCTTTTCAAGAGG - Intergenic
1177098950 21:16875360-16875382 AACCACATGATCATTTCAACAGG + Intergenic
1179189916 21:39115126-39115148 AGCCATGTGGTCATTTCCACAGG + Intergenic
1179470122 21:41604842-41604864 AGCCATATGATTGATTCAAGGGG + Intergenic
1179851284 21:44139667-44139689 AGCCAATTGGTCAGTTCCAGAGG - Intronic
1180011370 21:45053703-45053725 AGCCATGTGGTCAGTGAAAGAGG + Intergenic
1181388502 22:22561372-22561394 AGCCATATATGCATCTCAAGAGG - Intronic
1181445893 22:22973920-22973942 AGCCATCTGGTCACTTCCAGAGG + Intergenic
1182852929 22:33491942-33491964 AGCCATAAGGCCACATCAAGGGG - Intronic
1184284048 22:43456858-43456880 AACCATATGATCATCTCAACAGG - Intronic
950607941 3:14100946-14100968 AACCATATGATCATCTCAATAGG + Intergenic
951181784 3:19667968-19667990 TGCCATATGGCCATTGCCAGAGG - Intergenic
951627705 3:24684359-24684381 AGTCAAGTGGTCATTTCAAAAGG - Intergenic
954488313 3:50875545-50875567 ACCCATATCATCATTTCAATGGG - Intronic
956371529 3:68568320-68568342 AAACATATGATCATTTCAATAGG - Intergenic
959439118 3:106354916-106354938 AACCACATGGTCATGTCAATAGG - Intergenic
959717625 3:109450459-109450481 AACCATATGATCATTTCAATTGG + Intergenic
960248250 3:115423373-115423395 AGCAATATGGAAATTTCAAGAGG - Intergenic
960406668 3:117269582-117269604 AGCAATGTTGTCATTTAAAGTGG + Intergenic
961610929 3:128137939-128137961 AGCCATATGGTCATTTCAAGTGG + Intronic
962909993 3:139839248-139839270 AGCCATATGGAACTTTCCAGTGG + Intergenic
963144505 3:141978529-141978551 AGCCAAATGGTTATTTGAATTGG + Exonic
963280128 3:143376201-143376223 AAGCATATTCTCATTTCAAGAGG - Intronic
963805811 3:149721346-149721368 AGCCACATGATCATCCCAAGTGG - Intronic
964537862 3:157744826-157744848 AACCACATGATCATTTCAATTGG - Intergenic
967760649 3:193221830-193221852 ACTCACATGGTCATTTCAATAGG - Intergenic
970821517 4:20220901-20220923 AACAATATGATCATTTCAATTGG - Intergenic
971534150 4:27727118-27727140 AGCCATATGCTCATTTTGTGGGG - Intergenic
971614340 4:28767890-28767912 AGCCATATGATCATCTCAATAGG + Intergenic
972219112 4:36933713-36933735 AACCATATGATCATCTCAATAGG + Intergenic
974785529 4:66615291-66615313 AACCATATGATCATCTCAATAGG - Intergenic
980272459 4:130603368-130603390 AGCTATAAGGTAATTTCTAGAGG + Intergenic
981329553 4:143492611-143492633 AGCCATAAGATCATTTGAATTGG + Intergenic
985792855 5:1939974-1939996 AGCCAAATGGTGATTCCCAGGGG - Intergenic
987770109 5:22291115-22291137 AGCCATATGATTATTTCAATAGG + Intronic
989074557 5:37550204-37550226 AACCGTATGATCATTTCAATTGG - Intronic
989082924 5:37644229-37644251 AAACATATGATCATTTCAACTGG - Intronic
989134819 5:38143295-38143317 AGCAAGATGTTCATTTCCAGAGG - Intergenic
989354175 5:40522950-40522972 AACCATATGATCATTTCAATTGG + Intergenic
990015498 5:51056918-51056940 AGCCATGAGGTTATTTCAGGAGG - Intergenic
990577953 5:57141589-57141611 AACCATATGATCATTTCAATTGG - Intergenic
991106391 5:62847871-62847893 AACCATATGATCATCTCAATAGG - Intergenic
991664020 5:68979003-68979025 ACCCATATGATCATTTCAACTGG + Intergenic
992746301 5:79824476-79824498 AGTCATATCATCATTTAAAGTGG - Intergenic
993944767 5:94104897-94104919 AACCATATGATCATCTCAATAGG + Intronic
994533944 5:101004216-101004238 AGCCATATGATCATCTCAATAGG + Intergenic
995771204 5:115672460-115672482 AGCCACTTGGTCATTACAGGTGG - Intergenic
997664099 5:135614629-135614651 AAACATATGATCATTTCAATAGG - Intergenic
998930410 5:147174998-147175020 AGCATTATGTTCATTTGAAGGGG - Intergenic
1002375282 5:178784413-178784435 AGCCATCGAGTCATTTCATGTGG - Intergenic
1004488565 6:16091896-16091918 ACCCATATAATCATTTCAATGGG + Intergenic
