ID: 961616813

View in Genome Browser
Species Human (GRCh38)
Location 3:128188948-128188970
Sequence TTGTGAGTCTGTAGGGGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 275}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961616813 Original CRISPR TTGTGAGTCTGTAGGGGAGT TGG Intronic
900093648 1:931439-931461 TTGTGGGTCTCTAGGAGGGTGGG - Intronic
902635265 1:17730806-17730828 TTATGAGTCTGTGGGTCAGTTGG - Intergenic
902813805 1:18904696-18904718 TGGGGAGTCTGGAGGGGACTGGG - Exonic
904981761 1:34509498-34509520 CTGTCAGTCTGTTGGGGAGTGGG + Intergenic
905120587 1:35678830-35678852 GTGTGGGCCTGTAGGGGAGTGGG - Intergenic
907575573 1:55522918-55522940 TGCTGAGGTTGTAGGGGAGTGGG - Intergenic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
907784968 1:57602780-57602802 GTGTGTGTGTGGAGGGGAGTGGG + Intronic
908281494 1:62541741-62541763 TTTTGACTGTGTGGGGGAGTCGG + Intronic
910170319 1:84370187-84370209 GTGTGTGTGTGTAGGGGAATGGG - Intronic
915178971 1:154041911-154041933 TTTTGTGTGTGTAGGGGACTGGG - Intronic
916605863 1:166342760-166342782 TTCTGAGTCTGGTGGGGACTTGG - Intergenic
916725426 1:167518343-167518365 TTGTGTATGTGTAGGGGAGTGGG - Intronic
917090927 1:171352450-171352472 TATTGAGTGTGTAGGGGGGTAGG - Intergenic
922152397 1:223017371-223017393 TTGTGAGAAAGTAGGGGAGAGGG - Intergenic
922329862 1:224564974-224564996 ATGTGAGACTGAAGGGGACTGGG - Intronic
922887648 1:229032142-229032164 TGGTGTGTATGTAGGGGAGTGGG - Intergenic
924034705 1:239924667-239924689 TTCTGAGTCTGGTGGGGACTTGG - Intergenic
924488048 1:244506528-244506550 TAGTGAGGCTGTAGAGGAATTGG - Intronic
1063727810 10:8658109-8658131 TTGTGTGTGTGGAGGGGTGTGGG + Intergenic
1065421365 10:25548007-25548029 TTGTGAGGCAGTAAGGGATTTGG - Intronic
1065649067 10:27868186-27868208 TTGTGAGTCTGTGGAGAAATAGG + Intronic
1066062646 10:31737652-31737674 TTGTAAGGCTTTTGGGGAGTGGG - Intergenic
1066660968 10:37737789-37737811 TTCTGAGTCTGGTGGGGACTTGG + Intergenic
1066712677 10:38252472-38252494 TCATAAGTCTGTAGGAGAGTGGG + Intergenic
1067682981 10:48451852-48451874 TTGTGTGTGTGTAGGGGCTTTGG - Intronic
1067739485 10:48883617-48883639 TTCTGAGACGGTAGGGGAGGAGG - Intronic
1068152882 10:53156691-53156713 TGGTGAGGCTGTAGGGAAGTAGG + Intergenic
1068754594 10:60637289-60637311 TTATGAGCCTTTAGGGGAGAAGG + Intronic
1068978232 10:63034049-63034071 TTCTGAGTCTGGTGGGGAGGTGG + Intergenic
1069105251 10:64375892-64375914 TTGTGTGTTTGTAGGAGAGGGGG + Intergenic
1070201278 10:74208150-74208172 TTCTGAGTCTGCAGGGGAAAGGG + Intronic
1072680985 10:97506333-97506355 TTGTGAGACTCTAGGGCAGTGGG + Intronic
1074643384 10:115415173-115415195 TTATGAGTCTGTAGATGAATAGG - Intronic
1076484077 10:130804681-130804703 GTGTGAGTCTGAGGTGGAGTTGG + Intergenic
1076716204 10:132365228-132365250 GCGTGAGTCTGGAGGAGAGTGGG + Intronic
