ID: 961613219

View in Genome Browser
Species Human (GRCh38)
Location 3:128157599-128157621
Sequence TTGTGCCATTTCAAGAGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1078
Summary {0: 1, 1: 1, 2: 53, 3: 324, 4: 699}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961613219_961613222 14 Left 961613219 3:128157599-128157621 CCTGTGCTCTTGAAATGGCACAA 0: 1
1: 1
2: 53
3: 324
4: 699
Right 961613222 3:128157636-128157658 CAGCACATCTGTTTATAGCATGG 0: 57
1: 352
2: 540
3: 527
4: 491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961613219 Original CRISPR TTGTGCCATTTCAAGAGCAC AGG (reversed) Intronic
900508708 1:3045381-3045403 TTGTTGCATTTCTAGAGCACAGG + Intergenic
900864772 1:5260490-5260512 TTATGCCATTTCCACAGCACAGG + Intergenic
901042177 1:6371222-6371244 TTGTTCCATTTATAGAACACAGG + Intronic
901261256 1:7873033-7873055 TTGTTCCATTGGTAGAGCACAGG - Intergenic
901949364 1:12729597-12729619 TTGTTCCATTTATAGAGCACAGG + Intergenic
902092930 1:13917848-13917870 CTGTTCCATTTATAGAGCACAGG - Intergenic
902483032 1:16721833-16721855 TTGCACCCTTTTAAGAGCACAGG - Intergenic
903561045 1:24227789-24227811 TTGTACCATTGATAGAGCACAGG + Intergenic
903783821 1:25842764-25842786 TTGTTCCATTTATAGACCACAGG - Intronic
904127800 1:28254135-28254157 CTGTTCCATTTATAGAGCACAGG - Intergenic
904202268 1:28828407-28828429 TTGTACCATTTATAGAGCACAGG + Intronic
904452992 1:30628448-30628470 TTGGGCCATGTCAATAGCCCAGG + Intergenic
904760730 1:32802780-32802802 TTGTTCCATTTATAGAGCTCAGG + Intronic
905144286 1:35875340-35875362 TTGTTCCACTTATAGAGCACAGG - Intronic
905189159 1:36219957-36219979 TTGTTCCATTTGTAGAGCATAGG - Intergenic
905260927 1:36718532-36718554 TTGTTCCATTTATAGAGCACAGG + Intergenic
905545816 1:38799615-38799637 TTTTGCTATTTCTAGAGCACAGG + Intergenic
905708766 1:40083032-40083054 GTGTTCCATTTGTAGAGCACAGG - Intronic
905783001 1:40729079-40729101 TTGCTCCATTTATAGAGCACAGG + Intronic
906269724 1:44466814-44466836 TTGTTCCATTTATAGAGCATAGG + Intronic
906953754 1:50355348-50355370 TTGTTCCATTTCTAGAGCACGGG - Intergenic
907002085 1:50871549-50871571 TTGTTCCATTTAGAGAGCACAGG - Intronic
907113031 1:51944188-51944210 TTGTTCGATTTCTAGAGCACAGG - Intronic
907188038 1:52626184-52626206 TTGTTCCATTTATACAGCACAGG - Intergenic
907685135 1:56603503-56603525 TTTTTCCATTTATAGAGCACAGG - Intronic
907766190 1:57413082-57413104 TTGTTCCATTTTTAGAGTACAGG - Intronic
907802579 1:57785090-57785112 TTGTTATATTTCTAGAGCACAGG - Intronic
907858832 1:58330701-58330723 TTGTTCCATTTTTAGAACACAGG - Intronic
907965780 1:59327981-59328003 TTGTTCCATTTCTAGAGCACAGG + Intronic
908464970 1:64384685-64384707 CTGTTCCATTTCTAGAGCACAGG - Intergenic
908849582 1:68362034-68362056 TTGTTCCATTTGTAGAGCACAGG + Intergenic
909246400 1:73290736-73290758 TTGTTCCATGTATAGAGCACAGG + Intergenic
910076463 1:83285436-83285458 TTGTTTCATTTATAGAGCACAGG - Intergenic
910286386 1:85559154-85559176 GTGTGCAATTTCAAAAGCAATGG - Intronic
910298282 1:85675491-85675513 TTGTTCCATTTACAGAGCACAGG + Intronic
910411661 1:86952793-86952815 TTGTCCCATTTATAGATCACAGG + Intronic
910545678 1:88414417-88414439 TTATTCCATTTGCAGAGCACAGG + Intergenic
910718765 1:90261265-90261287 TTGTTCCATGTATAGAGCACAGG - Intergenic
910992527 1:93071092-93071114 TTGTTCCATTGGTAGAGCACAGG - Intergenic
911081413 1:93935517-93935539 TTGTTCCAGTTATAGAGCACAGG - Intergenic
911198999 1:95025361-95025383 TTGTTCCACTTACAGAGCACAGG + Intronic
911559839 1:99390933-99390955 TTGTTCCATTTATAGAGCACAGG - Intergenic
911833799 1:102590013-102590035 TTGTGCCATCTTTAGAGGACAGG + Intergenic
912078652 1:105909965-105909987 CTGTGCCATTTGCAGAGGACAGG + Intergenic
912783129 1:112572206-112572228 TTGTTCCATTTATAGAGCACAGG + Intronic
912902447 1:113667048-113667070 TTGTTCCATTTTTAGAGCATAGG + Intronic
913082934 1:115406386-115406408 TTCTTCCATTTCTAGAGCACAGG + Intergenic
913341457 1:117761497-117761519 TTGTTCCACTTATAGAGCACAGG - Intergenic
913350988 1:117859081-117859103 TTGTTCCATTTATAGAGCACAGG - Intergenic
913721204 1:121597530-121597552 TTCTTCCAACTCAAGAGCACTGG + Intergenic
914356862 1:146893651-146893673 TTGTTCCATTTCTAGAGCATAGG + Intergenic
914774499 1:150723832-150723854 TTGTTCCATTTATAGATCACAGG + Intergenic
915600256 1:156918422-156918444 TTGTTCCTTTTCCAGAGCACAGG - Intergenic
915845235 1:159256499-159256521 TTGTTCCATTTATAGAGCACTGG + Intergenic
916553066 1:165868220-165868242 TTGTTCCATTTACAGAGCACAGG + Intronic
916586029 1:166151185-166151207 TTGAGACATTTCAAAAGCACAGG - Intronic
916831845 1:168500962-168500984 TTGTTTCATTTATAGAGCACAGG + Intergenic
917112140 1:171559437-171559459 TTGTTCCATTTCTAGAGTACAGG - Intronic
917115432 1:171598585-171598607 CTGTTCTATTTCTAGAGCACAGG - Intergenic
917353196 1:174099771-174099793 TTGTTCCATTTGTAGAGCACGGG + Intergenic
917362148 1:174188808-174188830 TTGTTCCATTTATACAGCACAGG + Intronic
917669529 1:177259708-177259730 TTGTTCCATTTATAGAGCACTGG - Intronic
917993608 1:180410555-180410577 TTTTCCCATTTCAAAAGCACAGG - Intronic
918123828 1:181564978-181565000 CTGTTCCATTTATAGAGCACAGG + Intronic
918411632 1:184264662-184264684 TTGTTCCATTTATAGAGCACAGG - Intergenic
918498296 1:185164268-185164290 TTGTTTCATTTCTAGAGCACAGG + Intronic
918632459 1:186734272-186734294 TTGTTCCATTGATAGAGCACAGG + Intergenic
919093694 1:193003997-193004019 TTCTTCCATTTCTAGAGCACAGG + Intergenic
919113369 1:193248221-193248243 TTGTTCAATTTCTAAAGCACAGG - Intronic
919200018 1:194344242-194344264 TTTTTCCATTTTTAGAGCACAGG + Intergenic
919217357 1:194575794-194575816 TTGTTCCATTTCTAGAGCACAGG - Intergenic
919448763 1:197744590-197744612 TTATTCCATTTATAGAGCACAGG + Intronic
919548835 1:198959017-198959039 TTGTTCCATTTATAGTGCACAGG + Intergenic
919612881 1:199767918-199767940 TTGTTCCATTTATAGAGCACAGG - Intergenic
920024275 1:202981482-202981504 TTATTCCATTTCTAGAGCACAGG + Intergenic
920064236 1:203255143-203255165 TTGTTCAATTTATAGAGCACAGG - Intronic
920662687 1:207930718-207930740 TTTTTCCATTTATAGAGCACAGG + Intergenic
921379430 1:214509003-214509025 TTGTTCCATTTACAGAGCACAGG + Intronic
921397456 1:214683714-214683736 TTGTGACATTTCCAAATCACAGG + Intergenic
921402568 1:214742229-214742251 TTGTTCCATTCCTAGAGCAAAGG + Intergenic
921408310 1:214806526-214806548 TTGTTCCATTTCCAGAGCATAGG - Intergenic
921576373 1:216839901-216839923 TTGTTCCATTGATAGAGCACAGG + Intronic
921908215 1:220518046-220518068 TTGTTCCATTTATAGAACACAGG - Intergenic
922032547 1:221815793-221815815 TTGTTCCACTTATAGAGCACAGG - Intergenic
922065410 1:222134262-222134284 TTGTTCCATTTAGAGAACACAGG + Intergenic
922333225 1:224596291-224596313 TTGTTCCACTTAGAGAGCACAGG - Intronic
922389486 1:225125128-225125150 TTGTTCCATTTGTAGAGCAGGGG + Intronic
922658993 1:227412662-227412684 CTGTTCCATTTGTAGAGCACAGG + Intergenic
922727880 1:227932893-227932915 TTATTCCATTTCTAGAGCACAGG + Intronic
923014616 1:230116796-230116818 TTGTTCCATTTATAGAGCACAGG + Intronic
923936086 1:238762180-238762202 TTGTTCCACTTACAGAGCACAGG + Intergenic
924006886 1:239622061-239622083 TTATTCCATTTATAGAGCACAGG - Intronic
924080757 1:240395131-240395153 TTGTTCCATTTATACAGCACAGG - Intronic
924259725 1:242216961-242216983 TTGTTCCATTTATAGAGCACAGG - Intronic
1062865970 10:854669-854691 TTGTTCCACTTAAAGAACACAGG + Intronic
1062995684 10:1864394-1864416 TTGTTCCATTTCTAGAGCACAGG - Intergenic
1063039609 10:2323713-2323735 TTGTTCCATTTATAGAGCACAGG + Intergenic
1063803959 10:9616030-9616052 TTGTTCCATTTACAGAGCACAGG + Intergenic
1063821185 10:9838178-9838200 TTGTTCCATTTACAGACCACAGG - Intergenic
1063934333 10:11061739-11061761 TTGTTCCATTTACAGAGCACTGG - Intronic
1064291891 10:14042627-14042649 TTGTGCTCTTTCCTGAGCACAGG + Intronic
1065413823 10:25462211-25462233 TTGTTACATTTCTACAGCACAGG - Intronic
1066056886 10:31690448-31690470 TTGTCCCATTTTTAGAGCACAGG + Intergenic
1066285419 10:33961456-33961478 TTATTCCATTTCTAGAGCACAGG + Intergenic
1066478905 10:35776193-35776215 TTGTTCCATTTCTAGAGCACAGG + Intergenic
1066531261 10:36342399-36342421 TTGTTCCACTTGAGGAGCACAGG - Intergenic
1067286776 10:44912761-44912783 CTGGGTCATTTCAGGAGCACTGG + Intronic
1067404378 10:46007957-46007979 TTGTTCCATTTCTAGAGCACAGG - Intronic
1068559197 10:58494261-58494283 TTGTTCCATTTATACAGCACAGG - Intergenic
1068719844 10:60232443-60232465 TTCTGCCATTTAAAAAGCGCAGG - Intronic
1068940835 10:62679324-62679346 TTGTTCCATTTATAGAGCACAGG + Intergenic
1069046940 10:63752949-63752971 TTGTGCCACTACAAAAGCCCGGG - Intergenic
1069196933 10:65562292-65562314 TTTTTCCATTTATAGAGCACAGG + Intergenic
1069417884 10:68217533-68217555 TTGTTCCATTTATAGAACACAGG - Intergenic
1069481065 10:68782716-68782738 TTGTTCAATTTCTAGGGCACAGG - Intronic
1070315567 10:75308150-75308172 TTTTTCCATTTAAAGAGCACAGG - Intergenic
1070489273 10:76960663-76960685 TTTTTCCATTGCTAGAGCACAGG + Intronic
1071209663 10:83324631-83324653 TTGTTCCAATTCACGAGCATGGG - Intergenic
1071662939 10:87523939-87523961 TTGTTCTATTTATAGAGCACAGG + Intronic
1071683505 10:87731223-87731245 TTTTTCCATTTATAGAGCACAGG - Intronic
1071691865 10:87828853-87828875 TTGTTCCATTTATAAAGCACAGG - Intronic
1071731487 10:88253116-88253138 TTGAGCAATTTCAAAAACACTGG + Intergenic
1071851589 10:89576941-89576963 TTGTTCCGTTTATAGAGCACAGG + Intergenic
1072184882 10:93027625-93027647 TTGTTCCATTTATAGAGCACAGG - Intronic
1072248352 10:93562542-93562564 TTGTGAGGTCTCAAGAGCACAGG + Intergenic
1072477169 10:95773507-95773529 TTGTTCCATTTATAGAGCACAGG + Intronic
1072763847 10:98080491-98080513 TGGTGCCATGTCCAGAGGACAGG + Intergenic
