ID: 961616619

View in Genome Browser
Species Human (GRCh38)
Location 3:128187881-128187903
Sequence CAGGGAGCCTAGAAGTATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 189}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961616614_961616619 23 Left 961616614 3:128187835-128187857 CCTGGTAGCAATGAGAGATTCAG 0: 1
1: 0
2: 1
3: 12
4: 126
Right 961616619 3:128187881-128187903 CAGGGAGCCTAGAAGTATGAAGG 0: 1
1: 0
2: 0
3: 10
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961616619 Original CRISPR CAGGGAGCCTAGAAGTATGA AGG Intronic
901059919 1:6467257-6467279 CAGTGAGGGTAGAAGTAGGATGG + Exonic
901946879 1:12711337-12711359 CAGGGAGCCAAAAACTATAAAGG - Intergenic
904904313 1:33883640-33883662 CATGGAGCCAAGAAGTTAGAAGG + Intronic
905709153 1:40086209-40086231 CAGGGAGTGTAGAGGTAGGAGGG + Intronic
906771662 1:48490436-48490458 CAGGGGCCCTGGCAGTATGAGGG + Intergenic
907562486 1:55403528-55403550 CAGGGAGCCAAGAACAGTGAGGG - Intergenic
908808892 1:67958953-67958975 AAGGGACCCTAAAAGCATGAGGG + Intergenic
911708771 1:101044849-101044871 CAGGGAGGGAAGAAGTATGGAGG - Intergenic
916560588 1:165931280-165931302 CACAGAGCCCAGAAGTAGGAAGG - Intergenic
917880492 1:179330661-179330683 CTGTGAGGCTAGAAGCATGATGG + Intronic
919007066 1:191911138-191911160 CAGGAAACTTAGAAGTATGGTGG + Intergenic
919818285 1:201455861-201455883 CAGGGTGCCTGGAAGGATGTGGG - Intergenic
921487547 1:215733115-215733137 CAGGAAGCTTACAACTATGATGG + Intronic
1063725764 10:8635761-8635783 CAGGCAGCCCAGATTTATGAAGG - Intergenic
1065992858 10:31030179-31030201 CAGGGACACTTGAAGTGTGAGGG - Intronic
1066717075 10:38297948-38297970 CATGGAGCCTAGACGAAGGACGG - Intergenic
1067264735 10:44730311-44730333 CATGGAGGCTAGAAATTTGAGGG - Intergenic
1067757626 10:49016857-49016879 CAGGAAGCCGGGAGGTATGAAGG - Exonic
1067761969 10:49055191-49055213 CAGGGGGCCTGGAAGGATGTTGG - Intronic
1072550658 10:96474778-96474800 CCTGGAGGCTAGAAGTCTGAAGG + Intronic
1072713768 10:97735916-97735938 CAGGTAGCCCAGAAATATGGAGG + Intergenic
1073081253 10:100862349-100862371 CAGGGAGTCTGGAAACATGATGG - Intergenic
1075313135 10:121431259-121431281 GAGGGAGGCTACAAATATGATGG - Intergenic
1075339790 10:121637395-121637417 CAGGCAGCCTGCAAGTCTGAAGG + Intergenic
1079347744 11:19667960-19667982 AAGGGACCTTAGAAGTATAAGGG - Intronic
1083304591 11:61755824-61755846 CAGGGAGCCTTGGAGGATGGAGG + Intronic
1085762003 11:79249375-79249397 AAGGTAGACTAGAAGCATGATGG - Intronic
1086766542 11:90702773-90702795 CACTGAGCCTAGAATTATGGAGG + Intergenic
1087723324 11:101691500-101691522 GAAGGAGACTAGAAGTAAGAGGG + Intronic
1091068478 11:132540957-132540979 CAGGGAGCCTACAAGTCGGGGGG - Intronic
1091250015 11:134136108-134136130 CAGAGAGCTTAAGAGTATGATGG + Intronic
1091820975 12:3475006-3475028 CAGGGAGCCTCACAGTGTGAGGG - Intronic
1094432827 12:30388739-30388761 CAGGAAGCTTACAATTATGATGG + Intergenic
1094763041 12:33557227-33557249 CTTGGAGGCTAGAAGTAAGATGG - Intergenic