1077489566 11:2854433-2854455 GTGTGTGTGTGTAGGGGTGTCGG - Intergenic
1079039054 11:17045185-17045207 TGGTGAGACTGGAGGGAAGTAGG + Intergenic
1079310249 11:19359252-19359274 TTGTGAGTCTTTATGCGTGTGGG + Intronic
1080034189 11:27695069-27695091 TTGTGAGTGTGTATGGGGGTGGG - Intronic
1080695576 11:34600583-34600605 TTGGAAGTCTGTGGGTGAGTGGG - Intergenic
1082640840 11:55658460-55658482 TTGTGAGTGTGTTGGGTTGTGGG + Intergenic
1083691151 11:64409662-64409684 TTGTGAGTGGGGAAGGGAGTGGG + Intergenic
1084259210 11:67963683-67963705 TCCTGAGTCTGTTGGGGACTTGG + Intergenic
1084887732 11:72221971-72221993 TTGTGAGTTTGTGGGTGGGTGGG + Intergenic
1086124243 11:83333596-83333618 AGGTGAGTATGGAGGGGAGTTGG - Intergenic
1088458987 11:110062957-110062979 TTGAGAGTGTGGAGGGGAATGGG - Intergenic
1088920586 11:114257653-114257675 GTGTGTGTGTGTCGGGGAGTTGG - Intergenic
1089092330 11:115888310-115888332 CTGTGAGTTTGGAGTGGAGTTGG - Intergenic
1089240495 11:117074331-117074353 TTGTGGGGCTGTAGGGAAGTGGG - Intronic
1091071803 11:132571904-132571926 TTGTGAGGATGTGGGGGATTTGG - Intronic
1091428969 12:416321-416343 GTGTGAGTCTGTGGGTGTGTGGG + Intronic
1092128444 12:6091755-6091777 TTGTGTTTCTCTTGGGGAGTTGG - Intronic
1092230511 12:6773253-6773275 TTGTGGGGCTGCAGGGGAGCTGG - Exonic
1092741594 12:11635787-11635809 TTGTGATTCTGAATGAGAGTTGG - Intergenic
1093728352 12:22541612-22541634 ATTTGTGTGTGTAGGGGAGTGGG - Intronic
1094472237 12:30814051-30814073 TTGTGTGTGTGTGGGGGTGTGGG + Intergenic
1097173384 12:57129347-57129369 TTGTGAGGATGTAGGGGAGGCGG - Intronic
1097182578 12:57179732-57179754 TTGGGTGTCTGCAGGGCAGTGGG - Intronic
1100925052 12:99535946-99535968 TTGTGAGACTGTTGTGGAGCTGG - Intronic
1101161214 12:101978535-101978557 TGGAGAGCCTGTAGGGGAGTAGG + Intronic
1101531340 12:105576141-105576163 TGGTGATTCTGTGGGGTAGTGGG + Intergenic
1102014451 12:109638584-109638606 ATGTGAGTGTGTAGGAGTGTCGG + Intergenic
1102073804 12:110044164-110044186 ATGTGTGTCTGTAGGGATGTGGG + Intronic
1102547154 12:113665349-113665371 TTATGAGTGTGTAAGAGAGTAGG - Intergenic
1103410694 12:120709976-120709998 TTGGGGGTCTGATGGGGAGTGGG + Intergenic
1104470359 12:129025112-129025134 GTGTGAGTCTGTGGGGGATGTGG - Intergenic
1104636237 12:130439527-130439549 GTGTGGGTCTGTAGGGGTGTCGG + Intronic
1107003530 13:35580507-35580529 TTGTCAGTATGTAGGTAAGTAGG + Intronic
1109163550 13:59005421-59005443 GTGTGTGTGTGTAAGGGAGTGGG - Intergenic
1109530017 13:63630855-63630877 TTGTGATTCTTAAGGGGAATTGG + Intergenic
1109856311 13:68132419-68132441 TTGTGAGTCTGTGTGGGTGAGGG - Intergenic
1111538581 13:89638987-89639009 TTGTGAGGCTGTAGAGAAATTGG - Intergenic
1111747760 13:92291305-92291327 TCCTGAGTCTGGAGGGGACTTGG + Intronic
1113327439 13:109295469-109295491 TTGTGTGTGTGTAGGGTTGTGGG - Intergenic