1004599681 6:17136439-17136461 AACCATATGATCATCTCAACAGG + Intergenic
1009311782 6:62162962-62162984 ATCCATATGTTGATGTCAAGTGG + Intronic
1009876370 6:69510774-69510796 AGCCATATTCTCTTTTCAAATGG - Intergenic
1010306585 6:74330925-74330947 AACCATATGATCATCTCAATAGG - Intergenic
1010819708 6:80399003-80399025 AACCATATGATTATTTCAATAGG + Intergenic
1012627350 6:101420439-101420461 AGAAAAATGGTCATTTCATGTGG + Intronic
1013729301 6:113144588-113144610 AGCCAGATGATGATTTGAAGAGG + Intergenic
1014121916 6:117735771-117735793 AGCCATAAAGTAATTTCTAGAGG - Intergenic
1014958037 6:127646140-127646162 AACCATATATTCATTTCAACAGG + Intergenic
1016292945 6:142543333-142543355 AGCCTTATAATCACTTCAAGAGG + Intergenic
1017579302 6:155844722-155844744 ACCCATATGATCATTTCAATTGG + Intergenic
1017580815 6:155863186-155863208 AACCATATGATCATCTCAATAGG - Intergenic
1018287515 6:162256812-162256834 GGTCATATTGTGATTTCAAGGGG - Intronic
1018738244 6:166706242-166706264 AGCCATGTGGTCCTCTCAATTGG - Intronic
1019396282 7:820787-820809 AGCCATGTGATCATCTCAATTGG - Intronic
1020528069 7:9289745-9289767 AACCACATGATCATTTCAATAGG - Intergenic
1020856896 7:13438468-13438490 AACCATACGATCATTTCAATAGG + Intergenic
1023676264 7:42633395-42633417 AACCTTATTGTCATTTCAAGAGG - Intergenic
1024103225 7:46055123-46055145 AGACATATGGTAATTGCAAAAGG + Intergenic
1031559710 7:123223715-123223737 ACCCATATGATCATTTCAGTTGG - Intergenic
1032481218 7:132248813-132248835 GGCCAGATGGTCAGTACAAGGGG - Intronic
1033542484 7:142369655-142369677 AGCCATATGGCCACTGCCAGGGG + Intergenic
1035976769 8:4321316-4321338 AGACGTATGGCCATTTCAGGAGG - Intronic
1041964297 8:63657191-63657213 TGCCTTATGGTCACTTCAATGGG + Intergenic
1043513651 8:80976081-80976103 AGGAATCTGGACATTTCAAGGGG + Exonic
1045171346 8:99672887-99672909 AACCATATGATCATTTCAACAGG - Intronic
1045777121 8:105818041-105818063 AATCATATGGTCATTTCAATTGG - Intergenic
1046267989 8:111857306-111857328 AGTCATATGATCATTTCAGTTGG + Intergenic
1046908134 8:119596408-119596430 AGCCACTTGGTCATTTCAAGAGG + Intronic
1051047580 9:12893442-12893464 AACCATATAATCATTTCAATTGG + Intergenic
1051518160 9:17953930-17953952 AGACATATGGACCCTTCAAGGGG - Intergenic
1053327866 9:37172890-37172912 AGCCATGTGGGCATTCCAATAGG + Intronic
1053730462 9:41050803-41050825 AGCCACATGATCATCTCAATTGG - Intergenic
1055736679 9:79337772-79337794 AGAAATAGGGTCATTGCAAGTGG + Intergenic
1061414797 9:130441262-130441284 AATCATATGATCATTTCAATAGG + Intergenic
1186184560 X:7007638-7007660 AGCCATATGAGCACTGCAAGTGG + Intergenic
1186343734 X:8669504-8669526 AGCCATATGATGATTTGGAGTGG - Intronic
1188663374 X:32788741-32788763 AGCCATTTGCTTATTTCAAGTGG + Intronic
1189858242 X:45245841-45245863 AACCATATGGTCATTTCAATTGG - Intergenic
1189889833 X:45589350-45589372 AACCATATAATCATTTCAATTGG - Intergenic
1190457059 X:50636843-50636865 TGCCATATGGTCTTTTAAATAGG + Intronic
1195312675 X:103647843-103647865 AACCATATGATCATTTCAGTTGG + Intergenic
1196315968 X:114223955-114223977 AACCATATGATCATTTAAATTGG + Intergenic
1196979996 X:121202187-121202209 AACCATATGATCATCTCAATAGG - Intergenic
1197360774 X:125500576-125500598 AACTATATGATCATTTCAATTGG - Intergenic
1197521123 X:127497521-127497543 ATCCATATGGTCATCTCAATTGG + Intergenic
1198942387 X:141970813-141970835 AGCCATATGCTCAGTGGAAGTGG + Intergenic
1199407716 X:147482138-147482160 AACCATATGATCATCTCAATAGG - Intergenic
1202108585 Y:21397370-21397392 AGACATATGGTCATTTCTCCAGG + Intergenic