1095883324 12:47162582-47162604 CAGGAAGCCTAAAATCATGATGG + Intronic
1096237129 12:49936980-49937002 CATGGAGCCTAGGACTATGGTGG + Intergenic
1097200179 12:57271701-57271723 CAGGGCTCCTACAACTATGATGG + Intronic
1097996988 12:65898700-65898722 CAGGGAGGCTAGGAGGATTAAGG - Intronic
1098330197 12:69344858-69344880 CAGGGAGCTTACAATTATGGAGG - Intergenic
1099816888 12:87660900-87660922 CTGGGAGGCTAGAAGTATTTGGG - Intergenic
1103020203 12:117527758-117527780 CAGGGAGGCTAAAAGTAATAAGG + Intronic
1104265670 12:127230626-127230648 CTTGGAGGCTAGAAGTAAGATGG - Intergenic
1107508785 13:41061264-41061286 CAGCGAGCCTAGAAGGAGGATGG + Exonic
1108477800 13:50838523-50838545 AAGGGAGCATAGAAGTGTGCAGG - Intronic
1111651708 13:91099160-91099182 AAGGGAGCCTAGATGTTTTAAGG - Intergenic
1116290284 14:43026444-43026466 CAGGAAGCCTACAATTATGATGG - Intergenic
1116679337 14:47945963-47945985 CAGGGAGACTATTATTATGACGG - Intergenic
1116690917 14:48104357-48104379 CTGGGACCCTAGAAGCAAGATGG + Intergenic
1117234732 14:53760247-53760269 CATGGAGCCCAGTAGTATGCTGG - Intergenic
1117985673 14:61384103-61384125 CAGGGATCCTAGAATGATGGAGG + Intronic
1119510543 14:75207772-75207794 AAGAGAGCCAAGAAGGATGAAGG + Intergenic
1122002533 14:98672268-98672290 CTGGGACCCTAAAAGGATGAGGG - Intergenic
1122667468 14:103342259-103342281 CAGGCACCCAAGAAGTCTGATGG + Exonic
1125212578 15:37234354-37234376 CAGGAAGCTTACAAGCATGACGG - Intergenic
1126662527 15:51046956-51046978 CAGGGAGGCTTGAAGGCTGAAGG + Intergenic
1128903891 15:71450707-71450729 CAAGGAACCTAGAAGGGTGAGGG - Intronic
1131140693 15:89974653-89974675 CTGGGAGCCTTGCAATATGAGGG - Intergenic
1136489537 16:30597623-30597645 CAGGAAGACTAGAAGAATGCGGG + Intergenic
1143966914 17:10762158-10762180 CCTGGAGCCTAGAAGTAGTAGGG - Intergenic
1148627204 17:49078776-49078798 CTGGGAGGCTAGAGGTAAGATGG - Intergenic
1148916379 17:50983110-50983132 CAGTGATACTAGAAATATGAAGG + Intronic
1152999432 18:440831-440853 CAGGTATCCTATAGGTATGATGG - Intronic
1154145211 18:11861266-11861288 CAGGGACCCTAGAAGGAAGAAGG - Intronic
1155357208 18:24964750-24964772 CTGGGAGGCTAGAAGCAAGATGG + Intergenic
1155449670 18:25950586-25950608 CAGGGAGCTTACAATTATGGTGG + Intergenic
1157145481 18:45158294-45158316 AAGGGAGCCCAAAAGTAAGATGG - Intergenic
1157223942 18:45846190-45846212 CAGGGGGCCCAGAAACATGAGGG - Intergenic
1157560187 18:48640120-48640142 AAGGGAGCCTTGAAGGATGAAGG - Intronic
1158298147 18:56022028-56022050 CATGGAACCTAGAAGCATTAAGG + Intergenic
1165663891 19:37609024-37609046 CTGGGAGACTAGAAGTGTCAAGG - Intronic
1166367713 19:42285730-42285752 CAGGGAGCCAGGCAGTGTGAGGG + Intronic
1167925009 19:52814151-52814173 CAGGGAGGCTGGAAGGAGGATGG + Intronic
925809208 2:7682362-7682384 GAGAGAGTCAAGAAGTATGAGGG - Intergenic
927174937 2:20399230-20399252 CAAGGAGCCCAGAACCATGATGG - Intergenic
928285631 2:29987847-29987869 AAGGGAGGCTAGAAGTTTTAGGG + Intergenic