1072836264 10:98716899-98716921 TTGTTCCATTTATAGAGTACAGG + Intronic
1072912598 10:99517009-99517031 TTGTTCCATTTACAGAGCACAGG + Intergenic
1074033073 10:109708484-109708506 TTGTTCCATTTCTAGAGCACAGG + Intergenic
1074084609 10:110199238-110199260 TTGTTTCATTTATAGAGCACAGG + Intergenic
1074090978 10:110255208-110255230 TTGTTCCATTTACAGAGCACAGG - Intronic
1074210775 10:111332368-111332390 TTCTTCCATTTATAGAGCACAGG - Intergenic
1074767875 10:116713959-116713981 TTGTGACATGTCAAGAGCTAAGG - Intronic
1075178820 10:120191286-120191308 TTATTCCATTTATAGAGCACAGG + Intergenic
1075596580 10:123734956-123734978 TTATTCCATTTATAGAGCACAGG - Intronic
1075841152 10:125505008-125505030 TTGTTCCATGTACAGAGCACAGG - Intergenic
1075847831 10:125560037-125560059 TTGTTCCATTTATAGAGCCCAGG - Intergenic
1076205998 10:128603602-128603624 TTTTTCCATTTATAGAGCACAGG - Intergenic
1077756957 11:5041813-5041835 TTGTTCCACTTACAGAGCACAGG - Intergenic
1078193588 11:9115100-9115122 TTGTTCCATTTATAGAGCACAGG + Intronic
1078398861 11:11005881-11005903 TTTTTCCATTTATAGAGCACAGG + Intergenic
1078638088 11:13070451-13070473 TTGTTCCATTTATAGAGCACAGG - Intergenic
1078975782 11:16474671-16474693 TTATTCCATTTGTAGAGCACAGG + Intronic
1079101674 11:17545670-17545692 TTGTGCCCTGTCAAGGGCAGGGG + Intergenic
1079132854 11:17758810-17758832 TTGTTCCATTTCTAGAGCACAGG + Intronic
1079158526 11:17971482-17971504 TTGTTCCATTTCTGGAGCACAGG - Intronic
1080670907 11:34376694-34376716 TTGTTCCATTTATAGAGCACAGG - Intergenic
1080671061 11:34378445-34378467 TTGTTCCATTTTTAGAGCACAGG - Intergenic
1080673221 11:34400321-34400343 CTGTTCCATTTATAGAGCACAGG - Intergenic
1080940090 11:36906626-36906648 TTGTTCCATTTATAGAGCACAGG - Intergenic
1082063631 11:47881380-47881402 TTGTGCCATTCCCAGGCCACTGG - Intergenic
1082801287 11:57416648-57416670 TGGTGCCATTCCCAGGGCACAGG + Exonic
1083166921 11:60894990-60895012 TTGTTCTATTTACAGAGCACAGG + Intronic
1083378001 11:62241946-62241968 TTGTATCAGTTCAAGGGCACAGG - Intergenic
1083976116 11:66122180-66122202 TTGTTCCATTTATAGAGCACAGG - Intronic
1084761619 11:71276096-71276118 CTGTTCCATTTGTAGAGCACAGG - Intergenic
1084847794 11:71913875-71913897 CTGTTCCATTTATAGAGCACAGG - Intronic
1085436474 11:76508437-76508459 TTGTTTCATTTATAGAGCACAGG + Intronic
1085441133 11:76563702-76563724 TTGTTCCATTGATAGAGCACAGG + Intergenic
1085633175 11:78136631-78136653 TTGTTCCATTTATAGATCACAGG + Intronic
1085654373 11:78299347-78299369 TTCTGACATTTTAAGATCACAGG + Intronic
1085927962 11:81044651-81044673 TTGTTCCATTTATAGAACACAGG + Intergenic
1086121584 11:83310150-83310172 TTTTTTCATTTCTAGAGCACAGG + Intergenic
1086619977 11:88875896-88875918 CTGTTCCATTTTTAGAGCACAGG + Intronic
1086649662 11:89272484-89272506 TTGTTCTATTTACAGAGCACAGG + Intronic
1086734136 11:90284862-90284884 TTGTTTCATTTATAGAGCACAGG + Intergenic
1087023566 11:93627643-93627665 TTGTTCCATTTATAGAGCACAGG + Intergenic
1087422001 11:97940977-97940999 TTGTTCCATTGCTAGAGCACAGG - Intergenic
1087478729 11:98671653-98671675 TTGTTCCATTTCTAAAGCACAGG - Intergenic
1087635927 11:100701230-100701252 TTGTTCCATTTCTAGTGCACAGG + Intronic
1087650974 11:100867096-100867118 TTGTAACCTTTCTAGAGCACAGG + Intronic
1087657742 11:100945763-100945785 TTGTTCCATTTGTAGAGCACAGG + Intronic
1087913890 11:103785524-103785546 TTGTTCTATTTCTAGAACACAGG + Intergenic
1088266799 11:107995494-107995516 TTGTTCCATTTCTGGAGCACAGG + Intergenic
1089119181 11:116120280-116120302 TGGTGGCATTTCAAGTGCACAGG - Intergenic
1089415433 11:118285419-118285441 TTGTTCCATTTATAGAGCTCAGG - Intergenic
1090147894 11:124346250-124346272 TTGTTCCATTTGTAGAGCATAGG - Intergenic
1090523254 11:127501412-127501434 TCGTTCCATTTATAGAGCACAGG - Intergenic
1091032617 11:132204617-132204639 TTGAGGCATTTGAAGAGGACAGG + Intronic
1091093870 11:132798986-132799008 TTGTTCCATTTGTAGAGCACGGG + Intronic
1091110136 11:132958711-132958733 TTGTTCCATTTATGGAGCACAGG - Intronic
1091427025 12:399753-399775 TTGTTCCATTTATAGAGCACAGG + Intronic
1093002451 12:14013077-14013099 TTGTTCCATTTACAGAGCATGGG + Intergenic
1093412908 12:18887846-18887868 AAGTGCCAGTTCAAGAGCAAAGG - Intergenic
1093435080 12:19127533-19127555 TTGTTCCATTTATAGAGCACAGG + Intergenic
1093541281 12:20288520-20288542 TTGCTCCATTTCTAGAGCACAGG - Intergenic
1093635154 12:21457922-21457944 TTGTTCCATTTACAGAGGACAGG + Intronic
1093690837 12:22106904-22106926 CTGTTCCATTTATAGAGCACAGG + Intronic
1093823191 12:23647341-23647363 CTGTTCCATTTATAGAGCACAGG + Intronic
1095208767 12:39468676-39468698 TTGTCCCATTTACAGAACACAGG - Intergenic
1095311954 12:40709367-40709389 TTGTTCTATTTACAGAGCACAGG + Intronic
1095435556 12:42183991-42184013 TTGTTTCATTTATAGAGCACAGG - Intronic
1095518346 12:43032450-43032472 TTGTTCCATTAATAGAGCACAGG + Intergenic
1095605915 12:44067688-44067710 TTGTTTCATTTATAGAGCACAGG + Intronic
1095657903 12:44692250-44692272 TTGTTCCATTTATAGAGCATAGG - Intronic
1095881835 12:47145643-47145665 TTGTTCCATTTCTACAGCACAGG - Intronic
1096440403 12:51638049-51638071 TTGTTCCATTTATAGGGCACAGG - Intronic
1096659687 12:53116433-53116455 TTATTCCATTTATAGAGCACAGG + Intronic
1097206576 12:57326887-57326909 TTGTTCTATTTTTAGAGCACAGG - Intronic
1097430728 12:59502710-59502732 TTGTGACATTTCAAGAACTAAGG - Intergenic
1098206586 12:68117131-68117153 TTGTTCCATTAACAGAGCACAGG + Intergenic
1098253653 12:68594437-68594459 TTGTACCTTTTGAAGAGCAAAGG + Intergenic
1098427283 12:70379104-70379126 TTGTTCCATTTCTAAAGCACAGG + Intronic
1098575730 12:72039941-72039963 TTGTTACATTTCTAGAGCACAGG + Intronic
1098577922 12:72065172-72065194 TAGTTCCATTTCTAGAGCATAGG - Intronic
1098744184 12:74214615-74214637 TTGTCCCATTTATAGAGAACAGG + Intergenic
1098889975 12:76000063-76000085 TTGTTCCATGTAGAGAGCACAGG + Intergenic
1099052360 12:77795805-77795827 TTGTTCTATTTATAGAGCACAGG - Intergenic
1099218431 12:79881906-79881928 TTGTTCCATTTATAGAGCACTGG - Intronic
1099252590 12:80274831-80274853 TTGTTCCATTTACAGAGCACAGG - Intronic
1099296815 12:80838350-80838372 TCGTGCTATCTCAATAGCACAGG - Intronic
1099480858 12:83164637-83164659 TTGTTCCATTTATAGAACACAGG + Intergenic
1099502874 12:83435324-83435346 TTGTTCCATTTATAGACCACAGG + Intergenic
1099609156 12:84844421-84844443 TTGTTACATTTGCAGAGCACAGG - Intergenic
1099820528 12:87703587-87703609 TTGTTCCATTTACAGAGAACAGG + Intergenic
1099938114 12:89152486-89152508 TTGTTCCATTTACAGAGCACAGG - Intergenic
1100618800 12:96252116-96252138 TTGTTCCATTTACAGAGCACAGG - Intronic
1100961993 12:99972952-99972974 TTGTGCCACTTGCAGAGCACAGG - Intronic
1101387454 12:104270534-104270556 TTGTTCCATTTCTAAAGCAAAGG + Intronic
1104096391 12:125561800-125561822 TTGTTTCATTTCTAGAGTACAGG + Intronic
1104113746 12:125728644-125728666 TTGTTTCATTTATAGAGCACAGG - Intergenic
1104488344 12:129171827-129171849 TGGTTCCATTTACAGAGCACAGG + Intronic
1104533994 12:129600830-129600852 TTGTTCCATTTATAGAACACAGG + Intronic
1104799623 12:131545049-131545071 TTGTTCCATTTACAGAGCACAGG - Intergenic
1105554876 13:21437627-21437649 TTGTTCCATTTCTAGAGCATAGG - Intronic
1106071712 13:26418457-26418479 TTTTTCTATTTCTAGAGCACAGG - Intergenic
1106358503 13:29007894-29007916 TTGTGGATTTTCAACAGCACAGG + Intronic
1106379075 13:29218834-29218856 TTGTTCCATTTCTAGAGCACAGG + Intronic
1106941347 13:34783201-34783223 TTGTTTCATTTTTAGAGCACAGG - Intergenic
1106946726 13:34836138-34836160 TCGTTTCATTTCTAGAGCACAGG - Intergenic
1106989356 13:35398718-35398740 TTGTTCCATTTTTAGAGCACAGG + Intronic
1107674799 13:42784359-42784381 TCGTCCCATTTCAGGAGCTCTGG + Intronic
1108331068 13:49384881-49384903 TTGTTCCATTTATGGAGCACAGG + Intronic
1108845013 13:54667442-54667464 TTGTTCCATTTACAGAGCATAGG + Intergenic
1108926525 13:55754162-55754184 TTGTTCCATTTATAGAGCACAGG - Intergenic
1109777613 13:67062645-67062667 TTTTGCAAGTTCAAGAGCAAAGG - Intronic
1109869635 13:68317134-68317156 TTGTACTATTTACAGAGCACAGG + Intergenic
1109893546 13:68651861-68651883 TTGTTCCATTTCTAGGGCATAGG - Intergenic
1109953342 13:69531782-69531804 TTGTTCTATTTATAGAGCACAGG - Intergenic
1110316429 13:74113494-74113516 TTGTTCCATTTATAAAGCACAGG - Intronic
1110379210 13:74830600-74830622 TTTTTCCATTTCTAGAGCACAGG - Intergenic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1110561696 13:76916826-76916848 CTGTTCCATTTATAGAGCACAGG - Intergenic
1110635176 13:77759050-77759072 TTCTTCCATTTCATGAGCATGGG + Intronic
1110735582 13:78932452-78932474 TTGTTTCATTTATAGAGCACAGG - Intergenic
1110995757 13:82107131-82107153 TTGTTCCATTTATAGAGCACAGG + Intergenic
1111065149 13:83081304-83081326 TTGTTCCATTTATAGAGCACAGG + Intergenic
1111575742 13:90152320-90152342 TTGTTTCATTTCTAGAGCACAGG + Intergenic
1111617573 13:90680530-90680552 TTGTTCCATTTATAGAGTACAGG + Intergenic
1111640589 13:90964689-90964711 TTGTTCCATTTACAGAGCATAGG - Intergenic
1111787332 13:92805832-92805854 TTGTTCCATTTATAAAGCACTGG + Intronic
1111936407 13:94562474-94562496 TTGTATAATTTCTAGAGCACAGG + Intergenic
1112208709 13:97351275-97351297 TTGTTTCATTTCTAGAGCATAGG + Intronic
1112543942 13:100345879-100345901 TTGTTCCATTTCTAGAGCACAGG - Intronic
1112622957 13:101070745-101070767 TTGTTCCATTTATAGAGCACAGG + Intronic
1112653362 13:101422179-101422201 TTGTGCTATTTCTAGAGCACAGG + Intergenic
1112939429 13:104843368-104843390 TTGTTCCATTTCTAGAGCACAGG + Intergenic
1113057292 13:106282460-106282482 TTGTTTCATTTCTAGAGCACAGG - Intergenic
1113158007 13:107347380-107347402 TTCTGAAATTTCAAGAGGACAGG + Intronic
1113722604 13:112571473-112571495 TCGTTTCATTTCTAGAGCACAGG + Intronic
1114152365 14:20057849-20057871 CTGTTCCATTTACAGAGCACAGG + Intergenic