1113671566 13:112178974-112178996 CTGTGAGGCTGTGGGGCAGTGGG + Intergenic
1114463444 14:22903167-22903189 TTGTGTGTATGTGGGGGTGTGGG - Intronic
1114708629 14:24753959-24753981 ATGTGAGTCTGTCGTGGGGTGGG - Intergenic
1115730410 14:36262528-36262550 TTCTCTGTCTTTAGGGGAGTTGG + Intergenic
1117271102 14:54144774-54144796 TTCTGAGGTTGTAGGGGAGTGGG - Intergenic
1117486770 14:56205396-56205418 TCATGAGCCTGTAGGGGAGGGGG + Intronic
1118580000 14:67286313-67286335 TTGTCTGTCTGTATGGGATTGGG + Intronic
1120560115 14:85981013-85981035 GTGTGTGTGTGTAGGTGAGTTGG - Intergenic
1122313123 14:100809916-100809938 TTGTGGTTCTGAAGGGGAATGGG - Intergenic
1123467588 15:20528213-20528235 TTGTGAGTGTGTATGGGGGTGGG - Intergenic
1123607614 15:22050836-22050858 ATGAGATTCTGTAGGGGTGTAGG + Intergenic
1123650526 15:22472829-22472851 TTGTGAGTGTGTATGGGGGTGGG + Intergenic
1123685657 15:22795342-22795364 TTGTGATTCTGTGGTGGACTGGG + Intronic
1123740934 15:23281671-23281693 TTGTGAGTGTGTATGGGGGTGGG + Intergenic
1123746064 15:23320887-23320909 TTGTGAGTGTGTATGGGGGTGGG - Intergenic
1124110528 15:26781569-26781591 TTCTGAGTCTGGTGGGGACTTGG - Intronic
1124278333 15:28344204-28344226 TTGTGAGTGTGTATGGGGGTGGG - Intergenic
1124304369 15:28567404-28567426 TTGTGAGTGTGTATGGGGGTGGG + Intergenic
1124485469 15:30111067-30111089 ATGTGAGTATGTTGGGGAGCTGG - Intergenic
1124495404 15:30183729-30183751 TGGGAAGTCTGTAGGGCAGTGGG + Intergenic
1124518107 15:30386200-30386222 ATGTGAGTATGTTGGGGAGCTGG + Intronic
1124533245 15:30523870-30523892 TTGTGAGTGTGTATGGGGGTGGG + Intergenic
1124540546 15:30580053-30580075 ATGTGAGTATGTTGGGGAGCTGG - Intergenic
1124593872 15:31077823-31077845 TGATGAGTCTGTATGTGAGTGGG + Intronic
1124748169 15:32354917-32354939 TGGGAAGTCTGTAGGGCAGTGGG - Intergenic
1124758107 15:32427528-32427550 ATGTGAGTATGTTGGGGAGCTGG + Intergenic
1124765412 15:32483774-32483796 TTGTGAGTGTGTATGGGGGTGGG - Intergenic
1124795914 15:32779421-32779443 TTGTGAGGATGCAGGGGAATGGG + Intronic
1124901498 15:33827274-33827296 TTCTGCGTCTGCAGGTGAGTGGG + Exonic
1125054368 15:35340265-35340287 TTGTGTTTCTGTAGGCGAGATGG + Intronic
1125631679 15:41152099-41152121 TCCTGAGTCTGTTGGGGACTTGG + Intergenic
1128650516 15:69409213-69409235 GTGTGTGTGTGTTGGGGAGTTGG - Intergenic
1129054676 15:72810573-72810595 ATGTGAGTCTGTTGGGAAATGGG + Intergenic
1129197010 15:73974169-73974191 TCCTGAGTCTGTTGGGGACTTGG + Intergenic
1130614537 15:85392138-85392160 TGGTGAGTTTCTAGGGTAGTGGG + Intronic
1130921306 15:88347362-88347384 TTGTGAGTCTGGAGGGAACAAGG + Intergenic
1131992299 15:98104165-98104187 TCCTGAGTCTGGTGGGGAGTTGG - Intergenic
1132098791 15:99008176-99008198 TTCTGAGTCTGGAAGGGACTTGG - Intergenic
1202979850 15_KI270727v1_random:342638-342660 ATGAGATTCTGTAGGGGTGTAGG + Intergenic
1136332165 16:29587355-29587377 TTGTCAGTGTGTAGAGGAATTGG - Intergenic
1136446862 16:30327425-30327447 TTGTCAGTGTGTAGAGGAATTGG - Intergenic
1137486196 16:48893529-48893551 TTCTGAGTGTGTTTGGGAGTAGG + Intergenic
1137623629 16:49893591-49893613 TTTTGCCACTGTAGGGGAGTCGG - Intergenic
1137802733 16:51275913-51275935 TTGTGTGTCTGTATAGGATTGGG - Intergenic
1138008278 16:53356922-53356944 TTGTGAGTGTGTATGGGGGTGGG - Intergenic
1138781279 16:59791207-59791229 TTGTGAGTCTGGCTAGGAGTTGG + Intergenic
1140151758 16:72374563-72374585 CTTTGAGTCTGTAGAGGAATCGG + Intergenic
1141570482 16:84930784-84930806 GTGTGAGTGGGTAGGGGTGTGGG + Intergenic
1141570503 16:84930858-84930880 GTGTGAGTGGGTAGGGGTGTGGG + Intergenic
1142809495 17:2388648-2388670 CAGGGAGTCTGGAGGGGAGTGGG - Intronic
1143552811 17:7641296-7641318 TTCTGAGTCTGGTGGGGACTTGG + Intergenic
1144960398 17:19041319-19041341 TTTGGAGTCTGGGGGGGAGTTGG - Intronic
1144974761 17:19133205-19133227 TTTGGAGTCTGGGGGGGAGTTGG + Intronic
1145016318 17:19400669-19400691 TTGTGTGTGTGTGGGGTAGTGGG + Intergenic
1148512091 17:48179896-48179918 TTATGAGATTGTAGGGAAGTGGG - Intronic
1149013504 17:51882444-51882466 TTGTGTGTGTGTATGGGTGTTGG + Intronic
1150965427 17:69962524-69962546 TTGTTAGTCTGCAGCAGAGTGGG + Intergenic
1151194023 17:72419207-72419229 TTGTGGGTCTGAATGGGAGATGG + Intergenic
1151208933 17:72529287-72529309 CTGTGTGTGTGTAGGGGGGTGGG - Intergenic
1151484360 17:74389302-74389324 TTGTGTAACTGTAGGGGAGAGGG + Intergenic
1152018562 17:77768377-77768399 GTGTGAGTGTGTATGGGAGGAGG - Intergenic
1153916470 18:9750101-9750123 TTGTGACTCTGTGGAGGCGTGGG + Intronic
1155468093 18:26161507-26161529 TTGTGAGGAAGTAGGGGAATTGG - Intronic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158447049 18:57530774-57530796 TTGTGTGTATGTGGGGGAGGAGG - Intergenic
1159061032 18:63514035-63514057 TTTTCAGTCTGTAAGGGAGCTGG - Intergenic
1159670073 18:71212295-71212317 TCCTGAGTCTGGTGGGGAGTTGG - Intergenic
1161262827 19:3346922-3346944 TTTTGATTCTGTCGCGGAGTTGG - Intergenic
1163207659 19:15815430-15815452 ATGTGAGTCTACAGGGCAGTGGG - Intergenic
1165353619 19:35290928-35290950 TTGTGGGGCTGGGGGGGAGTTGG - Intergenic
1165880540 19:39039490-39039512 TTGGGAGGCTGAAGGGGAGGTGG + Intergenic
1166647410 19:44542578-44542600 TTGTAAGTCTGCAGGTCAGTTGG - Intergenic
1167454772 19:49592270-49592292 TTGTGTGTGTGTAAGGGAGGGGG + Intronic
1167741937 19:51329122-51329144 TTGTGTGTGTGTGGGGGGGTGGG + Exonic
924963743 2:57407-57429 TTCTGAGCCTGTAGGGGACAGGG - Intergenic
925515781 2:4679372-4679394 TTGTGTGTGTGTATGGGTGTGGG - Intergenic
926704447 2:15826709-15826731 TTGTGACTGTGTAAGGGAGGAGG + Intergenic
927910928 2:26899080-26899102 TTGTTATTAAGTAGGGGAGTGGG + Intronic
928092373 2:28382893-28382915 CTGTGTGTCTTTAGGGGCGTGGG + Intergenic
928683492 2:33726529-33726551 TTGTGTGTGTTTGGGGGAGTGGG - Intergenic
929056838 2:37885666-37885688 GAGGGAGTCTTTAGGGGAGTTGG - Intergenic
929829110 2:45333302-45333324 GTGTGTGTCTGTGGGGGATTGGG - Intergenic
931027041 2:58122289-58122311 TTTTGACTGTGCAGGGGAGTGGG - Intronic
931198294 2:60073664-60073686 TTGTGAGGCTTTAGGGGAAAAGG + Intergenic
931253243 2:60551279-60551301 TTGTGAGTCTGTATAAGAGCTGG - Intronic
931702318 2:64918985-64919007 TTAAGAGTCTGGAGGGAAGTGGG - Intergenic
931739768 2:65231318-65231340 TTCTGAGTATGTAGAGGACTAGG + Intronic
932366655 2:71157348-71157370 TTGTGAGTGTGTATGGGGGTGGG + Intergenic
933050810 2:77599162-77599184 TTGTGTTTCTTTAGGGGAGTGGG + Intergenic
934095626 2:88600880-88600902 GTGTGAGTCAGTTGGGGAGAGGG - Intronic
936350854 2:111711519-111711541 AGGTGAGTCTGCAGGGGAGTAGG - Intergenic
937310076 2:120896666-120896688 GTGTGAGTGTGTGGGGGGGTGGG - Intronic
937358323 2:121212193-121212215 GTGTGTGTCTGTTGGGGGGTGGG + Intergenic
939398804 2:141665437-141665459 TGGTGAGTCTGTGGAGAAGTTGG + Intronic
940139628 2:150479406-150479428 CTGTGAGGCTTTAGAGGAGTTGG + Intronic
940285271 2:152027485-152027507 GTGTGAGTCAGGAGGGGAGGTGG - Intronic
940867888 2:158835592-158835614 TGGTGAGAGTGTAGGGGAATGGG + Intronic
941827744 2:169918750-169918772 TTGTGAGTTTGTAGCAGGGTGGG + Intronic
943427083 2:187750324-187750346 TTGTGAGCCTGTGGGGGAAGGGG + Intergenic
943494660 2:188606294-188606316 TTCTGAGTCTGGTGGGGAGGTGG - Intergenic
947617456 2:231567611-231567633 TTGTGAATCACCAGGGGAGTGGG - Intergenic
1169038187 20:2470633-2470655 TTCCGAGTCTGTTGTGGAGTGGG - Intronic
1170228724 20:14021373-14021395 CTGTGAGTCTGTAGCGGCCTTGG + Intronic
1171934107 20:31257347-31257369 CTGTGAGAATGTAGGGGAGGGGG + Intergenic
1172124048 20:32614605-32614627 TTGGGAGGTGGTAGGGGAGTTGG - Intergenic
1175852691 20:62102298-62102320 TTGTGTCTTTGTAGGGGAGGTGG - Intergenic
1177093425 21:16799698-16799720 TTGTGAGTCTGTATGTGGGATGG - Intergenic
1178931185 21:36820419-36820441 TTCTGAGCCTGTGGGGGAGGGGG - Intronic
1179031537 21:37724555-37724577 TAGTGAGTGTGGAGGGGAGTGGG + Intronic
1179101591 21:38359430-38359452 TTGCGGGTCTGCAGGGCAGTCGG + Intergenic
1180766927 22:18350775-18350797 GTGTGAGTGTGTGGGGGTGTGGG + Intergenic
1180812102 22:18768924-18768946 GTGTGAGTGTGTGGGGGTGTGGG - Intergenic
1181077587 22:20392310-20392332 TTCTGAGTCTGGTGGGGACTTGG - Intergenic
1181198261 22:21203171-21203193 GTGTGAGTGTGTGGGGGTGTGGG - Intergenic
1181598390 22:23933725-23933747 TTGTCAGTCTGTAGGAGAATGGG - Intergenic
1182618513 22:31604854-31604876 TGGTAAGTCTGTAGGGGACAAGG - Exonic
1182947272 22:34334912-34334934 TTCTGACTCTGTAGGGGAGATGG - Intergenic
1184649979 22:45915268-45915290 TGATGAGGCTGTAGGGGAGTGGG - Intergenic
1203228546 22_KI270731v1_random:91666-91688 GTGTGAGTGTGTGGGGGTGTGGG + Intergenic
950009522 3:9712960-9712982 TGGTGAACCTGGAGGGGAGTGGG - Exonic
953313134 3:41900038-41900060 ATGTGAGTATGTTGGGGAGCTGG + Intronic
958576165 3:95951671-95951693 TTCTGAGTCGGGTGGGGAGTTGG - Intergenic
959907643 3:111728413-111728435 TTGTGTGTGTGTAGGTGAGAGGG + Intronic
961616813 3:128188948-128188970 TTGTGAGTCTGTAGGGGAGTTGG + Intronic
962451344 3:135519855-135519877 TGGTAAGTATGGAGGGGAGTAGG - Intergenic
962925884 3:139993090-139993112 TTGTGTGTGTGTATGGGAGGGGG + Intronic
963076991 3:141356069-141356091 TTGTGTGTGTGTGGTGGAGTGGG + Intronic
964198226 3:154088432-154088454 TTCTGAGTCTGGTGGGGACTTGG + Intergenic
965347768 3:167573209-167573231 GTGTGTGTCTGTGGGGGTGTAGG - Intronic
966203257 3:177378915-177378937 TTGTGCTTCTGAAGGGGAGAGGG + Intergenic
968611113 4:1557574-1557596 TTGAGGCTCTGGAGGGGAGTGGG - Intergenic
968611143 4:1557671-1557693 TTGAGGCTCTGGAGGGGAGTGGG - Intergenic
968611159 4:1557719-1557741 TTGAGGCTCTGGAGGGGAGTGGG - Intergenic
969683241 4:8655004-8655026 TGGTGAGGCTGTGGGGGAATAGG - Intergenic
970214968 4:13749381-13749403 GTGTGTGTCTGGGGGGGAGTTGG - Intergenic
971994518 4:33947949-33947971 TTGTGAGTCTGTAGAGAAAGGGG + Intergenic
974920667 4:68235318-68235340 TTGTTTGTCTGTAGGTAAGTAGG + Intronic
975349029 4:73325877-73325899 TTCTGAGTCTGGTGGGGACTTGG + Intergenic
976620740 4:87124859-87124881 GTGTGAGTGTGATGGGGAGTGGG - Intronic
976736218 4:88313102-88313124 TGCTGAGTCTGTTGGGGACTTGG - Intergenic
979129260 4:117019975-117019997 TAGTGGGGCTGTAGGGGAGTGGG + Intergenic
980693729 4:136329172-136329194 TTGTGAGCCAGTGGGGAAGTGGG + Intergenic
980824025 4:138052845-138052867 TTCTGAGTCTGGTGGGGACTTGG - Intergenic
982519714 4:156399124-156399146 TGGTGAGGCTGTAGAGGAATAGG + Intergenic
982583610 4:157209552-157209574 TTCTGGGTCTGGAGGGGACTTGG - Intronic
986799725 5:11246705-11246727 CTGTGTGTCTGTAGGTGGGTGGG + Intronic
987765956 5:22230165-22230187 TGGTGAATATGTTGGGGAGTGGG - Intronic
988494167 5:31730599-31730621 GTGTGTGTGTGTAAGGGAGTTGG + Intronic
988853244 5:35199715-35199737 TTGTAAATCTGTAGAGGAGAGGG + Intronic
991427168 5:66503705-66503727 TTCTGAGTCTGGTGGGGACTTGG + Intergenic
992792542 5:80226497-80226519 TTATGTTTCTATAGGGGAGTAGG - Intronic
993017697 5:82554268-82554290 TTGTGAGGCTGTAGAGAAATTGG - Intergenic
993342933 5:86747062-86747084 TAATGAGTATGTAGGGGACTTGG + Intergenic
993770382 5:91917738-91917760 TTCTGAGTCTGGTGGGGACTTGG + Intergenic
993808743 5:92446621-92446643 TTGTGAATGTGTTGGGAAGTTGG - Intergenic
994176717 5:96719230-96719252 TTGTGAGACTGGATGGGAGTAGG - Intronic
996493801 5:124129814-124129836 TTCTGAGGCTGAAGGGGCGTTGG + Intergenic
997130044 5:131267515-131267537 ATGTGTGTCTGTTGGGGAGAGGG + Intronic
997234486 5:132264913-132264935 TTTTCATTCTGTGGGGGAGTTGG - Intronic
998003568 5:138642766-138642788 CTGTCAGTCTGCAGGTGAGTGGG - Intronic
1000143462 5:158429632-158429654 GTGTGTGTGTGTAGGGGAGGAGG - Intergenic
1001809527 5:174617425-174617447 TGGTGAGTTTGTAGGGGAGCAGG - Intergenic
1002763974 6:224009-224031 TTGTGAGTCAGTGGGTGAGTCGG + Intergenic
1003048875 6:2763235-2763257 TTCTGAGTCTGGTGGGGACTTGG - Intergenic
1003213825 6:4090552-4090574 TTCTGAGTCTGGTGGGGACTTGG + Intronic
1003870678 6:10400193-10400215 TAATGAGTGTGTATGGGAGTGGG - Intronic
1004009058 6:11663909-11663931 GTGTGTGTGTGTAGGGGAGGCGG + Intergenic
1004452305 6:15758658-15758680 TTCTGAGTCTGGTGGGGACTTGG - Intergenic
1005042183 6:21609798-21609820 TTCTGAGTCTGGTGGGGACTTGG - Intergenic
1006058861 6:31404683-31404705 TTGGGGGTCTGGAGGGGAGTGGG - Intronic
1006071346 6:31499568-31499590 TTGGGGGTCTGGAGGGGAGTGGG - Intronic
1006887130 6:37391276-37391298 TTGTGAGACTGTCTGGGAGCAGG - Exonic
1009664258 6:66655309-66655331 TTCTGAGTCTGGTGGGGACTTGG - Intergenic
1011877639 6:91980806-91980828 TTGTGTGTCTGTATGGGAAAGGG - Intergenic
1012790104 6:103682414-103682436 GTGTGTGTGTGTAGGGGGGTGGG - Intergenic
1013179006 6:107702415-107702437 TTGTGACTCTGTAGTGAAGGAGG + Intergenic
1016858711 6:148697091-148697113 TTCTGAGTCTGGTGGGGACTTGG - Intergenic
1019106489 6:169671749-169671771 TTGTGAGTGTGCAGAGGAGAAGG - Intronic
1021406880 7:20280427-20280449 TTGTGTGTGTGTTGGGGAGGTGG + Intergenic
1022193653 7:28042367-28042389 TTCTGAGTCTGAGGGGGAGCTGG + Intronic
1024062425 7:45709122-45709144 TTGTGAGTGTGAAGGGTGGTAGG + Intronic
1024386456 7:48757416-48757438 TTGTGTGTGTGTCGGGGGGTGGG - Intergenic
1028054646 7:86226529-86226551 TTCTGAGCCTGCAGGGGAATGGG + Intergenic
1029158670 7:98535409-98535431 TTGGGTGGCTGTAGGGAAGTGGG + Intergenic
1029474316 7:100773917-100773939 CAGGGAGTCTGTTGGGGAGTTGG - Intronic
1031110051 7:117596571-117596593 TTCTGAGTCTGGTGGGGACTTGG + Intronic
1031363622 7:120876733-120876755 TTGTGTGTCTGTGGTGGAGATGG - Intergenic
1031683001 7:124697354-124697376 TTCTGAGTCTCTGGGGAAGTTGG - Intergenic
1031723208 7:125203503-125203525 TAGTGAGTGTGTAGGGCAATTGG - Intergenic
1031782452 7:125985564-125985586 TGGAGAGTATGCAGGGGAGTGGG - Intergenic
1033340777 7:140490645-140490667 TTGGGAGACTGAAGGGGGGTGGG - Intergenic
1033482462 7:141755555-141755577 TTGTGAGTATGTAGCAGAGCCGG - Intronic
1034068678 7:148161540-148161562 TTGTGTGTGTGTATGGGAGGTGG - Intronic
1034541937 7:151763954-151763976 TTGTGCGTCTCTACAGGAGTTGG + Intronic
1034725336 7:153330598-153330620 TTGTGTGTGTGTTGGGGAGCTGG + Intergenic
1034937268 7:155208339-155208361 GTGTGTGTCTGTGGGGGAATGGG + Intergenic
1035869007 8:3116517-3116539 TTGGGAGTCTGAAGGGGTTTAGG + Intronic
1035976876 8:4322822-4322844 TTGTGTGTTTGTAGGAGAGTTGG - Intronic
1036679925 8:10864492-10864514 TGTTGAGGCAGTAGGGGAGTGGG + Intergenic