929379366 2:41332438-41332460 CTGAGAGACTAGAAGTGTGAAGG - Intergenic
930458168 2:51633208-51633230 CAGGTAGCCAAGAAGAAGGAAGG - Intergenic
930681780 2:54264487-54264509 CAGGGAGCTTAGAATGAAGAAGG + Intronic
932915516 2:75854138-75854160 CAGGGACTTTTGAAGTATGAGGG + Intergenic
933158364 2:78998440-78998462 TGGGGAGCCTAGCAGGATGATGG - Intergenic
933449528 2:82429501-82429523 CTGGGAACCTAGAAGTAAGGGGG - Intergenic
936679881 2:114757563-114757585 CAGGGAGACTACTTGTATGAGGG + Intronic
937681114 2:124645840-124645862 CAGGGAGCTTAGAATCATGGTGG + Intronic
938122603 2:128644488-128644510 CATGGTGCCAAGAACTATGATGG - Intergenic
940069280 2:149666960-149666982 CAGAGAGCCTAGAACTATACAGG - Intergenic
941332100 2:164191255-164191277 CAGAGAGCCTAAATGGATGAAGG + Intergenic
941513191 2:166438806-166438828 TAGTGAGCCAAGAAATATGATGG + Intronic
941925426 2:170889518-170889540 CTGGGAGCTTAGAATTATCAAGG - Intergenic
942419390 2:175792517-175792539 CAGGAAACCAAAAAGTATGAAGG + Intergenic
943247897 2:185478737-185478759 CAGGAAGCCTACAAGTCTGCAGG + Intergenic
945384597 2:209181836-209181858 GAGGGAGCCAAGAAGTGGGATGG + Intergenic
946128067 2:217581778-217581800 CAGGGAGGCATGAAGAATGAAGG + Intronic
946177147 2:217928834-217928856 CAGGGAGCCTAGCAGTGGGCTGG - Intronic
947488735 2:230575790-230575812 CAGGGAGCCCAGATGAATGCTGG - Intergenic
1169450377 20:5705877-5705899 CAGGGAGCCCAGAAATAATAAGG - Intergenic
1170022253 20:11849553-11849575 CAGGGAGCCTAGAGAAAGGAGGG - Intergenic
1171434000 20:25105013-25105035 CAGGGAGCCCAGAAGTAATGTGG + Intergenic
1172346097 20:34201176-34201198 CAGGCACCCAAGAAGTCTGATGG + Intronic
1172790544 20:37502318-37502340 CATGGAGCTTACAAGGATGAGGG + Intronic
1173188208 20:40857283-40857305 CAGGAAGCTTACAATTATGACGG - Intergenic
1173681819 20:44887190-44887212 CAGGGATCCAAGAAAAATGAGGG - Intronic
1173724862 20:45290390-45290412 CAGGGAACCAAGAAGGCTGAGGG + Intergenic
1174280333 20:49434524-49434546 CAGGGAGCCCAGGAAGATGATGG - Intronic
1175490979 20:59381147-59381169 CAGGGAGCAGAGAAGGGTGAAGG - Intergenic
1176204980 20:63883393-63883415 CAGGGAGCCTAGAACAGGGAAGG - Intronic
1177509286 21:22062861-22062883 CATGGAGCTTAGAATTAGGAAGG - Intergenic
1178341732 21:31791352-31791374 CAGGGAGTCAAGAGGTCTGAGGG - Intergenic
1179425629 21:41276086-41276108 CAGGAAGGCTTGCAGTATGATGG + Exonic
1180318782 22:11301983-11302005 CAGGGAGCTTACAATCATGACGG + Intergenic
1180336435 22:11580589-11580611 CAGGGAGCTTACAATCATGATGG - Intergenic
1182974161 22:34606904-34606926 CAGGGAGACTAGAGAGATGATGG - Intergenic
952066888 3:29581423-29581445 CAGGCTGCCTGGAAGTCTGATGG - Intronic
952369249 3:32703870-32703892 CAGGGAGCAGAGAAACATGAAGG + Exonic
957036720 3:75300302-75300324 CAGAGAGCCTATCAGTATTAGGG + Intergenic
961616619 3:128187881-128187903 CAGGGAGCCTAGAAGTATGAAGG + Intronic
964731859 3:159876137-159876159 CAGGGAGACTGGAAGAATGGGGG - Intronic
965282382 3:166770684-166770706 CAGGAAGCTTACAATTATGACGG + Intergenic
965870723 3:173261238-173261260 CTGTGAGGCTAGAAGTAAGATGG + Intergenic
970235392 4:13953331-13953353 CCAGGAGCCTAGAAGTGGGAGGG - Intergenic
971055663 4:22910170-22910192 TAGGGAGCCTGGAATTATGTGGG - Intergenic
972906347 4:43752557-43752579 CAGGGAGCTTACAATTATGATGG - Intergenic
975789523 4:77933434-77933456 CAGGGAACCCAGAAGTACGGGGG + Intronic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
982195969 4:152914434-152914456 AAAGGAGACTAGAAATATGAGGG + Intronic
982255588 4:153448369-153448391 CATGAAGCCCAGATGTATGAGGG - Intergenic
985013877 4:185613085-185613107 CACGTAGCCTAGAAGTAGGCAGG + Intronic
986947614 5:13043844-13043866 AAGGGAGACTTGAAGTAGGAAGG - Intergenic
986981063 5:13448511-13448533 CAGGGTGCCTAGAATAAAGAAGG - Intergenic
990355803 5:54965012-54965034 CAGGAAGTCTAGAAATATAAAGG + Intergenic
990631403 5:57674419-57674441 CAGGAAACTTAGAATTATGATGG + Intergenic
991432910 5:66567125-66567147 AGGGAAGCCTAGAAGTAGGATGG + Intergenic
992299513 5:75363889-75363911 CAGGGAGCATAAAAGTAGGAGGG + Intergenic
992673243 5:79080638-79080660 TAGTGAGCCTAGCAGTTTGAAGG - Intronic
992845173 5:80739526-80739548 CAGGGAGCTTAGATCTATTAAGG + Intronic
993150997 5:84162128-84162150 CATGGGGCCTAGAAGTATGCTGG + Intronic
996344173 5:122471810-122471832 CAGGGGGAGTAGAAGGATGAGGG - Intergenic
997949961 5:138234548-138234570 CAGGAAGCCCTGAAGTATTATGG - Intergenic
998386811 5:141761946-141761968 CAGGAAGCCAAGAGGTAGGAGGG + Intergenic
999124851 5:149239488-149239510 CAGGGATCCCAGAAGCCTGAGGG - Intronic
999335669 5:150714283-150714305 AAGGGAGACTAGAAGTCTGGAGG + Intronic
1000986105 5:167862347-167862369 CACGGAGCCTAGTGGTATGCTGG - Intronic
1001360125 5:171075540-171075562 CAGGGAGGCTTGGAGAATGATGG + Intronic
1002367396 5:178723975-178723997 CAGGGAGCCCATTAGCATGATGG - Intronic
1002386053 5:178868195-178868217 CAGGGAGCCCATCAGCATGACGG + Intronic
1004143348 6:13042322-13042344 CAGGCAGCACTGAAGTATGATGG + Intronic
1005695276 6:28346044-28346066 CACGGAGCCTAGAATCAAGAGGG - Intronic
1006958229 6:37897163-37897185 GAAGGAGCCTACAGGTATGAAGG - Intronic
1007178676 6:39913198-39913220 CAGTGAGTCTAGGATTATGATGG - Intronic
1007749905 6:44065469-44065491 CTGGGAGCCTAGAAGACAGAGGG + Intergenic
1007787336 6:44288403-44288425 CATGCAGCTTAGAAGTATCACGG + Intronic
1009055673 6:58331934-58331956 CAGGGAGTCGAGAAATGTGAAGG + Intergenic
1009235496 6:61118661-61118683 CAGGGAGTCGAGAAATGTGAAGG - Intergenic
1010118402 6:72342498-72342520 CAGGGAGCTTAGCATTAGGAAGG + Intronic
1011414932 6:87108400-87108422 CAGGTAGCTTTGAACTATGAAGG - Intergenic
1012205432 6:96455415-96455437 CAGGGAGCCTAATTTTATGAAGG - Intergenic
1015028704 6:128568518-128568540 AAGGGAGCCAAGAAATCTGATGG - Intergenic
1015108431 6:129564832-129564854 CAGGGAGACTAAAATTATGTTGG - Intergenic
1015869276 6:137759733-137759755 CAGGGAGCTTAGAAGTAACCTGG - Intergenic
1015898089 6:138036243-138036265 CTGGAGGCCTAGGAGTATGACGG - Intergenic