1114368665 14:22059663-22059685 TTGTTCCATTTATAGAGCACAGG - Intergenic
1114545386 14:23496640-23496662 TGCTGGCATTTCAAGAGCAGAGG + Intronic
1114591911 14:23873642-23873664 TTATTCCATTTATAGAGCACAGG + Intergenic
1114601904 14:23963105-23963127 TTGTTCCATTTGCAGAGCACAGG + Intronic
1114606079 14:23998227-23998249 TTGTTCCATTTACAGAGCACAGG + Intronic
1114611674 14:24046183-24046205 TTGTTCCATTTATAGAGCACAGG + Intergenic
1114815387 14:25951782-25951804 TTGTTCCATTTGTAGAGCACAGG + Intergenic
1115258842 14:31432042-31432064 TTGTTCCATTTATAAAGCACAGG - Intronic
1115280441 14:31655759-31655781 TTTTTCCATTTATAGAGCACAGG + Intronic
1115486877 14:33919124-33919146 TTGTTCCATTTATAGAACACAGG - Intergenic
1115709605 14:36036491-36036513 TTGTTCCATTTAGAGAACACGGG - Intergenic
1116013952 14:39384245-39384267 TTGTTCCATTTATGGAGCACAGG - Intronic
1116150581 14:41136526-41136548 TTGTTCCATTTATAGAGCACAGG + Intergenic
1116387895 14:44355110-44355132 TTGTTTCATTTATAGAGCACAGG + Intergenic
1116626414 14:47270356-47270378 TTATGCCACTTCAAGATGACTGG - Intronic
1116796851 14:49400344-49400366 TAGTGCTATCTCAAGTGCACTGG - Intergenic
1117169311 14:53075834-53075856 TTGTTCTATTTATAGAGCACAGG - Intronic
1117269640 14:54129314-54129336 TTGTTCCATTTATAAAGCACAGG - Intergenic
1117401386 14:55361404-55361426 TTGTTCCATTTACAGAGCACAGG + Intronic
1117662692 14:58023991-58024013 TTGTTCCATTTATAGAGCACAGG + Intronic
1117926715 14:60788355-60788377 TTCTTCCATTTATAGAGCACAGG + Intronic
1118037820 14:61887306-61887328 TTGTTTTATTTCTAGAGCACAGG + Intergenic
1118045326 14:61963903-61963925 TTGTTCCATTTCTAAAGCACAGG - Intergenic
1118125066 14:62892756-62892778 TTGTCCCATTTATAGGGCACAGG - Intronic
1118553098 14:66979087-66979109 TTGTTCCATTTGTAGAGCACAGG + Intronic
1118656038 14:67950002-67950024 TTGTTCCATTTCTAGACCACAGG + Intronic
1118662546 14:68030089-68030111 TTGTTCTATTTCCAGTGCACAGG + Intronic
1118677503 14:68203458-68203480 TCGTTCCACTTCTAGAGCACAGG + Intronic
1119005052 14:70917627-70917649 TTGTTCCATTTATAGAACACAGG + Intronic
1119091658 14:71787908-71787930 TTGTTCCATTTTTAGAGCACAGG - Intergenic
1119145195 14:72306145-72306167 TTGTTCCATTTTTAGGGCACAGG - Intronic
1119964166 14:78894990-78895012 TTGTTCCATTTACAGAGCACAGG + Intronic
1120042085 14:79765362-79765384 TTGTTCCATTGAAAGAGAACTGG - Intronic
1120329233 14:83068143-83068165 TTGTCCCATTTATAGAGCACAGG + Intergenic
1121018578 14:90564378-90564400 TTGTTCCATTTACAGAGCACAGG + Intronic
1121036496 14:90708485-90708507 TTGTTCCATTTACAGAGCACAGG - Intronic
1121165647 14:91794556-91794578 TTGTTCCCTTTATAGAGCACAGG - Intronic
1121598217 14:95182523-95182545 TGGTGCAATTTCAAGGGCAGAGG + Exonic
1122001432 14:98658908-98658930 TTGTTCCATTTGTAGAGCACAGG - Intergenic
1122054471 14:99083843-99083865 TTGTCCCGTTTATAGAGCACAGG + Intergenic
1122170529 14:99870689-99870711 TTCTTCCATTTATAGAGCACAGG - Intronic
1122379392 14:101290832-101290854 TTGTGCCATTTAAGCAGCATGGG - Intergenic
1124177021 15:27435905-27435927 CTGTGCCATTCCCAGAGCCCAGG - Intronic
1124639372 15:31386853-31386875 TTCTTCCATTTCTAGAGCATAGG - Intronic
1125810347 15:42534900-42534922 TTGTTCCATTTATAGAGCACAGG + Intronic
1125981529 15:44006209-44006231 TTGTTTCATTTATAGAGCACAGG - Intronic
1126151205 15:45525108-45525130 TTGTTCCATTTATAGAGCACAGG + Intergenic
1126999234 15:54482288-54482310 TTGTGCTATTTTGAGAGCCCAGG - Intronic
1127081351 15:55383347-55383369 TTGTTCCATTTACAGAGCACAGG + Intronic
1127724804 15:61738991-61739013 TTGTTTCATTTATAGAGCACAGG + Intergenic
1128189872 15:65682025-65682047 TTGTTCCATTTACAGAGCACAGG + Intronic
1129126380 15:73445076-73445098 TTGTTCTATTTATAGAGCACAGG + Intronic
1130226608 15:82063465-82063487 GTGTGCCATTTTAAAAGCACCGG - Intergenic
1130290359 15:82593974-82593996 TTGTTCCATTTATAGAGCACAGG + Intronic
1130301657 15:82684010-82684032 TTGTTCCATTTATAGAGCACAGG + Intronic
1131652791 15:94420105-94420127 TTGTTCCATTTATAGAGCACAGG - Intronic
1131974094 15:97925087-97925109 TTGTTTCATTTATAGAGCACAGG + Intergenic
1132420872 15:101667217-101667239 TTGTTGCATTTCTAGAACACAGG + Intronic
1133636614 16:7672522-7672544 CTGTCACATTTCAAGAGAACTGG + Intronic
1133684762 16:8155672-8155694 TTGTTTCATTTACAGAGCACAGG - Intergenic
1133684764 16:8155710-8155732 TTGTTTCATTTATAGAGCACAGG - Intergenic
1135832160 16:25785042-25785064 TTGTTCCATTTCTAGAGCACAGG - Intronic
1136448352 16:30337675-30337697 TTGGGCCATTGAAAGAGCATGGG + Intergenic
1137234068 16:46598553-46598575 TTGTTCCATTTCTAGGGCACAGG + Intronic
1137740447 16:50766257-50766279 TTGTTCCATTTATAGAGCACAGG - Intronic
1138073077 16:54012729-54012751 TTGTTCCATTTATAGAGCACAGG - Intronic
1138518288 16:57552119-57552141 TTATTCCATTTGTAGAGCACAGG + Intronic
1138836081 16:60436401-60436423 TTGTTCCAGTTGTAGAGCACAGG - Intergenic
1139013850 16:62665882-62665904 TTGTGACATTTAAAGAGAACAGG - Intergenic
1139977154 16:70821802-70821824 TTGTTCCATTTCCAGAGCATAGG - Intronic
1140162479 16:72512488-72512510 TTGTTTCATTTATAGAGCACAGG + Intergenic
1140872225 16:79117423-79117445 TTATTCCATTTATAGAGCACAGG + Intronic
1142047521 16:87935156-87935178 TTGGGCCATTGAAAGAGCATGGG - Intronic
1142116880 16:88361672-88361694 TGGTGACTTTTCATGAGCACTGG + Intergenic
1143753398 17:9048413-9048435 TTGTTCCATTTATAGGGCACAGG + Intronic
1143782953 17:9239086-9239108 TAGTGCCTTTTCCAGAGCCCCGG - Intronic
1144265742 17:13567183-13567205 TTGTTCCATTTGTACAGCACAGG - Intronic
1144530725 17:16036339-16036361 TTGTTCCATTTCTAGAGCACAGG + Intronic
1144706925 17:17375042-17375064 GTTTTCCATTTCTAGAGCACAGG - Intergenic
1145377581 17:22365447-22365469 TTGTTCCATTTATAGAGCACAGG + Intergenic
1146096926 17:29939305-29939327 TTGTTCCATTTATAGAGTACAGG + Intronic
1146115450 17:30133510-30133532 TTGTTTCATTTATAGAGCACAGG + Intronic
1146204788 17:30894016-30894038 TTCTGCTATTTCAAAAGCATTGG + Exonic
1146360050 17:32167287-32167309 TTATTCCATTTATAGAGCACAGG + Intronic
1146949624 17:36896866-36896888 GTGTGCCATTGAAAGAGCCCTGG - Intergenic
1147231197 17:39019496-39019518 TTGTTCCATTTATAGAACACAGG - Intergenic
1148692462 17:49538425-49538447 TTGTTCCATTTATAGAGCACAGG + Intergenic
1148696299 17:49561528-49561550 TTGTTCCATTTCTAGAGCACAGG - Intergenic
1149096652 17:52849343-52849365 CCGTGGCATTTTAAGAGCACTGG - Intergenic
1149299487 17:55291422-55291444 CTGTTCCATTTACAGAGCACAGG - Intronic
1150174335 17:63034294-63034316 TTGTTCCATTTATAGAGCACAGG - Intronic
1150468064 17:65411965-65411987 TTGTTCCATTTATAGAGCACAGG + Intergenic
1150662565 17:67096239-67096261 TTGTTCCATTTATAGAGCACAGG + Intronic
1152193232 17:78901250-78901272 ATTGGCCATTTCTAGAGCACAGG - Intronic
1152972029 18:171431-171453 TTGTTCCATATACAGAGCACAGG - Intronic
1153288014 18:3474394-3474416 TTGTTCCATCTGTAGAGCACAGG - Intergenic
1153352863 18:4100448-4100470 TTGTTCCATTTATTGAGCACAGG + Intronic
1153395321 18:4613639-4613661 TTTTTCCATTTATAGAGCACAGG + Intergenic
1153492756 18:5666600-5666622 TTGTTCCATTTCTAGATCACAGG + Intergenic
1153619186 18:6961068-6961090 ATGTTCCTTTTCAAGAGCATAGG - Intronic
1153696578 18:7649110-7649132 TTGTTCCCTTTACAGAGCACAGG - Intronic
1153738991 18:8103118-8103140 TTGTTCCATTTGTAGAGCACAGG + Intronic
1153841853 18:9014892-9014914 TTGCGCCATTCCAAGAGCAATGG + Intergenic
1153877892 18:9392004-9392026 TTGTTCCATTTCTAGGGTACAGG + Intronic
1154096575 18:11421950-11421972 TTGTTCTATTTCTAAAGCACAGG + Intergenic
1154341733 18:13508593-13508615 TTGTTCTATTTCTAGAGCACAGG - Intronic
1154953011 18:21228132-21228154 TTGTTCCATTTACAGAGCACAGG + Intergenic
1155074409 18:22342141-22342163 ACCTGCCATTTCAAGGGCACTGG - Intergenic
1155101667 18:22616642-22616664 TTCTTCCATTTCTAGAGCACAGG - Intergenic
1155137723 18:23012981-23013003 TTGTTCTATTTCTAAAGCACAGG - Intronic
1155580157 18:27295841-27295863 TTGTTCCATTTATAGAGTACAGG + Intergenic
1156130951 18:33973836-33973858 CTGTTCCATTTATAGAGCACAGG + Intronic
1156208147 18:34908216-34908238 TTGTGCCAGTAAAAGAGAACTGG + Intergenic
1156629238 18:38946825-38946847 TTGCTCCATTTATAGAGCACAGG - Intergenic
1157371786 18:47120065-47120087 TTATTCCATTTATAGAGCACAGG + Intronic
1157960410 18:52147550-52147572 TTATTCCATTTATAGAGCACAGG + Intergenic
1158204563 18:54978017-54978039 TTGTTTCATTTATAGAGCACAGG + Intergenic
1158816596 18:61105191-61105213 TTGTTCCACTTATAGAGCACAGG + Intergenic
1159180539 18:64896814-64896836 TTGTTCTATTTAGAGAGCACAGG + Intergenic
1159191286 18:65046196-65046218 TTGTTCCATTTATATAGCACAGG - Intergenic
1159332057 18:67008534-67008556 TTGTTCCATTTACAGAGCACAGG + Intergenic
1159700439 18:71619937-71619959 TTGTTCCATTTATAGAGCATAGG + Intergenic
1159740739 18:72166863-72166885 TTGTTCCATTTATAGAGCATAGG - Intergenic
1160009736 18:75097520-75097542 TTGTGCTTTCTGAAGAGCACTGG - Intergenic
1160450439 18:78960324-78960346 TTGTTGCATTTCTAGAGCACAGG + Intergenic
1160600221 18:80006844-80006866 GTGTGCCATTTACATAGCACTGG + Intronic
1162843874 19:13376436-13376458 TTGTTCCATTTATAGAGCACAGG - Intronic
1163274838 19:16277062-16277084 TAGTGCCATTTCAAGGGTTCTGG + Intergenic
1163565283 19:18047466-18047488 GAGTGCCATCTCAAGAGCAGGGG - Intergenic
1164490136 19:28703089-28703111 TTGTTCCATTTCTAGAGCACAGG + Intergenic
1164940324 19:32247446-32247468 TTTTTCCATTTCTAGAGCATAGG - Intergenic
1165125094 19:33589071-33589093 TTGTTCCATTTACAGAGCATAGG - Intergenic
1165753288 19:38275029-38275051 TTGTGACATTGAAAGAGCAAAGG + Intronic
1166410972 19:42555221-42555243 TTGTCCCATTTCAGCATCACTGG - Intronic
1166580116 19:43889392-43889414 TTGTCCCATTTCTAGAGCACAGG + Intronic
