ID: 961617042

View in Genome Browser
Species Human (GRCh38)
Location 3:128190900-128190922
Sequence CAGCTCACTGTGCCTCGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 1, 2: 0, 3: 14, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961617039_961617042 6 Left 961617039 3:128190871-128190893 CCTGCAGTATTTAGTACAGTCAC 0: 2
1: 29
2: 236
3: 1007
4: 1681
Right 961617042 3:128190900-128190922 CAGCTCACTGTGCCTCGCCTGGG 0: 1
1: 1
2: 0
3: 14
4: 156
961617038_961617042 23 Left 961617038 3:128190854-128190876 CCACTGGGTTACAATTGCCTGCA 0: 1
1: 10
2: 156
3: 618
4: 1338
Right 961617042 3:128190900-128190922 CAGCTCACTGTGCCTCGCCTGGG 0: 1
1: 1
2: 0
3: 14
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961617042 Original CRISPR CAGCTCACTGTGCCTCGCCT GGG Intronic
900226030 1:1534090-1534112 CAGCTCACGGAGCCTGGCCGCGG + Exonic
901285146 1:8072369-8072391 AAGCTCAGTGTGCCTCACGTCGG + Intergenic
902599585 1:17531972-17531994 CAGCTCCCACTGGCTCGCCTAGG - Intergenic
902815359 1:18913421-18913443 CAGCTTCCTGTCCCTCGGCTGGG - Intronic
904786135 1:32984426-32984448 GAACTGACTGTGCCTAGCCTAGG + Intergenic
905254726 1:36672949-36672971 CAGTTCACTGTACTTCTCCTGGG + Intergenic
905370721 1:37481416-37481438 CAGCAAACTGTGCCACGCCAAGG + Intronic
905403265 1:37717831-37717853 CAGCTCCCTGTGCCTTGGCAGGG - Exonic
906571544 1:46846048-46846070 CAGCTCAGCATGCCTCTCCTGGG - Intergenic
906599560 1:47113305-47113327 CAGCTCAGCATGCCTCGCCTGGG + Intronic
912053544 1:105565101-105565123 CAGCTCACTGTGCATAATCTTGG + Intergenic
912982286 1:114386503-114386525 CAGCTCACAGGACCTCTCCTGGG - Intergenic
916269213 1:162921866-162921888 CAGCCCTCTTTGCCTCCCCTAGG + Intergenic
916560572 1:165931197-165931219 CAGCTCCCTGAGCCTGGCCTGGG - Intergenic
921382147 1:214534796-214534818 CAGTTCCCTGTGACTTGCCTGGG + Intronic
923189365 1:231605816-231605838 CAGCTCATAGTGCCTGGCTTGGG + Intronic
1063926239 10:10980490-10980512 CAGCTCACTGTGCTTCTTCTGGG + Intergenic
1066099091 10:32101243-32101265 AAGCTAACTGTGCATCTCCTAGG - Intergenic
1066502469 10:36007549-36007571 CAGCTCTCTCTGCCTTACCTGGG + Intergenic
1067368563 10:45660200-45660222 CATACCACTGTGCCTTGCCTAGG - Intronic
1067435092 10:46271068-46271090 CTGCTCACTGTGCAAGGCCTCGG + Intergenic
1069777395 10:70934980-70935002 CAGCTTACTGTGCCTGGGCAAGG + Intergenic
1073158327 10:101367353-101367375 CCACTCACTGCGCCTGGCCTAGG + Intronic
1073461254 10:103667186-103667208 CAGCCCACACTGCCTCCCCTGGG + Intronic
1074390705 10:113055725-113055747 CACATCACTGTGCCTAGCTTTGG + Intronic
1076097279 10:127741751-127741773 AAGCTGACTGTGCCATGCCTGGG - Intergenic
1076365153 10:129916812-129916834 CTGCTCACTGTGCCTCCCTTGGG - Intronic
