ID: 961615904

View in Genome Browser
Species Human (GRCh38)
Location 3:128180874-128180896
Sequence GGGGGCTAATGAAGTCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 208}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961615904 Original CRISPR GGGGGCTAATGAAGTCCTGA AGG Intronic