1167021710 19:46881614-46881636 TTGTTCCATTTATAGAGCACAGG + Intergenic
1168478959 19:56700965-56700987 TTGTTCCATTTATAGAGCACAGG - Intergenic
924980222 2:212779-212801 TTGTTCCATTTACAGAGCACAGG + Intergenic
925854124 2:8113397-8113419 GAGTTCCATTTCTAGAGCACAGG - Intergenic
926450043 2:12992058-12992080 TTGTTCTATTTATAGAGCACAGG - Intergenic
926469591 2:13237560-13237582 TTGTTCCATTTATAGAGCATAGG + Intergenic
926493430 2:13554424-13554446 TTGTTTCATTTACAGAGCACAGG + Intergenic
926608356 2:14920340-14920362 TTGCCCCATTTAAAGAGCATAGG + Intergenic
926818473 2:16825936-16825958 TTGTTCCATTTATAGGGCACAGG + Intergenic
927014320 2:18941615-18941637 TTGTTCCATTTATAGAGCACAGG + Intergenic
927105861 2:19824837-19824859 TTTTTCCATTTCTACAGCACAGG + Intergenic
927322478 2:21763372-21763394 TCGTTCCATTTTTAGAGCACAGG + Intergenic
927552636 2:24012541-24012563 TTATGTTATTACAAGAGCACTGG + Intronic
927657377 2:24961191-24961213 CTGTTCCATTTATAGAGCACAGG - Intronic
928607515 2:32957053-32957075 TTGTTCCATTTACAGAGCACAGG + Intronic
928726649 2:34181552-34181574 TTGTTCCATTTATAGGGCACAGG - Intergenic
928915942 2:36470534-36470556 TTGTTCCATTTATAAAGCACAGG - Intronic
929672922 2:43892411-43892433 TTGTTCCATTTATAGAACACAGG - Intronic
929813271 2:45209916-45209938 TTGTAACATTGCAAGAGCAAAGG - Intergenic
930322081 2:49868248-49868270 TTGTTCCATTTATATAGCACAGG + Intergenic
930859579 2:56056489-56056511 TTATTCCATTTATAGAGCACAGG + Intergenic
930899578 2:56487474-56487496 TTGTTCCACTTACAGAGCACAGG - Intergenic
931407821 2:61997659-61997681 TTGTTCCATTTATAGAGCACGGG + Intronic
931419566 2:62113814-62113836 TTCTGCCATTTATAGAGCAAAGG - Intronic
931961034 2:67483272-67483294 TTGTTCCATTTATAGAGCAAAGG - Intergenic
932033292 2:68212719-68212741 TTGTTCCATTTAGAGAGCACAGG + Intronic
932175355 2:69595968-69595990 TTGTTCCATTTATAGAGCACAGG - Intronic
932469874 2:71947528-71947550 TTGTTCCATTTATAGAGCACAGG + Intergenic
933301968 2:80551254-80551276 TTGTTCCATTTATAGAGCACAGG + Intronic
933350108 2:81143377-81143399 TTGTTCCATTTGCAGAGGACAGG - Intergenic
933386965 2:81623152-81623174 TTGTTCCGTTTATAGAGCACAGG + Intergenic
933630246 2:84647586-84647608 TTGTTTCATTTTTAGAGCACAGG - Intronic
933873662 2:86596226-86596248 TTGTTCCATTTATAGCGCACAGG - Intronic
934059067 2:88277334-88277356 TTGTCCCATTTATAGAGTACAGG - Intergenic
935228239 2:101073030-101073052 TTGTTCCATTTATAAAGCACAGG + Intronic
935288982 2:101593142-101593164 TTGTTCCATTTATAGAGTACAGG + Intergenic
935485602 2:103649619-103649641 TTATTCCATTTATAGAGCACAGG - Intergenic
936079934 2:109425596-109425618 TTGTCCCATTTACACAGCACAGG - Intronic
936257002 2:110925153-110925175 TTGTTTCATTTCTAGAGCACAGG + Intronic
937099328 2:119256638-119256660 TTTTGCCACTGCAAGAGCAGGGG + Intronic
938424064 2:131169525-131169547 TTGTTCCATTTATACAGCACAGG - Intronic
938606506 2:132898839-132898861 TTGTACCATTTACAGAGGACAGG + Intronic
938876887 2:135541088-135541110 TTGTTTCATTTATAGAGCACAGG + Intronic
939131671 2:138242863-138242885 GTGTGACATTTAAATAGCACTGG + Intergenic
939132121 2:138248470-138248492 TTGTTCCATTTATAGAGCACAGG + Intergenic
939486505 2:142819072-142819094 TTGTTTCATTTGTAGAGCACAGG + Intergenic
939786960 2:146526673-146526695 TTGTTCCATTTATAGGGCACAGG - Intergenic
939867849 2:147494550-147494572 TTGTTCCATTTGTAGAGCACGGG - Intergenic
939931278 2:148236625-148236647 TTGTTTCATTTATAGAGCACAGG + Intronic
939933607 2:148261097-148261119 TTATTCCATTTATAGAGCACAGG + Intronic
940018326 2:149130227-149130249 ATTTGCCATTTTAAGAGCAAAGG - Intronic
940199214 2:151131743-151131765 TTGTTCCATTGATAGAGCACAGG + Intergenic
940496034 2:154429885-154429907 TTGTTCCATTTACAGAGCACAGG - Intronic
941084048 2:161095828-161095850 TTGTAGCATTTCCAGAGTACTGG - Intergenic
941503696 2:166312910-166312932 TTGTTCTATTTATAGAGCACAGG + Intronic
941903692 2:170701311-170701333 CTGTGCCCTTTCACCAGCACTGG - Intergenic
942050937 2:172140345-172140367 TTGTTCCATTTATAGAGCATGGG - Intergenic
942077428 2:172368942-172368964 TTGTTCCATTTGTAGAGCACAGG - Intergenic
942822315 2:180129035-180129057 TTGTTCCATTTGCAGAGCACAGG + Intergenic
942999206 2:182303505-182303527 TCGTTCCATTTCTAGAGCACAGG + Intronic
943123380 2:183765894-183765916 TTGTTCCATTTCTAAAGGACAGG + Intergenic
943187357 2:184628268-184628290 TTGTGCCATTGCAACAGCCTGGG + Intronic
943583068 2:189706962-189706984 TGCTGCCACTTCAGGAGCACTGG + Exonic
943604803 2:189964325-189964347 TTGTTCCATTTATAGAGCACAGG + Intronic
943769628 2:191702544-191702566 TTTTCCCATTTATAGAGCACAGG - Intergenic
943883061 2:193171875-193171897 GTGTTCCATTTATAGAGCACAGG - Intergenic
944003652 2:194875126-194875148 CTGTTCCATTTATAGAGCACAGG - Intergenic
944421536 2:199536217-199536239 CTGTGGCATTTCAACAGCCCAGG - Intergenic
944623199 2:201540523-201540545 TTGTTCCATTTATAGAGCACAGG - Intronic
944720153 2:202415658-202415680 TTGTTCCATTCATAGAGCACAGG - Intronic
945126243 2:206513878-206513900 TTGTTCCATTTATGGAGCACAGG - Intronic
945487179 2:210410220-210410242 TTGTTCCATTCACAGAGCACAGG + Intergenic
945690856 2:213033717-213033739 CTGTTCCATTTATAGAGCACAGG + Intronic
946091536 2:217229287-217229309 TTGTTACATTTATAGAGCACAGG + Intergenic
946264885 2:218531315-218531337 TTGTTCCATTTCTAGAGCACAGG - Intronic
946713527 2:222530152-222530174 TTATTTCATTTCTAGAGCACAGG + Intronic
947020666 2:225671994-225672016 TTTTTTCATTTCTAGAGCACAGG + Intergenic
947256382 2:228169462-228169484 TTGTTCCATTTACAGAGCACAGG - Intronic
948518215 2:238519559-238519581 TGCTGCCATTTCAAGAGGCCTGG + Intergenic
1168735208 20:129486-129508 TTGTTCCTTTTCATGAGCATGGG + Intergenic
1169322284 20:4643433-4643455 CTGTTCCATTTTTAGAGCACAGG - Intergenic
1169485271 20:6025313-6025335 CTATTCCATTTCTAGAGCACAGG - Intronic
1169756584 20:9049634-9049656 TTGTTTCATTTACAGAGCACAGG + Intergenic
1169835652 20:9874793-9874815 TTTTGCCAGTTCAAGAGCCTTGG + Intergenic
1169836639 20:9887452-9887474 GTGATCCATTTCTAGAGCACAGG + Intergenic
1170246883 20:14231084-14231106 TTGTTCCATTTATAGAGCACAGG + Intronic
1170252329 20:14298002-14298024 TTCTTCCATTTACAGAGCACAGG - Intronic
1170397202 20:15939417-15939439 TTGTGCCATTTACAGAGCACAGG - Intronic
1170682679 20:18540466-18540488 TTGTTCCTTTTGTAGAGCACAGG + Intronic
1170904489 20:20501052-20501074 TTGTTCCATTTATTGAGCACAGG + Intronic
1171205556 20:23276952-23276974 TTGTTCCAATTATAGAGCACAGG - Intergenic
1171323739 20:24271743-24271765 TTGTTCCATTTATAGATCACAGG + Intergenic
1171792137 20:29537148-29537170 TTGTTCCATTTATAGAGCACGGG + Intergenic
1171856218 20:30345797-30345819 TTGTTCCATTTATAGAGCAGGGG - Intergenic
1172184366 20:33022046-33022068 TTGTGCCCATTCCAGGGCACAGG - Intronic
1172818177 20:37707099-37707121 TTATTCCATTTCTAGAACACAGG + Intronic
1173381182 20:42543982-42544004 TTGTTCCATTTACAGAGCACAGG + Intronic
1173665626 20:44761163-44761185 TTGTGGCATTTAGTGAGCACTGG - Intronic
1173707297 20:45120899-45120921 TTGTTCCACTTATAGAGCACAGG + Intergenic
1174650628 20:52121950-52121972 TGGTTCCATTTCTAGAGCACAGG - Intronic
1174847322 20:53955230-53955252 TTCTGCCCTCTGAAGAGCACCGG - Intronic
1175088293 20:56479915-56479937 TTCTTCCATTTCGAGAGTACAGG + Intronic
1175167905 20:57058740-57058762 TTGTTCCATTGCTAGAGCACAGG + Intergenic
1175408532 20:58751175-58751197 TTGTGCAATTCAAAGAGCATGGG + Intergenic
1175649767 20:60709597-60709619 TTGTTTCATTTCTAGAGCACAGG - Intergenic
1177044097 21:16147843-16147865 TTGTTTCATTTATAGAGCACAGG - Intergenic
1177401462 21:20611078-20611100 TTGTTCCATTTCTACAGGACAGG - Intergenic
1177413695 21:20767078-20767100 TTGTTTCATTTCTAGAACACAGG + Intergenic
1177472899 21:21581711-21581733 GTATTCCATTTCTAGAGCACAGG - Intergenic
1177699791 21:24623119-24623141 TTGTTCCATTTATAGAGCACAGG - Intergenic
1177807997 21:25894041-25894063 TTGTTCCATTTATAGAGCATGGG - Intronic
1178100474 21:29263212-29263234 TTGTTCCATTTATAGAGCATAGG + Intronic
1178177023 21:30114098-30114120 TTGTTCCATTTATAGAGGACAGG + Intergenic
1178519323 21:33274743-33274765 TTGCTCCATTTGTAGAGCACAGG + Intronic
1179148646 21:38791685-38791707 TTGTTCCATTTCTAGAGAACAGG + Intergenic
1179675317 21:42977145-42977167 TTATTCCATTTCCAGAGCACAGG + Intronic
1179814103 21:43892562-43892584 TTATTCCATCTCTAGAGCACAGG + Intronic
1180651920 22:17384654-17384676 TTTTCCCATTTAGAGAGCACAGG + Intronic
1180932504 22:19602385-19602407 TTGTTCCATTTCTAGAGCGCAGG + Intergenic
1181663988 22:24377840-24377862 TTGTTCCATTTATAGAGCACAGG + Intronic
1181871285 22:25901280-25901302 TTCTGCCATATCAAGATCTCTGG + Intronic
1181897391 22:26122424-26122446 TAGATCCATTTCAAGTGCACCGG - Intergenic
1182228470 22:28818426-28818448 TTGTCCCATCTCAGGAGCCCTGG - Intergenic
1182258910 22:29058761-29058783 TTGGGCCATTTCTTGAGTACAGG + Exonic
1182514163 22:30843537-30843559 TTGTTCCATTTATAGAGCATAGG + Intronic
1182603375 22:31484882-31484904 TTCTGCCACTTCAAGTTCACGGG - Intronic
1182731250 22:32496531-32496553 TTGTTCCATTTACAGAGCAAAGG - Intronic
1183008377 22:34923420-34923442 TTGTTCCATTTCTAGAGCACAGG + Intergenic
1183234098 22:36603677-36603699 TTGTCTCATTTATAGAGCACAGG - Intronic
1183268072 22:36842599-36842621 TTTTTCCATTTATAGAGCACAGG - Intergenic
1184363467 22:44032924-44032946 CTGTGTCATTTCAGCAGCACTGG + Intronic
1184831135 22:46988701-46988723 TTGTTCCATTTATAGAGCACAGG + Intronic
949623162 3:5838681-5838703 TTGTTTCATTTATAGAGCACAGG + Intergenic
949626490 3:5872660-5872682 TTGTTCCATTTATAGAGCATAGG - Intergenic
949809864 3:7995187-7995209 TTGTCCCATTTCTAGAGCACAGG - Intergenic
949813432 3:8032936-8032958 TTGTTTCATTTCTAGAGCACAGG + Intergenic
950562183 3:13738249-13738271 TGGTTCCATTTCTAGAGCACAGG - Intergenic
950632536 3:14292753-14292775 TTGTTCCATTTCTAGAGCACAGG - Intergenic
950700264 3:14739456-14739478 TTGTTCCATTTATATAGCACAGG + Intronic
950838571 3:15944588-15944610 CTGTTCCATTTATAGAGCACAGG - Intergenic
950957908 3:17074396-17074418 TTGATCCATTTATAGAGCACGGG + Intronic
951042890 3:18007589-18007611 TTGTTCCATTTACAGAGCATAGG + Intronic
951096732 3:18640888-18640910 TTGTTCCATTTATAGAGCACAGG + Intergenic
951164190 3:19465306-19465328 TTGTTCCATTTATAGAGTACAGG - Intronic
951373378 3:21881387-21881409 TTGTTTCATTTATAGAGCACAGG - Intronic
951413912 3:22399426-22399448 TTGTGACATTTCATTAGCAATGG - Intergenic
951422239 3:22500686-22500708 TTGTTCCATTTATAGAACACAGG - Intergenic
951530004 3:23689669-23689691 TTGTTCCATTTACAGAGCACTGG + Intergenic
951667169 3:25139905-25139927 TTGTTCCACTTATAGAGCACAGG - Intergenic
951741351 3:25927929-25927951 TTATTCCATTTATAGAGCACAGG + Intergenic
952201122 3:31128765-31128787 TTGTTCCATTTATAGAGCACAGG + Intergenic
952243797 3:31562821-31562843 TGGTGCCATTTTGAGAACACAGG - Intronic
952390876 3:32878700-32878722 TTTTTCCATTTGTAGAGCACAGG + Intronic
952637201 3:35546300-35546322 TTGTGACATATCAAGATAACTGG + Intergenic
952660218 3:35837001-35837023 TTGTTCCATTTATAGAGCACAGG + Intergenic
952774879 3:37035624-37035646 TTGTTCCATTTATAGAGCAGAGG - Intronic
952774974 3:37036626-37036648 TTGTTCCATTTATAGAGCACAGG - Intronic
952805909 3:37351815-37351837 TTGTTTCATTTCTAGAGCACAGG + Intronic
953174554 3:40538112-40538134 ATCTTCCATTTCTAGAGCACAGG - Intronic
953445778 3:42964761-42964783 TTGTTCCATTTATAGAGCACAGG - Intronic
953486917 3:43308533-43308555 TTGTTCCATTTATAGAGCACAGG - Intronic
953646354 3:44759429-44759451 TTTTTCCATTTCTAGAGCACAGG + Intronic
955211230 3:56943341-56943363 TTGTTCCCTTTATAGAGCACAGG - Intronic
955459791 3:59169428-59169450 TTGTTCTATTTATAGAGCACAGG - Intergenic
955593607 3:60564161-60564183 TTGTTCCATTTACAGAGCACAGG - Intronic
955675075 3:61439605-61439627 TTGTGCCAATTCCAGAGCTAGGG + Intergenic
955678226 3:61471834-61471856 TTGTTCCATTTCTGGAGCAAAGG + Intergenic
955679414 3:61485054-61485076 ATGTTCCATTTCTACAGCACAGG + Intergenic
955969872 3:64427897-64427919 TTGTTCTATTTATAGAGCACGGG - Intronic
956063478 3:65372421-65372443 TTGTTCCATTTCTAGAGCACAGG + Intronic
956163137 3:66375589-66375611 TTGTTCCATTTCTACAGCAGAGG - Intronic
956180404 3:66512687-66512709 TTGTTCCATTTCTAGATCAGAGG + Intergenic
957233589 3:77554154-77554176 TTTTTCCATTTACAGAGCACAGG - Intronic
957572976 3:81971856-81971878 TTTTTCCATTTATAGAGCACAGG - Intergenic
957707055 3:83802487-83802509 TTGTTCTATTTAAGGAGCACAGG + Intergenic
957955655 3:87183771-87183793 TTGTTCCATTTACAGAGCACAGG + Intergenic
958051041 3:88346554-88346576 TTGTTCCATTTCTAGTGCACAGG - Intergenic
958121576 3:89296565-89296587 TTGTTCCATTTGTAGAGCACAGG + Intronic
958655457 3:96996728-96996750 TTGTTCCATTTATAGAGCATGGG + Intronic
958661674 3:97076828-97076850 TTGTTCCATTTACAGAGCACAGG - Intronic
958840525 3:99199056-99199078 TTGTTCCATTTATAAAGCACAGG + Intergenic
958960856 3:100508298-100508320 TGGTGCCCTTTCGAGAGCCCAGG + Intronic
959177538 3:102934284-102934306 TTGTTTCATTTCTAGAGCACAGG - Intergenic
959182469 3:102999078-102999100 CTGTGGCTTTTCAAGAGCATTGG + Intergenic
959210155 3:103368584-103368606 TTATTCCATTTATAGAGCACAGG + Intergenic
959390421 3:105765657-105765679 TTGTTCCATTTGTAGAGCACAGG - Intronic
959413139 3:106049963-106049985 TTGTTCCATTTATAGAGTACAGG - Intergenic
959821061 3:110736174-110736196 TTGTTCCATTTATAGAGCAAAGG + Intergenic
959988432 3:112603106-112603128 TTGCTCCATTTATAGAGCACAGG - Intergenic
960458007 3:117897601-117897623 TTGTTCCATTTCTAGAGCATAGG - Intergenic
960599499 3:119441933-119441955 TTGTTCTATTTCTAGAGCATTGG - Intronic
960656926 3:120015116-120015138 TTGTGACACTTGAATAGCACAGG + Intronic
960669401 3:120141728-120141750 TTGTTACATTTATAGAGCACAGG - Intergenic
961411537 3:126725443-126725465 TTGTTCCATTTCTAGAGCACTGG + Intronic
961613219 3:128157599-128157621 TTGTGCCATTTCAAGAGCACAGG - Intronic
961733109 3:128981952-128981974 TTGTTCCATTTCTAGAGCACAGG + Intronic
962116040 3:132508798-132508820 TTCTTCCATTTATAGAGCACAGG - Intronic
962157368 3:132962090-132962112 TTGTCCCATTGATAGAGCACAGG + Intergenic
962663524 3:137629806-137629828 TTGTTCCATTTATAGAGAACAGG + Intergenic
962711827 3:138093372-138093394 TTGTTCCATTTTTAGAGCACAGG + Intronic
963183765 3:142390107-142390129 CTGTTCCATTTATAGAGCACAGG + Intronic
963243094 3:143030372-143030394 TTGTTCCATTTATAGAGCACAGG - Intronic
963579335 3:147104605-147104627 TTGTTCCAATTCATGAACACAGG + Intergenic
963929977 3:150993681-150993703 TTGTTCCATTTATAGAGCACAGG + Intergenic
964019061 3:151984792-151984814 TTGTTCCATTTGTAGAGCACAGG + Intergenic
964440003 3:156698506-156698528 TTTTTCCATTTATAGAGCACAGG - Intronic
964535069 3:157712123-157712145 TTGTTCCATTTATAGTGCACAGG - Intergenic
964596894 3:158443070-158443092 TTGTTCCATTTATAGAGCACAGG + Intronic
964599194 3:158476558-158476580 TTGTTCCATTTATAGAGGACAGG - Intronic
964785173 3:160388718-160388740 TTGTCCTATTTTAAGATCACTGG - Intronic
964870455 3:161308360-161308382 TTGTCCTATTTATAGAGCACAGG - Intergenic
965255606 3:166405769-166405791 TTGTTCTATTTCTAGAGCACAGG + Intergenic
965276423 3:166688699-166688721 TTGTTCCATTTACAGAGCAGAGG - Intergenic
965363340 3:167767229-167767251 TTGTTCCATTTGTAGAGCACAGG - Intronic
965438748 3:168686540-168686562 TTGTTCCATTTATAGAGCACAGG - Intergenic
965831206 3:172791203-172791225 TTGTTTCATTTATAGAGCACAGG + Intronic
966214262 3:177485577-177485599 TTGTTCCATTTATAGACCACAGG + Intergenic
966717488 3:183028181-183028203 TTGTTCCATTTATAGGGCACAGG - Intronic
966750751 3:183319827-183319849 TTGTTCTATTTCTAGGGCACAGG + Intronic
966814184 3:183875966-183875988 TTGTTCGATTTGTAGAGCACGGG - Intronic
967077449 3:186016694-186016716 TTGTTCCATTTCTAGAGCACAGG + Intergenic
967531227 3:190550484-190550506 TTGTGACATTTCCAGATAACTGG + Intronic
967578120 3:191121238-191121260 TTGTTCCATGGCAAGAGTACTGG - Intergenic
967661400 3:192114894-192114916 TTGTTCCTTTTCTAGAGCATAGG + Intergenic
967710724 3:192704528-192704550 TTGTTCCATTTATAGAACACAGG + Intronic
967766630 3:193287490-193287512 TTGTTCCATTTCTAGAGCACAGG - Intronic
969217954 4:5737635-5737657 TTGTTCCACTTATAGAGCACAGG - Intronic
970479161 4:16455998-16456020 TTGTTCCATTTCTGGAGCATAGG + Intergenic
970884542 4:20972606-20972628 TTGTTCCACTTACAGAGCACAGG + Intronic
970992161 4:22224879-22224901 TTCTCACATTTCAAGAGCTCTGG - Intergenic
971071268 4:23095000-23095022 TTGCTCCATTTATAGAGCACAGG - Intergenic
971143410 4:23949460-23949482 TTGTGCCAGTTAATTAGCACTGG + Intergenic
971441339 4:26690604-26690626 TTGTTCCATTTATAGAGCACAGG - Intronic
971609807 4:28708646-28708668 TTGTTCCATTTATAGAGCATAGG - Intergenic
972560389 4:40222481-40222503 TTGTTCCATTTATAGAGCACAGG - Intronic
972948135 4:44283570-44283592 TTGTTCCATTTATAGATCACAGG - Intronic
973235228 4:47895192-47895214 TTGTTCCATTTGCAGAGCATAGG + Intronic
974397102 4:61351654-61351676 TTGTTCCATTTATATAGCACAGG - Intronic
974448770 4:62022690-62022712 TTGTTCCATTTATAGAGCACAGG - Intronic
974471696 4:62327024-62327046 TTATTCCATTTATAGAGCACAGG - Intergenic
974709904 4:65577003-65577025 TTGTACCTGTTCAAGAACACTGG - Intronic
975323064 4:73030163-73030185 TTGTTTCATTTACAGAGCACAGG - Intergenic
975324687 4:73045991-73046013 TTGTTTCATTTACAGAGCACAGG + Intergenic
975475465 4:74818176-74818198 TTGTTCCACTTACAGAGCACAGG + Intergenic
975686436 4:76920348-76920370 TTGTTCCATTTATAGAGGACAGG + Intergenic
976256045 4:83101851-83101873 TGGTTCCATTTATAGAGCACAGG - Intronic
976433018 4:84985511-84985533 TTGTTCCATTGATAGAGCACAGG - Intergenic
976465328 4:85361696-85361718 TTGTTGCATTTCTAGAGCATCGG + Intergenic
976835370 4:89366659-89366681 TTGTTCCATTTATTGAGCACAGG - Intergenic
977013615 4:91663941-91663963 TGGTGCCATTTTGAGAGCCCAGG - Intergenic
977024723 4:91802952-91802974 TTGTTCCATTTATAGAACACAGG - Intergenic
977071976 4:92402683-92402705 TTGTTCCATTTATAGAGCACAGG + Intronic
977104074 4:92857963-92857985 TTGTTCCATTTATAGAACACAGG - Intronic
977224776 4:94382882-94382904 TTGTTTCATTTATAGAGCACAGG + Intergenic
977368882 4:96108878-96108900 TTGTTCTATTTCTAGAGCACAGG - Intergenic
977596991 4:98894158-98894180 TTGCTCCATTTCTAGAGCATGGG + Intronic
977612823 4:99053973-99053995 TTGTTCTGTTTCTAGAGCACAGG + Intronic
977714996 4:100172323-100172345 TTATTCCATTTATAGAGCACAGG + Intergenic
977915818 4:102591551-102591573 TTGTTCCATTTACAGAGCAAAGG - Intronic
977981197 4:103324401-103324423 TTGTTCCATTTCTCGAGCACAGG + Intergenic
978122690 4:105099583-105099605 TTGTTCCATTTATAGAGCACAGG + Intergenic
978125739 4:105133350-105133372 TTGTTCCATTTATAGAGCACAGG + Intergenic
978204219 4:106060425-106060447 TTGTTCCATTTATAGAACACAGG - Intronic
978212055 4:106148692-106148714 TTGTTCCATTTATAGAACACAGG + Intronic
978762955 4:112374899-112374921 TTGTGCCACTTATAGAGCACAGG + Intronic
979123636 4:116936898-116936920 TTGTTTCATTTGCAGAGCACAGG + Intergenic
979345568 4:119582900-119582922 TTGTTCCATTTGCAGAGGACAGG + Intronic
979811639 4:125043518-125043540 TTATTCCATTTATAGAGCACGGG - Intergenic
979846182 4:125515380-125515402 TTGTTGCATTTATAGAGCACAGG + Intergenic
979973889 4:127171727-127171749 TTGTTCCATTTAAAGAGCACAGG - Intergenic
980221376 4:129920464-129920486 TTGTTCCATTTATAGAGCACAGG - Intergenic
980549653 4:134317961-134317983 TTAATCCATTTCTAGAGCACAGG + Intergenic
980640617 4:135573768-135573790 TTGTACCATTTATAAAGCACAGG + Intergenic
980654897 4:135768700-135768722 TTGTTCCATTTATAGAGCACAGG + Intergenic
980680361 4:136152313-136152335 TTGTTCCATTTCCTGAGGACTGG + Intergenic
980680573 4:136154985-136155007 TTGTTCCATTTCCTGAGGACTGG + Intergenic
980749610 4:137071045-137071067 TAGTGCCATTCTAAGAGCCCAGG - Intergenic
980952804 4:139398221-139398243 TTGTCCCATTTATAGAGTACAGG + Intronic
981294993 4:143121487-143121509 TTGTGCCAAGTCATGAGCAGTGG + Intergenic
981416659 4:144501253-144501275 TTTTTCCATTTCTAGAGCACAGG - Intergenic
981493083 4:145362025-145362047 TTGTTCCATTTATAGTGCACAGG - Intergenic
981628742 4:146792343-146792365 TTGTTCCATTTATAGAGCACAGG - Intronic
981898346 4:149832170-149832192 TTGTTCCATTTACAGAGCACAGG + Intergenic
981924364 4:150122011-150122033 TTGTTCCATTTATAGAGCACAGG + Intronic
981995425 4:150968972-150968994 TTGTTCCATTTATAGAGCATAGG - Intronic
982149465 4:152436762-152436784 TTATTCCATTTGTAGAGCACAGG - Intronic
982169889 4:152650988-152651010 TTGTTCCACTTACAGAGCACAGG + Intronic
982224350 4:153152555-153152577 TTGGACCATTTCCAAAGCACGGG - Intronic
982458940 4:155643888-155643910 TTGTTCCATTTATAGAGCACAGG - Intergenic
982887560 4:160801016-160801038 TTCTTCCAATTCATGAGCACAGG - Intergenic
982946146 4:161626377-161626399 TTGTTCCATTTAAGAAGCACAGG - Intronic
983086447 4:163450781-163450803 TTGTCCCATTTCTATAGCACAGG + Intergenic
983134445 4:164063099-164063121 TTGTTCCATTTATAGAACACAGG + Intronic
983290178 4:165792716-165792738 TTGTTCCATTTATAGAACACAGG + Intergenic
983445009 4:167839226-167839248 TTGTACTATTTCAATATCACTGG + Intergenic
983701901 4:170607213-170607235 TTGTTCAATTTATAGAGCACAGG + Intergenic
983764360 4:171459059-171459081 TTTTTCCATTTCTAGAGTACAGG + Intergenic
983875459 4:172869807-172869829 TTGCTCCATTTCTAGAGCAGAGG - Intronic
983963305 4:173780185-173780207 TTGTTCCATTTCTAGAGCACAGG - Intergenic
984084290 4:175289272-175289294 TTGTTCCATTTACAGAGCACAGG + Intergenic
984174561 4:176400159-176400181 CTGTTCCATTCCTAGAGCACTGG - Intergenic
984258537 4:177416187-177416209 TTGTTCCATTTATAGAGCACAGG + Intergenic
984326195 4:178254473-178254495 TTGTTTCATTTCTACAGCACAGG + Intergenic
984535846 4:180974281-180974303 TTGTTCCATCTCAAGAACCCTGG + Intergenic
984685630 4:182665238-182665260 TTGTTCCATTTATAGAGCACAGG - Intronic
984898864 4:184566570-184566592 TTGTTCCATTTATAGAGCACAGG + Intergenic
985384558 4:189431811-189431833 TTGTGCCTGTCCCAGAGCACAGG + Intergenic
985430323 4:189873093-189873115 TTGTTCCATTTGTAGAGCACAGG - Intergenic
1202765973 4_GL000008v2_random:148844-148866 TTGTCCCATATCCATAGCACAGG + Intergenic
986408469 5:7450831-7450853 TTGTTCCATTTATAGAGTACAGG - Intronic
986466713 5:8033366-8033388 CTGTGTAAATTCAAGAGCACTGG + Intergenic
986485778 5:8235397-8235419 TTCTTCCATTTATAGAGCACAGG + Intergenic
987088969 5:14494319-14494341 TTGTTCCATTTCTAGAGCACAGG - Intronic
987142267 5:14958406-14958428 TGGTGCAACTTCATGAGCACTGG + Intergenic
987238007 5:15962926-15962948 TTGTTCCATTTATAGAGCACAGG - Intergenic
987529445 5:19098472-19098494 TTGTTCCATTTATAAAGCACAGG - Intergenic
987626160 5:20403686-20403708 TTGTTCCATTTATAGAACACAGG + Intronic
987920014 5:24267650-24267672 TTGTTCCGTTTATAGAGCACAGG - Intergenic
987935415 5:24457658-24457680 TTATTCCATTTATAGAGCACAGG + Intergenic
988259931 5:28873293-28873315 TTGTTCCTTTTCTAGAGCACAGG + Intergenic
989128644 5:38081848-38081870 TTGTTCCATTTATAAAGCACAGG - Intergenic
989374961 5:40751434-40751456 TTGTTCCATTTATAGAACACAGG + Intronic
989729366 5:44629894-44629916 TTGTTCCATTTAGAGAACACAGG - Intergenic
990572082 5:57089185-57089207 TTGTTCCATTTATGGAGCACAGG - Intergenic
991190318 5:63864848-63864870 TTGTTCCATTTATAGAGTACAGG + Intergenic
991332564 5:65507884-65507906 TTGACACATTTCAAGAGTACTGG + Intergenic
991428264 5:66514845-66514867 TTGTTCCATTTATAGGGCACAGG + Intergenic
992074627 5:73179874-73179896 TTGTTTCATTTCTAGAGCACAGG - Intergenic
992592960 5:78314753-78314775 TAGTTCCATTTCTAGAGCACAGG + Intergenic
992730503 5:79662702-79662724 TTTTTCCATTTATAGAGCACTGG + Intronic
992820906 5:80495041-80495063 TTGTTACGTTTCTAGAGCACAGG - Intronic
992922301 5:81538739-81538761 TTGTTCCATTTATAGAACACAGG - Intronic
993082203 5:83315642-83315664 TTGTTCCATTTCTTGAGCAAAGG - Intronic
993400397 5:87442667-87442689 TTGTTCCATTTATAGGGCACAGG + Intergenic
993893226 5:93500364-93500386 TTGTTCCATTTATAGAGCACAGG - Intergenic
994253675 5:97567441-97567463 TTGTTCCATTTCTAGAGCACTGG - Intergenic
994542467 5:101117472-101117494 TTATGTCATTTCAGGAGCAGGGG - Intergenic
994736847 5:103566374-103566396 TTGCTCCATTTAGAGAGCACAGG - Intergenic
995214319 5:109577571-109577593 TTGCTCCATTTCTAGAGCACAGG + Intergenic
995339466 5:111041599-111041621 TTGTTCCATTTATAGAGCTCAGG + Intergenic
995505710 5:112858793-112858815 TTGTTCCATTTAGAGAACACAGG + Intronic
995556585 5:113336134-113336156 TGGTGCCATTTTAAAAGGACAGG - Intronic
995658706 5:114456289-114456311 TTGTTCCATTTACAGGGCACAGG - Intronic
995678434 5:114689928-114689950 TTGTTCCATTTATAAAGCACAGG + Intergenic
995989584 5:118221051-118221073 TTGTTCCATTTTGAGAGCACAGG + Intergenic
996067395 5:119094339-119094361 TTGTTCCACTTGTAGAGCACAGG - Intronic
996194544 5:120587547-120587569 TTGTTCCATTTCTAGAGCAAGGG - Intronic
996464964 5:123789581-123789603 TTGTTCCACTTATAGAGCACAGG - Intergenic
996517629 5:124390412-124390434 TTGTTCCATTTACAGAGCACAGG + Intergenic
996841897 5:127855909-127855931 TCGTTCCATTTATAGAGCACAGG + Intergenic
996847526 5:127916775-127916797 TTTTTCCATTTCTAGAGCACAGG + Intergenic
997484007 5:134213314-134213336 TTGTTCCATTTCTAGAGCACAGG - Intronic
997566520 5:134891554-134891576 TTGTTCCTTTTCTAGAGCACAGG + Intronic
997577171 5:134989180-134989202 TTATTCCATTTCTAGAGCACAGG + Intronic
997766445 5:136508464-136508486 TTGGGCCCATTCAAGAGCAATGG + Intergenic
997835524 5:137189442-137189464 TTGTTCCATTTTTAGAGTACAGG - Intronic
998847066 5:146320996-146321018 TTGTTCCATTTATAGAACACGGG - Intronic
999039207 5:148388254-148388276 TTGTTCCTTTTATAGAGCACAGG + Intronic
999491788 5:152058374-152058396 TGGCGCAATTTCAGGAGCACTGG - Intergenic
999509602 5:152235173-152235195 TTGTTCCATTTCTAGAGCACAGG + Intergenic
999688076 5:154120360-154120382 TTGTTCCATTTATAGAGCAAAGG - Intronic
999884582 5:155907112-155907134 CTGTTCCATTTCTAGAGCACAGG - Intronic
999897169 5:156047544-156047566 TTGTTCCATTTCTAGGGCATAGG - Intronic
1000312537 5:160058976-160058998 TTGTTCCATTTCTAGAGCACAGG + Intronic
1000462580 5:161541263-161541285 GTTTTCCATTTCTAGAGCACAGG + Intronic
1000542465 5:162557081-162557103 TTGTTTCATTTATAGAGCACAGG + Intergenic
1000758304 5:165188144-165188166 TTGTTCCATTTACAGAGCACAGG - Intergenic
1000838796 5:166189916-166189938 TTGTTCCATTTACAGAGCATAGG - Intergenic
1001165402 5:169361135-169361157 ATCTGCCATTTTTAGAGCACTGG + Intergenic
1001369670 5:171186018-171186040 TTGCTCTATTTCTAGAGCACAGG + Intronic
1001731980 5:173967378-173967400 GTCTGCCATTTTTAGAGCACTGG + Intergenic
1002953551 6:1840110-1840132 CTGTGACATTTGAAGTGCACTGG - Intronic
1003187665 6:3847057-3847079 TTGTTCCATTTACAGAGCACAGG + Intergenic
1003403970 6:5813227-5813249 TTGTTCCATTTATAAAGCACAGG + Intergenic
1003844477 6:10158800-10158822 CTGTGACCTTTCAAGAGCAAGGG + Intronic
1003920146 6:10825269-10825291 TTGAGCCATTGAAAGAGCTCTGG + Intronic
1004188420 6:13442677-13442699 TTGTTCCATGTATAGAGCACAGG - Intronic
1004550400 6:16641467-16641489 TTGTTCCATTTCTATAGCACTGG - Intronic
1004823528 6:19396103-19396125 TTGTTCCATTTATAGAGCACAGG + Intergenic
1005213917 6:23502648-23502670 TTTTTCCATTTAGAGAGCACAGG + Intergenic
1005663927 6:28029939-28029961 TTGTGTTATTTCTAGAGCACAGG - Intergenic
1005689957 6:28294630-28294652 TTGTTCCATTTCTAGAGTACAGG - Intronic
1005703201 6:28425276-28425298 TTGTTCCATTTCTAGAGCACAGG + Intergenic
1006245283 6:32728869-32728891 TTGTTTCATTTATAGAGCACAGG - Intergenic
1006693507 6:35910804-35910826 TTGTTCCATTTATAGAGCACAGG - Intronic
1006973633 6:38074896-38074918 TTGTTCCATTTACAGAACACAGG - Intronic
1007017689 6:38485683-38485705 TTGTTCCATCTACAGAGCACAGG + Intronic
1007684983 6:43661180-43661202 TTGTTCCATCTATAGAGCACAGG + Intronic
1008120702 6:47613602-47613624 TTGTTCCATTTGTAGAGCATAGG + Intronic
1008653663 6:53589022-53589044 CTGTGCCATTATATGAGCACAGG - Intronic
1008761259 6:54853540-54853562 TTGTTCCATTTACAGAGCACAGG - Intronic
1009984272 6:70764545-70764567 TTGTTCCACTTAGAGAGCACAGG - Intronic
1011096025 6:83663997-83664019 TTGTTCCATTTATAGAGCACAGG - Intronic
1011115733 6:83889452-83889474 TTGTCCCATTTATAGAGCACAGG - Intronic
1011387829 6:86816340-86816362 TTGTTCAATCTCAAAAGCACAGG + Intergenic
1011653525 6:89528971-89528993 TTGTTCCATTTATAGAGTACAGG + Intronic
1011798616 6:90983848-90983870 TTGTGCCAGTTAAAGATCACTGG - Intergenic
1011908458 6:92403879-92403901 TTGTCCCATTTATAGAGCACAGG + Intergenic
1012080207 6:94748747-94748769 TTGTTCAATTTCTAGAGCATGGG + Intergenic
1012185768 6:96214619-96214641 TTAAGCCCTTTCAAAAGCACAGG - Exonic
1012564959 6:100637255-100637277 TTGTTCCATTTATAGAGCACAGG - Intronic
1012836976 6:104281400-104281422 TTGAGCCATTGCAAAAACACTGG + Intergenic
1013266401 6:108503568-108503590 TTGTTCCATTTTTAGGGCACAGG + Intronic
1013347321 6:109274142-109274164 TTATTCCATTTGCAGAGCACAGG + Intergenic
1013381961 6:109581986-109582008 TTGTTCTATTTGTAGAGCACAGG - Intronic
1013823827 6:114186933-114186955 TTGTTCCATTTATAGAGCTCAGG - Intronic
1013933285 6:115562267-115562289 TTATGGCATTTCTAGATCACTGG + Intergenic
1014319669 6:119911375-119911397 TTGTTCCATTTATAGAGCACAGG - Intergenic
1014598411 6:123375172-123375194 TTGTCACATTCCAAGAGCAATGG + Intronic
1014705101 6:124736640-124736662 TTGTTGCATTTATAGAGCACAGG - Intronic
1014741466 6:125152440-125152462 TTGTTCCATTTATAGAGCACAGG - Intronic
1015304290 6:131689429-131689451 TTGTTCCATTTACAGAGCACAGG - Intronic
1015740796 6:136451325-136451347 TTGTTCCTTTTATAGAGCACAGG - Intronic
1015901018 6:138066888-138066910 TTTTTCCATTTATAGAGCACCGG - Intergenic
1015939795 6:138436850-138436872 TTGTTCCATTTACAGAGCACAGG - Intronic
1016199252 6:141387714-141387736 TTATACCATTTATAGAGCACAGG + Intergenic
1016408143 6:143753527-143753549 ATGCGCCATTTCAAGACAACAGG - Intronic
1016946326 6:149537741-149537763 TTGTTCCATTTCTAGAGCACAGG - Intronic
1017243625 6:152197748-152197770 TTGTTCTATTTATAGAGCACAGG + Intronic
1018250508 6:161865271-161865293 TTGTTCCCTTTATAGAGCACAGG + Intronic
1018271332 6:162081598-162081620 TTGTTCCATTTATAGAGCACAGG + Intronic
1018337270 6:162806684-162806706 TTGTTCCATTTACAGAGTACAGG + Intronic
1018406091 6:163484162-163484184 TTGTTCCAATTGTAGAGCACAGG + Intronic
1019126478 6:169844010-169844032 TGGAGCCATTTCATGTGCACAGG + Intergenic
1019895815 7:3982158-3982180 CTGTTCCATTTACAGAGCACAGG - Intronic
1020626239 7:10583261-10583283 TTGTTCCATTTACAGAGCTCAGG - Intergenic
1020664619 7:11024620-11024642 TTGTTCCATTTACAGAGCACAGG - Intronic
1020754170 7:12180989-12181011 TTGTTCCATTTATAGAGCACAGG + Intergenic
1021015637 7:15527827-15527849 TTTTTCCATTTCTAGAGCACAGG - Intronic
1021204412 7:17762557-17762579 TTGTTCCATTTCTAGAGCACAGG + Intergenic
1021211238 7:17855579-17855601 TTGTTCCATTTCTGGAGCACAGG - Intronic
1021219039 7:17953163-17953185 TTGTTCCATTTCTAGAGCACAGG - Intergenic
1021282848 7:18741384-18741406 TGGTTCCATTTATAGAGCACAGG - Intronic
1021614050 7:22484378-22484400 TTGTGCCATGTCTAGAGCACAGG - Intronic
1021678190 7:23102415-23102437 TTGTTCCATTTATAGAGCACTGG - Intergenic
1021732981 7:23614887-23614909 TTGTTCCATTTATAGAGCACAGG + Intronic
1022066822 7:26866954-26866976 TTGTTCCACTTATAGAGCACAGG - Intronic
1022145056 7:27529008-27529030 CTGTTCCATTTGGAGAGCACAGG - Intronic
1022279850 7:28896515-28896537 TGGTTCCATTTATAGAGCACAGG + Intergenic
1022424836 7:30258502-30258524 TTGTTCCATTTCTAGAGCACAGG - Intergenic
1022548836 7:31216903-31216925 TTGTTCCATTTATAGAGCACAGG + Intergenic
1023026143 7:36051762-36051784 TTGTTCTATTTCTAGAACACAGG - Intergenic
1023724523 7:43128402-43128424 TTGTTCCATTTACAGAGCACAGG - Intronic
1024549385 7:50548984-50549006 TTGTTCCATTTATAAAGCACAGG - Intronic
1024932294 7:54676381-54676403 TTGTTCCATTTCTAGAGCACAGG - Intergenic
1025073371 7:55921085-55921107 TTGATCCATTTCTAGCGCACAGG - Intronic
1025089467 7:56050620-56050642 TTGTGCCATATCAAGACTAATGG - Intronic
1025195988 7:56934112-56934134 TTATTCCATTTCTAGAGCACAGG - Intergenic
1025299779 7:57809566-57809588 TTGTTCCATTTATAGAGCATGGG + Intergenic
1025675960 7:63642824-63642846 TTATTCCATTTCTAGAGCACAGG + Intergenic
1025875458 7:65476818-65476840 ATGTGCCATTTTTAGACCACTGG - Intergenic
1026256063 7:68712552-68712574 CTGTTCCATTTATAGAGCACAGG + Intergenic
1026415408 7:70174695-70174717 TTGTTTTATTTCTAGAGCACAGG - Intronic
1026489893 7:70853762-70853784 TTGTTCCATTTCTACAGCACAGG + Intergenic
1026507793 7:71000817-71000839 TTTTTCCATTTTTAGAGCACAGG - Intergenic
1026515070 7:71062113-71062135 TTATGGCATTTAAAAAGCACTGG + Intergenic
1026855607 7:73752008-73752030 TTGTTCCATTTCTAGAGCACAGG - Intergenic
1027294240 7:76750732-76750754 TTGTTTCATTTATAGAGCACAGG - Intergenic
1027596171 7:80176978-80177000 TTCTTCCATTTACAGAGCACAGG - Intronic
1027944880 7:84732093-84732115 TTGTTGCATTTTTAGAGCACAGG + Intergenic
1028137375 7:87236414-87236436 TTGTTCCATTTATAGAGCAAAGG + Intergenic
1028696029 7:93713795-93713817 TTGTTCCATTTATAGAGCACAGG - Intronic
1029049996 7:97675827-97675849 TGGTTCCATTTGTAGAGCACAGG - Intergenic
1029981188 7:104880569-104880591 TTGTTCCATTTCTAGAGCTCAGG - Intronic
1030136810 7:106259978-106260000 TTGTTCCATTTATAAAGCACAGG + Intronic
1030698376 7:112611466-112611488 TTGTTCCATTTATAGAGCACAGG - Intergenic
1031183628 7:118447895-118447917 TCCTTCCATTTCTAGAGCACAGG + Intergenic
1031307334 7:120147106-120147128 TTGTTACATTTATAGAGCACAGG + Intergenic
1031336282 7:120537357-120537379 CTGTTTCATTTCTAGAGCACAGG + Intronic
1031588540 7:123562221-123562243 TTGTTCCATTTATAGAACACAGG + Intergenic
1031670426 7:124536270-124536292 TTGTGTAATTGCAAGAGCAGTGG + Intergenic
1031715758 7:125107300-125107322 TTGTTCCATTTACAGAGCACAGG + Intergenic
1031851494 7:126869751-126869773 TTATTCCATTTATAGAGCACAGG + Intronic
1031921480 7:127604679-127604701 TTGTTCCATTTACAGAGCACAGG + Intergenic
1032814586 7:135459641-135459663 TTGTTCCATTTACAGAGCATAGG + Intronic
1033762624 7:144452183-144452205 TTGTGGCATTTAAGGAGCAGTGG - Exonic
1034022099 7:147655687-147655709 TTGTTCCATTTCTAGAGCACAGG + Intronic
1034185534 7:149173741-149173763 TTGTTCCATTTCTAGTGCACAGG + Intronic
1034210874 7:149361257-149361279 TTATTCCATTTCTAGAGTACAGG - Intergenic
1034361712 7:150505639-150505661 TTGTTCCATTTATAGAGCACAGG - Intergenic
1034404521 7:150893806-150893828 TTGTTTCATTTATAGAGCACAGG - Intergenic
1034568901 7:151939044-151939066 TTGTTCCATTTCTAGAGCACAGG - Intergenic
1034582721 7:152059775-152059797 TTGTTCCATTTCTAGAGCACAGG + Intronic
1034743374 7:153499121-153499143 TTGTTTCATTTCTAGAGCACAGG - Intergenic
1035066884 7:156112021-156112043 TTGTTCCAGTTACAGAGCACAGG + Intergenic
1035167018 7:156997222-156997244 TTGGTCCATTTACAGAGCACAGG + Intronic
1035479966 7:159174218-159174240 TTGTTCCGTTTATAGAGCACAGG + Intergenic
1036735646 8:11313030-11313052 TTGTTCCATTTATAGAGCACAGG + Intronic
1037019638 8:13953948-13953970 CTGTGTCATTTACAGAGCACAGG + Intergenic
1037089084 8:14890904-14890926 TTTTTCCATTTCTAGAGCACAGG - Intronic
1037145851 8:15571958-15571980 TTGTTCCATTTATAGAGCACAGG + Intronic
1037191817 8:16135358-16135380 TTGTCCTATTTCTAGAGCACAGG - Intronic
1037327765 8:17711066-17711088 TTGTTTCATTTATAGAGCACAGG + Intronic
1037435555 8:18859326-18859348 TAGTTCCATTCCTAGAGCACAGG + Intronic
1038025594 8:23586423-23586445 TTGTCCCATTTATAGAGCACAGG + Intergenic
1038178883 8:25207563-25207585 CTGTTCCATTTATAGAGCACAGG - Intronic
1038218769 8:25587741-25587763 GTGTGCCATTTCAACATCTCTGG + Intergenic
1038621859 8:29151596-29151618 TTGTTCCATTTACAGAGCACAGG - Intronic
1038703385 8:29872228-29872250 GTTTTCCAGTTCAAGAGCACAGG - Intergenic
1038749520 8:30282707-30282729 TTGTGCCCCGTTAAGAGCACAGG + Intergenic
1039212226 8:35230562-35230584 TTGTTCCATTTATAGAGCACAGG + Intergenic
1039268743 8:35857147-35857169 TTCTGCCATTCCATGAGCATGGG - Intergenic
1039983926 8:42431796-42431818 TTGTTCCATTTCTAGAGCACAGG - Intronic
1040036855 8:42878941-42878963 TTGTTGCATTTATAGAGCACAGG - Intronic
1040058154 8:43079424-43079446 TTGTTCCATTTATAGAGCACAGG - Intronic
1040076007 8:43231567-43231589 TTGTTCCATTTCCAGAGCAAAGG + Intergenic
1040425586 8:47282162-47282184 TTGTTACATTTATAGAGCACAGG + Intronic
1040685753 8:49870804-49870826 TTATTCCATTTCTAGAGCACAGG + Intergenic
1040737175 8:50522406-50522428 TTGTTCCATTTCTAGAGCACAGG + Intronic
1040833053 8:51699020-51699042 TTGTTCCACTTCTAGAGCACAGG + Intronic
1040841226 8:51786998-51787020 TTGTTCCATTTCTAGGGCATAGG - Intronic
1041131216 8:54703499-54703521 TTTTTCCATTTCTAGAGCACAGG + Intergenic
1041979069 8:63834538-63834560 TTGTTCCATTTCTGAAGCACAGG + Intergenic
1042287851 8:67134508-67134530 TTGTTTCCTTTCTAGAGCACAGG + Intronic
1042299502 8:67261426-67261448 TTGTTCCATTTCTAGAGTGCAGG - Intronic
1042635825 8:70873045-70873067 CTCTTCCATTTCTAGAGCACAGG - Intergenic
1042785958 8:72547082-72547104 TTGTTCCATTTCTAAAGCATAGG - Intronic
1042829507 8:73011025-73011047 TTGTTCCATTTCTAGAGCACAGG + Intronic
1042851615 8:73222478-73222500 TTGTTCCATTTCTAGAGCAGAGG + Intergenic
1042882334 8:73507520-73507542 CTCTTCCATTTCTAGAGCACAGG + Intronic
1043083775 8:75801050-75801072 TTGTTCCATTTATGGAGCACAGG + Intergenic
1043090936 8:75902949-75902971 TTGTTCCATTTCTAGAGGACAGG - Intergenic
1043420941 8:80098004-80098026 TTATTCCATTTCTAGAGCACAGG - Intronic
1043862780 8:85340302-85340324 TTGTTCCTTTTACAGAGCACAGG - Intronic
1043944706 8:86236670-86236692 TTGTTTCATTTGAAAAGCACGGG + Intronic
1043990804 8:86751753-86751775 TTGTTCCATTTGTAGATCACAGG + Intergenic
1044030830 8:87234642-87234664 TTGTTCCATTTATAGAGCACAGG + Intronic
1044414483 8:91920981-91921003 TTGATCCATTTAGAGAGCACAGG - Intergenic
1044415294 8:91932173-91932195 TTGATCCATTTAGAGAGCACAGG + Intergenic
1044449445 8:92316988-92317010 TTGTTCCATTTCTAGAACACAGG - Intergenic
1044461266 8:92447234-92447256 TTGCTCCATTTGTAGAGCACAGG - Intergenic
1044640023 8:94369584-94369606 TTGTTTCATTTCTAGAGCACAGG - Intergenic
1045073104 8:98531493-98531515 TTATTCCATTTATAGAGCACAGG + Intronic
1045399886 8:101803235-101803257 TTGTTCCATTTATGGAGCACAGG - Intronic
1045465488 8:102465725-102465747 TTCTTCCATTTATAGAGCACAGG + Intergenic
1045541770 8:103093308-103093330 TTGTTCCATTTGTGGAGCACAGG + Intergenic
1045563471 8:103289153-103289175 TTGTTCCATTTATTGAGCACAGG + Intergenic
1045907740 8:107368371-107368393 TGGTTCCATTTCTAGAGCACAGG + Intronic
1045948295 8:107822693-107822715 TTGTTCCATTTATAGAGCACAGG + Intergenic
1046182475 8:110669749-110669771 TTGTTCCATTTATAGAGCACGGG - Intergenic
1046316732 8:112512586-112512608 TTGTTCCATTTATAGATCACAGG + Intronic
1047106446 8:121735884-121735906 TTGTTCCATTTATAGAGCACAGG + Intergenic
1047147637 8:122222509-122222531 TTATTCCATTTCTAGAGCACAGG + Intergenic
1047400722 8:124544623-124544645 TTATTCCATTTCTAGGGCACAGG - Intronic
1047946897 8:129889147-129889169 TTGTACCATTTAGAGAGCACAGG - Intronic
1048077644 8:131090451-131090473 TTCTTCCATTTCTAGAGCATAGG - Intergenic
1048129246 8:131675490-131675512 TTGTGTTATTTATAGAGCACAGG + Intergenic
1048824212 8:138408026-138408048 TTGTTCCATTTCTAGAGCACAGG + Intronic
1048975432 8:139670102-139670124 TTGTACCACTTGTAGAGCACAGG + Intronic
1049145333 8:140996636-140996658 TTATTCCATTTGTAGAGCACAGG - Intronic
1049227524 8:141463979-141464001 TTGTTCCATGTCTAGAGCACAGG - Intergenic
1049314267 8:141952127-141952149 TTGTTCCATGTCTAGAGCACAGG - Intergenic
1049337705 8:142095392-142095414 TTGTGCAATGTCCAGAACACAGG - Intergenic
1050280363 9:4043994-4044016 ATGGGCCTTGTCAAGAGCACAGG + Intronic
1050298640 9:4233581-4233603 TTGTTCCATTTATAGATCACAGG + Intronic
1050380888 9:5028389-5028411 TTGTCCCATTTATAGAGCACAGG + Intronic
1050383714 9:5061127-5061149 TTGTTCCATTTATAGAGCACAGG + Intronic
1050384688 9:5075512-5075534 TTGTTCCATGTATAGAGCACAGG - Intronic
1050437190 9:5623618-5623640 CTGTTCCATTTATAGAGCACAGG + Intergenic
1050647583 9:7737905-7737927 TTGTTCCATTTATAGAGCACTGG + Intergenic
1050792608 9:9493220-9493242 TTTTTCCATTTCTAGAGCACAGG - Intronic
1050867456 9:10520778-10520800 TTGTTCCATTTATAGAACACAGG - Intronic
1051009932 9:12399153-12399175 TTTTTCCATTTACAGAGCACAGG - Intergenic
1051114621 9:13680306-13680328 TTGTTCCATTTATAGAGCACAGG + Intergenic
1051147126 9:14039165-14039187 TTGTTCCACTTATAGAGCACAGG + Intergenic
1051266353 9:15312882-15312904 TTGTTTCATTTATAGAGCACTGG - Intergenic
1051298317 9:15619930-15619952 TTGTCCCATTTATAGAGCACAGG - Intronic
1051542908 9:18240435-18240457 TTGTTCCATTTATAGAGCACAGG + Intergenic
1051601630 9:18880628-18880650 TTCTTCCATTTATAGAGCACAGG + Intronic
1051770700 9:20575766-20575788 TTGTTCCATTTATAGAGCACAGG + Intronic
1051852927 9:21529759-21529781 TTGTTCCATTGATAGAGCACAGG + Intergenic
1051944995 9:22557619-22557641 TTGTTCCATTTATAGAGCACAGG + Intergenic
1052803841 9:32994919-32994941 TTGTTCCATTTATAGAGCACAGG - Intronic
1053250442 9:36569923-36569945 TTGTTCCATTTATAGAGCATAGG - Intergenic
1053575152 9:39352214-39352236 TTGTCCCATTTATAGAGCACAGG - Intergenic
1053839655 9:42180148-42180170 TTGTCCCATTTATAGAGCACAGG - Intergenic
1054096716 9:60910897-60910919 TTGTCCCATTTATAGAGCACAGG - Intergenic
1054118117 9:61186523-61186545 TTGTCCCATTTATAGAGCACAGG - Intergenic
1054151358 9:61608380-61608402 TTGTTCCATTTATAGAGCTCGGG + Intergenic
1054589638 9:66996041-66996063 TTGTCCCATTTATAGAGCACAGG + Intergenic
1055036957 9:71827735-71827757 TTGTGCCATTACAATAGGAAGGG + Intergenic
1055375993 9:75648722-75648744 TTATGCCATTTGCAGAGGACAGG - Intergenic
1055377306 9:75663254-75663276 TTGTTCCATTTATAGAGCACAGG - Intergenic
1055557106 9:77485884-77485906 TTGTTCCATTTATAGAGCACAGG + Intronic
1055812730 9:80168753-80168775 TTGTACCATTTACAGAGCACAGG + Intergenic
1055906585 9:81301690-81301712 TTATTCCATTTATAGAGCACAGG - Intergenic
1056058395 9:82854363-82854385 TTATTCCATTTATAGAGCACAGG + Intergenic
1056093719 9:83229932-83229954 TTGTTCCATTTATAAAGCACAGG + Intergenic
1056181595 9:84089011-84089033 TTATTCCATTTATAGAGCACAGG + Intergenic
1056227280 9:84508236-84508258 TTGTTCCCTTTATAGAGCACAGG - Intergenic
1056274354 9:84978877-84978899 TTGTTCCATTTATAGAGCATGGG - Intronic
1056959544 9:91110733-91110755 TTGTTCCATTTACAGAGCACAGG + Intergenic
1057052336 9:91935359-91935381 TTGTTCCATCTCCAAAGCACAGG - Intronic
1057370487 9:94468175-94468197 TTGTTCCATTTACTGAGCACAGG + Intergenic
1057489044 9:95507865-95507887 GTGTGCCTTTTCCGGAGCACTGG - Intronic
1057504621 9:95622704-95622726 TTGTTCCATTTATAGAACACAGG - Intergenic
1057823644 9:98354229-98354251 TTGTTCCATTTATAGAGCACAGG + Intronic
1057887498 9:98841357-98841379 TTGTGTCATATCAGGAGCATAGG + Intronic
1057984558 9:99698659-99698681 TTGTTCCATTTATAGAGCACAGG - Intergenic
1058348722 9:103996091-103996113 TTGTTCCATTTATAGAGCACAGG + Intergenic
1058543015 9:106031452-106031474 TTGCACCATTACAAGAGCCCTGG - Intergenic
1058570629 9:106339038-106339060 TGGTGCTATTTCAAGAACAATGG - Intergenic
1059290030 9:113214537-113214559 TTGTTCCATTTGCAGAGCACAGG + Intronic
1059558955 9:115312616-115312638 TTCTTCCATTTATAGAGCACAGG - Intronic
1060460500 9:123849334-123849356 TTGTTCCATTTATAGAGCACAGG - Intronic
1060565333 9:124585865-124585887 TTGTTCCATTTATAGAACACAGG - Intronic
1061784503 9:133018467-133018489 TTCTTCCATTTCTAGAGCATGGG - Intergenic
1186255950 X:7719861-7719883 TTGTTCCATTTCTAGAGCACAGG + Intergenic
1186304023 X:8234515-8234537 TTCTTCCATTTACAGAGCACAGG + Intergenic
1186395369 X:9203040-9203062 TTGTTCGATTTCTAGAGCACAGG - Intergenic
1186493212 X:9991750-9991772 TTGTTCCATTTCTAGAGCACAGG - Intergenic
1187255749 X:17640388-17640410 TTCTGCCATTTCAGGAGCCGGGG - Intronic
1187269116 X:17763822-17763844 TTGTTCAATTTCGAGAACACAGG + Intergenic
1187320412 X:18232835-18232857 TTGTTCAATTTCAAGAACACAGG - Intergenic
1187516693 X:19977917-19977939 TTGTCCCATTTATGGAGCACAGG - Intergenic
1188448281 X:30280819-30280841 TTCTTCCATTTATAGAGCACAGG - Intergenic
1188469274 X:30518868-30518890 TTGTCCCACTTGCAGAGCACAGG - Intergenic
1188563913 X:31503289-31503311 TTGTACGATTGCAAGAGAACTGG + Intronic
1188732700 X:33671016-33671038 TTGTTCCATTTATAGAGCACAGG - Intergenic
1188822067 X:34787636-34787658 TTTTTCCATTTAGAGAGCACAGG + Intergenic
1189059999 X:37743083-37743105 TTGTTTCATTTCTGGAGCACAGG + Intronic
1189060085 X:37744293-37744315 GTGCTTCATTTCAAGAGCACAGG + Intronic
1189072506 X:37878812-37878834 TTGTTCCATTTATAGAGCACAGG - Intronic
1189788080 X:44577870-44577892 TTGTTCCATTTATAGAGCACAGG - Intergenic
1189923163 X:45923548-45923570 TTGTTCCATTTATAGAACACAGG - Intergenic
1189964915 X:46362493-46362515 TTGTTCCATTTGTAGAGCACAGG + Intergenic
1190482154 X:50888353-50888375 GTGTTCCATTTACAGAGCACAGG + Intergenic
1190814220 X:53914761-53914783 TTTTTCCATTTATAGAGCACAGG - Intergenic
1191016733 X:55817111-55817133 TTCTTCCAATTCAAGAGCATGGG + Intergenic
1191728921 X:64312969-64312991 TTGTTCTATTTATAGAGCACAGG + Intronic
1191957717 X:66664053-66664075 TTGTTCAATTTGTAGAGCACAGG + Intergenic
1192091632 X:68164587-68164609 CTGTTCCATTTATAGAGCACAGG + Intronic
1192301809 X:69912714-69912736 TTGTTCCATTTCTAGAGCTGAGG + Intronic
1192388688 X:70701376-70701398 TTGTTCCATTTATAGAGCACAGG - Intronic
1193291857 X:79782880-79782902 TTGTGCAATAGCAAAAGCACTGG + Intergenic
1193833469 X:86315207-86315229 TTGTGCCATTTGCATAGCACAGG - Intronic
1193835727 X:86341343-86341365 TTGTGCCATTTGTAGAGCACAGG - Intronic
1193906077 X:87245798-87245820 TTGTTCCTTTTACAGAGCACAGG - Intergenic
1193966333 X:87991566-87991588 TTGTTCCATTTATAGAGCATAGG + Intergenic
1194062819 X:89225686-89225708 TTGTTCCATGTATAGAGCACAGG + Intergenic
1194167820 X:90542159-90542181 TTGTCCCATTTACAGAGCACAGG + Intergenic
1194286406 X:92016201-92016223 TTGTTCCATGTGTAGAGCACAGG + Intronic
1194364773 X:93001525-93001547 TTGTTCCATTTATAGAGCAGAGG - Intergenic
1194759867 X:97783340-97783362 TGGTTTCATTTCAAGAGCACAGG - Intergenic
1194846435 X:98815055-98815077 TTGCTCCATTTTCAGAGCACAGG + Intergenic
1195338803 X:103884304-103884326 TTGTTTCATTTCTAGAGCACAGG - Intergenic
1195593255 X:106656828-106656850 TTGTTCCATTTCTAGAGCACAGG + Intronic
1195690791 X:107623204-107623226 TTGTTCCATTTATAGAGCACAGG + Intergenic
1195792563 X:108604522-108604544 TTGTTCCACTTATAGAGCACAGG + Intronic
1195819022 X:108922611-108922633 TTGTTCCATGTATAGAGCACAGG - Intergenic
1196260294 X:113571394-113571416 TTGCTCCATTTATAGAGCACAGG + Intergenic
1196504833 X:116429303-116429325 TTGTTCCATTTATAGAACACAGG - Intergenic
1196692767 X:118578061-118578083 TTGTTGCAGTTCAAGAGCTCTGG - Intronic
1196971552 X:121114999-121115021 TTGTTTCATTTACAGAGCACAGG + Intergenic
1197114117 X:122811868-122811890 TTGTTCCATTTACAGAACACAGG - Intergenic
1197344234 X:125312978-125313000 TTGTTCCATTTATAGAGCATAGG - Intergenic
1197358522 X:125467782-125467804 TTGTTCCACTTATAGAGCACAGG + Intergenic
1197423167 X:126263536-126263558 TTGTTTCATTTATAGAGCACAGG + Intergenic
1197830953 X:130641768-130641790 TTGTTCCGTTTCTAAAGCACAGG - Intronic
1197882653 X:131183734-131183756 TTGTCCTATTTTAAGATCACTGG + Intergenic
1197987492 X:132281993-132282015 TTGTTTCATTTATAGAGCACAGG - Intergenic
1198281092 X:135143530-135143552 TTGTTCCATTTATAGAGCATGGG + Intergenic
1198289866 X:135228986-135229008 TTGTTCCATTTATAGAGCATGGG - Intergenic
1198304892 X:135370729-135370751 TTATTCCATTTATAGAGCACAGG - Intergenic
1198323075 X:135538968-135538990 TTGTTCCATTGCTAAAGCACAGG + Intronic
1198690307 X:139275936-139275958 TTGTTCCATTTATAGAACACAGG + Intergenic
1198801002 X:140447615-140447637 GTCTGTCATTTCCAGAGCACTGG - Intergenic
1198826529 X:140704079-140704101 TTTTTCCATTTACAGAGCACAGG + Intergenic
1198970609 X:142274784-142274806 GTGTTCCATTTCTAGAGCACAGG + Intergenic
1199090581 X:143687282-143687304 TTGTTCCATGTAGAGAGCACAGG + Intergenic
1199311608 X:146327490-146327512 TTGTGATATTTCAACAGCACTGG + Intergenic
1199321786 X:146448060-146448082 TTGTGGCATTTCAAGAGTAATGG - Intergenic
1199343921 X:146715723-146715745 CTGTTCCATTTATAGAGCACAGG - Intergenic
1199503627 X:148537128-148537150 TGGTGCCATTTAAATAGCAAAGG + Intronic
1200013856 X:153143477-153143499 TTGTTTCATTTCTAGAGCACAGG - Intergenic
1200020316 X:153198666-153198688 TTCTTTCATTTCTAGAGCACAGG - Intergenic
1200025744 X:153256478-153256500 TTGTTTCATTTCTAGAGCACAGG + Intergenic
1200371740 X:155733513-155733535 ATGTTCCATTTCTAGAGCATAGG + Intergenic
1200389150 X:155926062-155926084 TTGTTCCATTTCAAGAGCACAGG + Intronic
1200514075 Y:4119949-4119971 TTGTCCCATTTACAGAGCACAGG + Intergenic
1202042229 Y:20697650-20697672 TGGTGCCATGTCCACAGCACAGG - Intergenic