1078468979 11:11571915-11571937 CAGCTCACTGTGTTTCCCCAGGG - Intronic
1079924761 11:26480242-26480264 CAGCTGACTGAGCCTCTGCTGGG + Intronic
1080774815 11:35375718-35375740 CAGGTCACTGGGCCTGGACTGGG + Intronic
1082129757 11:48473621-48473643 CAGCTCATTGTTCCTCACCCTGG - Intergenic
1082563280 11:54644519-54644541 CAGCTCATTGTTCCTCACCCTGG - Intergenic
1083696852 11:64449010-64449032 CAGCTCCCCCTGCCTCGCTTGGG + Intergenic
1083859831 11:65414152-65414174 CAAGCCACTGTGCCTGGCCTGGG - Intergenic
1085020862 11:73206314-73206336 AACCTCTCTGTGCCTCACCTTGG + Intergenic
1086080987 11:82901776-82901798 CGAGTCACTGTGCGTCGCCTGGG + Exonic
1090732785 11:129586150-129586172 CATCCCACTTTGCCTCTCCTTGG - Intergenic
1091637250 12:2206379-2206401 CATCTCACAGTGCCTCCTCTCGG - Intronic
1091912954 12:4246409-4246431 CAGCTCTGGGGGCCTCGCCTTGG - Intergenic
1091980447 12:4860167-4860189 CAGCCCACTCTGCCCTGCCTGGG - Intergenic
1092890498 12:12965235-12965257 CACCTCTCTGTGCTTCCCCTGGG + Intergenic
1095890564 12:47231832-47231854 CAGCTCGATGTGCCTTCCCTGGG - Intronic
1095962433 12:47844060-47844082 AAGCTCACAGTTCCTCGCCCTGG - Exonic
1096184795 12:49571670-49571692 CTGCTCACTGTACCTCTTCTTGG + Intronic
1096505601 12:52090522-52090544 CAGCTCCCTGGGCCTCCCCATGG - Intergenic
1100734532 12:97512580-97512602 CAGCACCCTGTGCCTAGCCCAGG - Intergenic
1102299468 12:111760475-111760497 CTGCTCATTCTGCCTCCCCTGGG - Intronic
1102739346 12:115193099-115193121 CACCTCCCTGTGCCTAGCCCCGG - Intergenic
1108667258 13:52645136-52645158 CAGCTCACTGAACCTCGACCTGG + Intergenic
1111402621 13:87761079-87761101 CAGGTCACTGCCCCTGGCCTAGG + Intergenic
1113405416 13:110034416-110034438 CATCTCACCCTGCCTCCCCTTGG - Intergenic
1114862664 14:26544435-26544457 CTCCTCACTGTGCATCACCTAGG - Intronic
1116325911 14:43533676-43533698 CAGCACTCTGTGCCTAGCTTGGG + Intergenic
1120999930 14:90444217-90444239 CAGCTCTCTGTGCCTCTCCAGGG + Intergenic
1122266269 14:100548360-100548382 CAGCCCATTGTGCCTGCCCTAGG - Intronic
1122800851 14:104228874-104228896 CTTCTCGCTGAGCCTCGCCTTGG - Intergenic
1129834654 15:78694545-78694567 CAGCTCAGTGTTCCTGGTCTTGG - Intronic
1134862022 16:17568696-17568718 CAGCACCCTGAGCCTGGCCTGGG + Intergenic
1139657143 16:68395967-68395989 CAACTCAGTGTGCCTGGCCTGGG + Intronic
1139777926 16:69328880-69328902 CAGCTCAGTCTGCCATGCCTTGG + Exonic
1142113987 16:88346962-88346984 TACCTCAGTGTGCCTCTCCTGGG - Intergenic
1144534017 17:16069400-16069422 CAGCTCACAGTGCCCAGCCCAGG + Intronic
1144771165 17:17760442-17760464 CAGCCCAGTGTCCCTGGCCTGGG + Intronic
1144847536 17:18227760-18227782 CAGCCCACTCTGGCTAGCCTTGG + Intronic
1145941873 17:28746981-28747003 CAGCTGTCTGTGCCTCCTCTAGG + