ID: 961615904

View in Genome Browser
Species Human (GRCh38)
Location 3:128180874-128180896
Sequence GGGGGCTAATGAAGTCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 208}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961615904 Original CRISPR GGGGGCTAATGAAGTCCTGA AGG Intronic
900076066 1:818789-818811 GGAGGCGAATGGAGTCCGGAGGG - Intergenic
900417131 1:2540410-2540432 GGGGGCTCCTGTAGCCCTGAGGG + Intergenic
902329853 1:15725953-15725975 GGGGGGTGATGAGGTCCTGAGGG - Intronic
902688123 1:18092168-18092190 GGAGGCTACTGAAATCCTGCAGG - Intergenic
904633531 1:31861471-31861493 GGGAGGTGATGAAGTCATGAGGG + Intergenic
907289927 1:53407188-53407210 GGAGGCTAGGGGAGTCCTGAGGG + Intergenic
907870469 1:58438324-58438346 TGGGCCTAATCAAGTCTTGAGGG + Intronic
911431977 1:97801110-97801132 GGTGGGTAATGAGGTCATGATGG + Intronic
912664570 1:111567596-111567618 GAGGTTAAATGAAGTCCTGAGGG + Intronic
913967684 1:143390831-143390853 GGGAGGTAATGAGGTCATGATGG + Intergenic
914062062 1:144216421-144216443 GGGAGGTAATGAGGTCATGATGG + Intergenic
914117088 1:144749933-144749955 GGGAGGTAATGAGGTCATGATGG - Intergenic
915918151 1:159953579-159953601 GGAGGCTGATGGACTCCTGAAGG + Exonic
916373791 1:164129310-164129332 GGGAGATAATGAGGTCATGAGGG - Intergenic
917033625 1:170722155-170722177 GGGGAAGAATGAAGTCATGAAGG - Intronic
917289295 1:173455639-173455661 AGGGGCTAAGGGAGTGCTGAAGG - Intergenic
917753476 1:178075950-178075972 GGGAGCTAATTAGGTCATGAGGG + Intergenic
918478977 1:184956830-184956852 GGGGGCTAATGAAGGGCAGTGGG - Intronic
918626784 1:186664644-186664666 GGGAGGTGATGAAGTCATGAGGG - Intergenic
918753353 1:188302820-188302842 AGGGGCCAATGAAGTTCTAAAGG + Intergenic
919909015 1:202098667-202098689 GAGTGCTTATGAAGTCATGATGG - Intergenic
922672266 1:227519611-227519633 GGGGGGTAATTAGGTCCTGAAGG + Intergenic
922916614 1:229263262-229263284 GGGGGCAAATGAAGTGCTGGGGG + Intergenic
923315918 1:232779948-232779970 GGGAGATGATGAAGTCATGAGGG - Intergenic
923407908 1:233680927-233680949 GGGGGCTTTTGAAGACTTGACGG + Intergenic
923853077 1:237818184-237818206 GGTGGCAAATGAAGTCATGCTGG - Intronic
924434902 1:244030624-244030646 GAGGGCTGAAGAATTCCTGATGG + Intergenic
1064939588 10:20718607-20718629 GGGAGATAATGAGGTCATGAGGG - Intergenic
1066422329 10:35274686-35274708 GGGAGCTAACGAAGTCCCGAGGG + Intronic
1066748350 10:38626123-38626145 GAGGGCAAAGGAACTCCTGAGGG - Intergenic
1066968328 10:42291652-42291674 GAGGGCAAAGGAACTCCTGAGGG + Intergenic
1071815380 10:89227140-89227162 GGGGGCTTCTGCAGTCCTGCTGG - Intronic
1072475776 10:95758492-95758514 GGGGGCTAATCTAGACTTGAAGG - Intronic
1073140984 10:101247572-101247594 TGGGGTTACTGAAGACCTGAAGG - Intergenic
1074590856 10:114811669-114811691 GGGGGCTGATAAAGTCTAGAAGG + Intergenic
1074600420 10:114908198-114908220 GGGGGATAATTAGGTCATGAGGG - Intergenic
1076448776 10:130540402-130540424 GGGGGGTCATTAAGTCATGAGGG - Intergenic
1079427958 11:20362025-20362047 AGGGGCTCATGAAGTGCTTAGGG + Intergenic
1080308826 11:30866479-30866501 AGGGGCTAATTAAGTCATGAGGG - Intronic
1084721004 11:70905567-70905589 GGGAGGTAATGAGGTCATGAGGG + Intronic
1085470981 11:76757741-76757763 GGGAGCTGAGAAAGTCCTGAGGG + Intergenic
1086307201 11:85494112-85494134 GGGAGGTAATTAAGTCATGAAGG - Intronic
1088713423 11:112528106-112528128 GGGAGGTAATCAAGTCATGAGGG + Intergenic
1089830367 11:121321976-121321998 GGGGGATATTTAAGTACTGAGGG + Intergenic
1090575151 11:128094381-128094403 TGGGGCTAAGCAGGTCCTGAAGG + Intergenic
1092529471 12:9332515-9332537 GGGAGGTAATGAGGTCCTGAGGG + Intergenic
1094812345 12:34150825-34150847 GGGAGGTAATTAGGTCCTGAAGG - Intergenic
1096526134 12:52211439-52211461 GGGGGCTACGGGAGCCCTGAGGG + Intergenic
1097446217 12:59675300-59675322 GGGAGGTAATTAAGTCGTGATGG + Intronic
1097955399 12:65480369-65480391 GGGGGGTGATTAAGTCATGAGGG - Intronic
1098156026 12:67599615-67599637 AGGGGATAATTAAGTCATGATGG - Intergenic
1105292143 13:19059971-19059993 GGGAGGTAATGAGGTCCTGAAGG + Intergenic
1106220481 13:27742604-27742626 TGGGGCTAATGAAGGCCTGATGG - Intergenic
1107856295 13:44618451-44618473 GAGGGGTAATGAAGTCCTTGAGG - Intergenic
1109433486 13:62267748-62267770 GGGAGGTAATTAGGTCCTGAGGG + Intergenic
1110398700 13:75064692-75064714 GGGAGGTGATGAAGTCATGAGGG - Intergenic
1110404810 13:75138279-75138301 GGAGGCTAATTAAGTCATGTTGG - Intergenic
1112078390 13:95937948-95937970 GGGAGGTAATGAAATCATGAGGG + Intronic
1112243103 13:97701850-97701872 GGGGGCTAAAGTAATCCTAATGG - Intergenic
1114358853 14:21947169-21947191 GGGGGCAAGTAAAGGCCTGATGG + Intergenic
1114593348 14:23890432-23890454 GGGAGATAATTAAGTCATGAAGG + Intergenic
1114670175 14:24406771-24406793 GGGGGCATATGAAGTCCACATGG + Intronic
1115373881 14:32651695-32651717 GGGAGGTAATTAAGTCATGAGGG - Intronic
1118161801 14:63298408-63298430 TGTTGCTGATGAAGTCCTGAAGG + Intergenic
1118315690 14:64724673-64724695 GGGGACATATGAAGACCTGAAGG - Intronic
1122281505 14:100625486-100625508 AGGGTCAAATGAAGTCATGAAGG - Intergenic
1123955983 15:25335217-25335239 GGGGGTTGATGAAGTCTTCATGG + Intronic
1127686742 15:61353215-61353237 GGGAGCTAACTAAGTCATGAGGG + Intergenic
1128432287 15:67608538-67608560 GGGGGCTGAGGAAGAACTGATGG + Intronic
1128946469 15:71826229-71826251 GGGGGATATTGCTGTCCTGAGGG - Exonic
1130318319 15:82816133-82816155 GGGGGGTAATTAGGTCATGAGGG - Intronic
1132032231 15:98447445-98447467 AGGGCCTAATGGAGTCCTCATGG - Intronic
1132536362 16:483107-483129 GGGGGCTACAGAAATCCTGAGGG - Intronic
1133109841 16:3541493-3541515 GGGGACACATGAAGTCCTCAGGG + Intronic
1136068380 16:27773806-27773828 GGGGGCTAAGGTAGACCAGAAGG - Intronic
1136277590 16:29187945-29187967 GGGGCCTAATTAAGGCCTCAAGG + Intergenic
1136734410 16:32451178-32451200 GAGGGCAAAGGAACTCCTGAGGG + Intergenic
1137804099 16:51287437-51287459 GGGGGCTGAGGAAGTCGGGAGGG + Intergenic
1138018721 16:53456846-53456868 AGGGGGAAAAGAAGTCCTGAGGG - Intronic
1141222959 16:82089024-82089046 GGAAGGTAATTAAGTCCTGAGGG - Intronic
1141493059 16:84387953-84387975 GGGGGCTTGTGGAGCCCTGATGG + Intronic
1203018670 16_KI270728v1_random:378424-378446 GAGGGCAAAGGAACTCCTGAGGG - Intergenic
1203037005 16_KI270728v1_random:651582-651604 GAGGGCAAAGGAACTCCTGAGGG - Intergenic
1143220176 17:5255054-5255076 GGGGCCTCTTGCAGTCCTGAAGG - Intergenic
1145304707 17:21667117-21667139 GGGAGCCAAGGAAATCCTGATGG - Intergenic
1146256501 17:31393905-31393927 TGGGGCTAATATAGTCCTGGTGG - Intronic
1146655364 17:34631745-34631767 GTGGGCTGATGATGCCCTGAAGG - Intronic
1147759141 17:42786364-42786386 GCTGGCTTAGGAAGTCCTGAAGG + Intronic
1150369032 17:64619768-64619790 GGGAGGTAATGAGGTCATGAGGG - Intronic
1152100195 17:78296930-78296952 GGGGGCTGGTTAAGTCATGAGGG + Intergenic
1153969084 18:10208379-10208401 GGGAGCTAATCTAGTTCTGAAGG + Intergenic
1158475187 18:57773663-57773685 GGGGGATAATGGAGTTATGAGGG - Intronic
1160669350 19:349722-349744 GGGTGCTAATCTACTCCTGAGGG + Intergenic
1163889574 19:19998990-19999012 GGGGCATCATTAAGTCCTGAAGG + Intronic
1202701471 1_KI270712v1_random:168299-168321 GGGAGGTAATGAGGTCATGATGG + Intergenic
929854527 2:45625444-45625466 CGGGTCTAATGAGGACCTGATGG + Intergenic
930068586 2:47347109-47347131 GAGTGCTGATGAAGTTCTGATGG - Intronic
931995751 2:67837730-67837752 GGGAGATAATTAGGTCCTGAGGG - Intergenic
934172387 2:89551746-89551768 GGGAGGTAATGAGGTCATGACGG + Intergenic
934282700 2:91626098-91626120 GGGAGGTAATGAGGTCATGACGG + Intergenic
934311323 2:91868271-91868293 GAGGGCAAAGGAACTCCTGAGGG - Intergenic
935607396 2:104984632-104984654 GGGAGGTAATTAAGTCATGAGGG + Intergenic
936458650 2:112694528-112694550 GGGGTCTACTGAAGGCCTCACGG - Intergenic
937451349 2:122004356-122004378 TGGTGCTAATGAACTCCTTATGG + Intergenic
940015772 2:149102517-149102539 GGGGGATTTTGAATTCCTGAGGG + Intronic
940459540 2:153946674-153946696 GGGGGGTGATTAAGTCATGAAGG - Intronic
941597560 2:167496725-167496747 GGGAGGTAATGAAGTCATGAAGG + Intergenic
941876304 2:170437155-170437177 GGGGGCCAATGAAGTTTTGCAGG - Intronic
943266738 2:185740812-185740834 GGGGGATAATTAAGTCATGAGGG - Intronic
944299240 2:198103858-198103880 GGGGGCAAAAGAAGGCTTGAAGG + Exonic
945959837 2:216121597-216121619 AGGAGGTAATGAAGTCCTGAGGG - Intronic
948027441 2:234789357-234789379 GGGGGCAGATGGAGTCCAGAGGG - Intergenic
948332124 2:237177930-237177952 GGGGGTTAATTAGGTCATGAGGG + Intergenic
1168948537 20:1780981-1781003 GGGGTCTAGTGAAGTGTTGATGG - Intergenic
1169206265 20:3741991-3742013 TGGGGCTAAGGCAGTCCAGAGGG + Intronic
1171203365 20:23259445-23259467 GGGGGGTGATGAGGTCATGAGGG - Intergenic
1173906595 20:46634237-46634259 GGGGGCTAATTCAGTCTTGAGGG + Intronic
1175573820 20:60045010-60045032 GGGGGGTCCTGAAATCCTGAGGG + Intergenic
1176656025 21:9589554-9589576 GGGAGCCAAGGAAATCCTGATGG - Intergenic
1177535293 21:22419459-22419481 GGGAGCTGATTAGGTCCTGAGGG + Intergenic
1179456525 21:41504705-41504727 GGGGGCTTATGATGTCCCCATGG - Intronic
1180538082 22:16414179-16414201 GAGGGCAAAGGAACTCCTGAGGG - Intergenic
1181032269 22:20154369-20154391 GGGGGCTAAGGAAGGCCTCTTGG + Intergenic
1181511196 22:23389359-23389381 GGGGGCTAAGGAAGGCCTCTTGG - Intergenic
1182719050 22:32383158-32383180 GGGAGGTAATGAGGTCCTGAGGG + Intergenic
1184242822 22:43220408-43220430 GGGGGCTTCTGCAGGCCTGAAGG - Intronic
1184966041 22:47972977-47972999 AGGGGGTGATTAAGTCCTGAGGG - Intergenic
950033831 3:9869961-9869983 GGCAGCCAATGAAGTCCTGTGGG + Exonic
950055825 3:10023639-10023661 GGCAGCCAATGAAGTCCTGTGGG + Intergenic
950157255 3:10730971-10730993 GGGGGGTAATTAGGTCATGAGGG - Intergenic
953468394 3:43145740-43145762 GGGAGCTAATTAATTCCTTAGGG - Intergenic
957191786 3:77019370-77019392 GGGGGATGATGATGTCCTGCGGG - Intronic
957196349 3:77073148-77073170 GGGGGCTAATAAATTGCTCAAGG + Intronic
961615904 3:128180874-128180896 GGGGGCTAATGAAGTCCTGAAGG + Intronic
961717697 3:128869952-128869974 GGCAGCTGATGAAGTCCTGTGGG - Intergenic
962918813 3:139933624-139933646 GTGGGCTAAAGGAGACCTGAAGG + Intergenic
963512727 3:146269001-146269023 GGGAGGTAATTAAGTCATGAGGG + Intergenic
967446594 3:189574159-189574181 AGGGGCTCCTGAAGTCTTGATGG + Intergenic
969027356 4:4184110-4184132 GGGAGGTAATGAGGTCATGATGG - Intergenic
969256695 4:6007320-6007342 GGGAGGTAATTAGGTCCTGAGGG + Intergenic
972297932 4:37757887-37757909 GGGAGCTTCTGAATTCCTGATGG - Intergenic
972382013 4:38527774-38527796 GGGGGGTGATTAAGTCATGAGGG + Intergenic
974304608 4:60117595-60117617 GGGAGGTGATGAGGTCCTGAGGG - Intergenic
974651957 4:64765503-64765525 GGGAGGTAATGAAGTCATGGTGG + Intergenic
976305180 4:83552831-83552853 GGGAGGTAATTAAGTCATGAAGG + Intronic
977605680 4:98983031-98983053 GGGAGGTAATTAAGTCATGAAGG - Intergenic
977944483 4:102896206-102896228 GAGGGCAAAGGAACTCCTGAGGG - Intronic
978869262 4:113555847-113555869 GGGAGGTAATGAGGTCATGAGGG + Intronic
979090854 4:116480439-116480461 GGTGGCTAAGGAAGTCCTCAGGG - Intergenic
981916694 4:150041548-150041570 GGGAGGTAATTAAGTCATGAAGG - Intergenic
985929756 5:3047545-3047567 GGGGGCTGAGTAAGCCCTGAAGG + Intergenic
986278697 5:6304834-6304856 GGGAGCTGATGAGGTCATGAAGG - Intergenic
986662548 5:10072396-10072418 GGGAGGTGATGAGGTCCTGAGGG - Intergenic