1021545182 7:21804996-21805018 GAGCGTGCCTGGAAGTATGAGGG - Intronic
1022771412 7:33476649-33476671 GAGGGAGCTGAGAAGTAAGACGG - Intronic
1022857517 7:34329933-34329955 GAAGGAGCCTAGAAGGCTGAAGG + Intergenic
1028653126 7:93172428-93172450 CTGGGAGGCTAGAAGCAAGAAGG + Intergenic
1029777445 7:102693004-102693026 AAGGGTGCCTAGATGTCTGAAGG + Intergenic
1029983618 7:104902002-104902024 CAGGGAGCTGAGAAGTAAGTGGG - Intronic
1030456665 7:109783067-109783089 CAGGTTGCCTAGAAGAATGCAGG - Intergenic
1030470256 7:109954259-109954281 CTGTGAGCCTACAAGTGTGAAGG + Intergenic
1031325728 7:120394733-120394755 CTGTGAGACTAGAAGTAAGATGG + Intronic
1033415617 7:141158888-141158910 CAGGGAGCCTGAGAGAATGAAGG + Intronic
1033873717 7:145788597-145788619 CAGGGAGCCAAGAAAGATGAAGG - Intergenic
1035814612 8:2526125-2526147 CAGGGATCTCAGAAGGATGAAGG + Intergenic
1036115756 8:5959187-5959209 CAGGGAGCCCAGAAGCAAAAGGG + Intergenic
1036621856 8:10429503-10429525 CAGGAAACTTAGAATTATGATGG + Intergenic
1038043557 8:23747388-23747410 CAAGGAGCCCAGGAGTTTGAGGG - Intergenic
1038394004 8:27233218-27233240 AAGGCAGCCCAGAAGCATGATGG - Intergenic
1041512344 8:58665814-58665836 CAGGAAGCTTAAAAGCATGAAGG - Intergenic
1044923138 8:97186714-97186736 CAGGGAACAGAGAAGTACGAAGG + Intergenic
1045936343 8:107684026-107684048 CATAGAGCCCAGAAATATGAAGG - Intergenic
1046122970 8:109867875-109867897 CAGGGAGCATAGCGGCATGATGG + Intergenic
1047105241 8:121724526-121724548 CAGGGAGCACAGCAGTATGCAGG - Intergenic
1047316509 8:123739543-123739565 CAGGGAGCTTACAATTATGGAGG + Intergenic
1047486340 8:125334435-125334457 CAGAGAGCCTAGAAGGAGCATGG + Intronic
1047868745 8:129059064-129059086 AAGTGACCCTAGAGGTATGAAGG - Intergenic
1049278565 8:141732262-141732284 CAGGGAGCCCAGAAGGACAATGG - Intergenic
1052302945 9:26974139-26974161 CAGGGAGCCAAGAACTATAAAGG - Intronic
1052684169 9:31733190-31733212 CTGGGTGCCCAGAAGTATGTTGG + Intergenic
1056129808 9:83573187-83573209 CTTGGAGCCTAGAACAATGATGG - Intergenic
1057034840 9:91804461-91804483 CAGGGAGCCTCCAAGTGTCAAGG + Intronic
1058056484 9:100454246-100454268 CAGAGAGCTAAGAAGCATGAAGG + Intronic
1058248426 9:102660238-102660260 TAAGCAGCCTAGAAGTATGAGGG - Intergenic
1058469919 9:105267209-105267231 CAGCGACCCTAGAAGTCAGAAGG - Intronic
1059324950 9:113498373-113498395 CAGGGGGCCGAGAAGTCTGTGGG - Intronic
1059698354 9:116749892-116749914 CAGGAAGCTTACAAGTATGTTGG - Intronic
1203367003 Un_KI270442v1:267734-267756 CAGGGAGCTTACAATCATGACGG + Intergenic
1192931569 X:75811781-75811803 CAGGAAGCTTAAAATTATGATGG - Intergenic
1197327315 X:125109703-125109725 CCGGGAGGCTAGTGGTATGATGG - Intergenic
1197841933 X:130757495-130757517 CAGGGAGGAAAGAGGTATGATGG + Intronic
1201071670 Y:10152493-10152515 CAGGGAGCTTACAATCATGACGG - Intergenic
1202337075 Y:23823705-23823727 CAGCCAGTCTAAAAGTATGAAGG - Intergenic
1202533690 Y:25846366-25846388 CAGCCAGTCTAAAAGTATGAAGG + Intergenic