1037372438 8:18194282-18194304 TGATGTGTCTGTAGGGGAGAGGG + Intronic
1039067382 8:33620640-33620662 TTCTGAGTCTATAGGAGATTAGG + Intergenic
1039143464 8:34419355-34419377 ATGTGTGTGTGTAGGGGAGAGGG + Intergenic
1040836779 8:51740464-51740486 TAGTGAGGCTGTAGAGGAATAGG - Intronic
1043588891 8:81804058-81804080 TTGTAAGACAGTAGGGGACTGGG + Intronic
1043668615 8:82851229-82851251 TTGTGTGTATGTGGGGGAGGGGG + Intergenic
1044346305 8:91108320-91108342 ATGTGTGTCTGCAGTGGAGTAGG + Intronic
1044956975 8:97491264-97491286 TTGTGAGTCTATAGGCCAGCTGG + Intergenic
1047607534 8:126489871-126489893 TTCTGAGTCTGCAGTGGAATAGG + Intergenic
1048056991 8:130876701-130876723 TTGTGTGTGTGTAGGGGGGCAGG + Intronic
1048308958 8:133303558-133303580 ATGTGAATCTGTGGGGCAGTGGG - Intergenic
1048402842 8:134087986-134088008 TTCTGTGCCTGCAGGGGAGTGGG + Intergenic
1048786030 8:138051339-138051361 TTGTGTGTGTGGCGGGGAGTTGG + Intergenic
1049290379 8:141798485-141798507 CTCTGAGTGTGTGGGGGAGTGGG + Intergenic
1049763658 8:144342997-144343019 CTGTGTCTCTGTAGGTGAGTGGG - Intergenic
1049826940 8:144674952-144674974 TTCTGAGTCTGCAGGGGAAGGGG + Intergenic
1051442174 9:17097064-17097086 CTGTGAGTGTGTAGGGCAGGAGG - Intergenic
1051622916 9:19070104-19070126 TTCTGGGTCTGTTGGGGAGTTGG - Intronic
1052056594 9:23914358-23914380 TCCTGAGTCTGTTGGGGACTTGG - Intergenic
1052090439 9:24320648-24320670 TTGGGAGTCTGGAGGAGAGTGGG + Intergenic
1052810801 9:33057763-33057785 TTGTGAGTTTGTAGAGAACTGGG - Intronic
1053298273 9:36930638-36930660 TTGTGTGGCTGTAGGTGAGCTGG + Intronic
1057653884 9:96937593-96937615 TTGTGTGTCTGTGTGGGTGTGGG + Intronic
1058758115 9:108102599-108102621 GTGTGTGTATGTTGGGGAGTAGG + Intergenic
1059113269 9:111577318-111577340 TGGTGAGTATGTAGAGAAGTTGG + Intronic
1059521001 9:114942053-114942075 TAGTAGGTCTGTAGGGGAGGAGG + Intergenic
1059643397 9:116239322-116239344 TGGTGAGTTTGTAGCAGAGTTGG - Intronic
1059827364 9:118045906-118045928 ATGTAAGTGTGTAGGGGAGGTGG + Intergenic
1186502190 X:10060412-10060434 TTGTGTGTGTGTTGGGGAGGGGG + Intronic
1187977772 X:24720591-24720613 TTGTGGGGTTGTGGGGGAGTGGG - Intronic
1188963041 X:36516933-36516955 TTGTGGGACTGGAGGGGAGGTGG + Intergenic
1189209918 X:39276041-39276063 TTCTGAGTCTGGTGGGGACTTGG + Intergenic
1193708888 X:84856545-84856567 TTCTGAGTCTGATGGGGACTTGG - Intergenic
1194210815 X:91066619-91066641 TTGTGGGCCTGTGTGGGAGTGGG + Intergenic
1196105314 X:111888952-111888974 ATGGGAGGCTGTAAGGGAGTAGG + Intronic
1197317920 X:124991458-124991480 ATGTGTGTGTGTCGGGGAGTGGG + Intergenic
1197533700 X:127662913-127662935 TTCTGAGTCTGGTGGGGACTTGG - Intergenic
1199540072 X:148948822-148948844 TTGTGGGTCTGAAGTGGGGTTGG - Intronic
1200398436 X:156004732-156004754 TTATGTGTGTGTATGGGAGTAGG + Intronic