987175375 5:15302580-15302602 GGGAGGTAATTAGGTCCTGAGGG + Intergenic
988041233 5:25891194-25891216 GAGGGCAAAGAAAGTCCTGAAGG + Intergenic
989196781 5:38724122-38724144 GGGAGCTAATGAAGTCATGAGGG - Intergenic
990131981 5:52597157-52597179 TGGGGGTACTGAAGACCTGAAGG - Intergenic
991997463 5:72402219-72402241 GGGTGGTAATGAACTCTTGAAGG - Intergenic
992105061 5:73443721-73443743 CGGGGGTAATGAAGCCCTTATGG - Intergenic
992519823 5:77539141-77539163 GGGAGGTAATGAGGTCATGAGGG - Intronic
994112730 5:96025392-96025414 GGGGGATAATTAGGTCATGAAGG - Intergenic
995158420 5:108944331-108944353 GGGGACTAATGAAGGGGTGAAGG - Intronic
996915779 5:128710912-128710934 GAGGGCTAAGGAAATCATGAAGG - Intronic
998670593 5:144348939-144348961 GGGGGCTAAAGAAATCCTGTGGG + Intronic
998896161 5:146802354-146802376 GGTGGCAAATGAATACCTGAGGG + Intronic
999005034 5:147966563-147966585 GGAGGCTAATACAGTACTGAAGG + Intergenic
999236965 5:150104280-150104302 GGAGGCTACAGTAGTCCTGAGGG + Intronic
999945895 5:156595203-156595225 GAGGGGTAATTAAGTCATGAGGG + Intronic
1000515826 5:162235710-162235732 GGGGGTTAAAGAAGTTCTAAGGG + Intergenic
1001021769 5:168189153-168189175 GGGAGGTAATTAAGTCATGAAGG - Intronic
1001699176 5:173694375-173694397 GGGTGCTAATGAAGTCAGGCGGG - Intergenic
1001776064 5:174329953-174329975 GGGAGCTAATGAAAACCAGATGG - Intergenic
1002436875 5:179236904-179236926 GGGGGGTAATTAGGTCATGAGGG + Intronic
1003493631 6:6644940-6644962 GGGGGCTCATGAAGTTCTTGAGG - Intronic
1004288908 6:14348801-14348823 GCTGACTAATGAAGTCGTGAAGG - Intergenic
1006638007 6:35474223-35474245 GTGGGCTAATGAGGTGCTAATGG + Exonic
1007135530 6:39517597-39517619 TGGGGATAATGAGGTCCTGTGGG + Intronic
1007311790 6:40952502-40952524 GGGAGGTAATTAGGTCCTGAGGG + Intergenic
1007342080 6:41197561-41197583 GGGAGCTACTGAAGTACTGGGGG - Intronic
1013260541 6:108437107-108437129 GGGAGGTGATTAAGTCCTGAGGG - Intronic
1016426939 6:143945038-143945060 GGGAGCTAGTGAAGTCTGGAAGG - Intronic
1019176346 6:170161138-170161160 GGGGGCTAATGAAGACCCCCCGG - Intergenic
1020073083 7:5240285-5240307 GGCGGCTCCTGAGGTCCTGATGG - Intergenic
1021153312 7:17178604-17178626 GAGGGCTAATCAATTCCTAAAGG + Intergenic
1023539594 7:41251304-41251326 GGGGGCTGATTAGGTCATGAGGG - Intergenic
1025282711 7:57639732-57639754 GGGAGCCAAGGAAATCCTGATGG - Intergenic
1025302006 7:57825685-57825707 GGGAGCCAAGGAAATCCTGATGG + Intergenic
1027521977 7:79220645-79220667 GGGGGCTAAATAAGTCCTGGTGG + Intronic
1030543801 7:110867324-110867346 GCGGGGTAATGAGGTCATGAGGG - Intronic
1031070249 7:117154152-117154174 GGGAGCTAATTAGGTCATGAGGG + Intronic
1033992426 7:147305049-147305071 GGGGGCTAATTAGGTCATGAGGG - Intronic
1033998029 7:147376339-147376361 GGGTGCTACTGAAGCACTGAGGG + Intronic
1035085573 7:156254705-156254727 GGGAGATGATGAAGTCATGAGGG + Intergenic
1035529266 8:338045-338067 GGGAGGTGATGAGGTCCTGAAGG + Intergenic
1035595431 8:853906-853928 GGGAGGTCATGAAGTCATGAGGG + Intergenic
1035879676 8:3231771-3231793 AGGTACTAATTAAGTCCTGATGG - Intronic
1037778337 8:21850170-21850192 GGGGGGTGATGAGGTCATGAGGG + Intergenic
1038181462 8:25232683-25232705 GGGAGGTAATTAAGTCATGAGGG - Intronic
1042935215 8:74051627-74051649 GGGAGGTAATGAAGTCGTGAGGG + Intergenic
1043305120 8:78784150-78784172 GGGAGGTAATTAAGTCATGAAGG + Intronic
1044885607 8:96773918-96773940 GGGAGATAATTAAGTCATGAGGG - Intronic
1045468863 8:102493409-102493431 GGGGGATAATTAGGTCGTGAGGG + Intergenic
1046231763 8:111367297-111367319 GGGAGGTAAATAAGTCCTGAAGG - Intergenic
1046419763 8:113964914-113964936 GGGAGGTAATTAAGTCATGAGGG + Intergenic
1046474650 8:114726206-114726228 GGGGGCTAATCACCTCCTAAGGG + Intergenic
1048512139 8:135072454-135072476 AGGGGCTAAGGAAATCATGAAGG + Intergenic
1050153323 9:2639343-2639365 GGGAGGTAATTAAGTCATGAGGG - Intronic
1050456468 9:5839615-5839637 GGGGGCTCAGGAAGTGCTGGGGG - Intergenic
1050778575 9:9300562-9300584 GGGAGGTAATTAAGTCATGAAGG + Intronic
1051371128 9:16360150-16360172 GAGGGATAATTAAGTCATGAGGG - Intergenic
1052284878 9:26773889-26773911 GGGGGCCAATGAAGCCTTGGTGG + Intergenic
1054733670 9:68728414-68728436 GGGGAATAATGAGGTCATGAGGG - Intronic
1055728693 9:79258653-79258675 GGGGGGTGATTAAGTCATGAGGG + Intergenic
1058022725 9:100106474-100106496 GTGCGCTAATGCAGTCGTGAGGG - Intronic
1058169981 9:101669154-101669176 GGGGAGTACTGCAGTCCTGATGG - Intronic
1058222090 9:102314789-102314811 GGGAGCTAATTTAGTCATGAGGG + Intergenic
1058244988 9:102611986-102612008 TCGGGCTGATGAAGTCCTTATGG - Intergenic
1203633742 Un_KI270750v1:93014-93036 GGGAGCCAAGGAAATCCTGATGG - Intergenic
1185828574 X:3276547-3276569 GGGAGGTAATGAGGTCATGAGGG + Intronic
1186034698 X:5409306-5409328 GGGGGGTAATGACGTCATGAGGG + Intergenic
1186228970 X:7432017-7432039 GGGAGGTAATGAGGTCATGAGGG + Intergenic
1186275004 X:7928879-7928901 GGGAGGTAATTAAGTCATGAGGG + Intergenic
1187521440 X:20018284-20018306 GGGCACTTCTGAAGTCCTGATGG - Intronic
1189154553 X:38744015-38744037 GGGAGGTAATGAGGTCATGAAGG - Intergenic
1189804649 X:44723128-44723150 TGGGTCTGATGGAGTCCTGATGG + Intergenic
1191728145 X:64302908-64302930 GAGGGCTAAGGAACTCATGAAGG - Intronic
1193600156 X:83501402-83501424 AGGGGGCAATGAAGTCCTGAAGG + Intergenic
1196314557 X:114208236-114208258 GGGGGGTAATGAGGTCATGAAGG - Intergenic
1196500861 X:116380199-116380221 TGGGGCTAATGAATCCCTGGAGG - Intergenic
1197966128 X:132063953-132063975 GGGACCTAATTAAGTCATGAAGG + Intergenic
1199486501 X:148354047-148354069 GGGGCCTACTGAAGTACGGAGGG + Intergenic
1200491581 Y:3830421-3830443 GGGAGCTAATTAGGTCATGAGGG - Intergenic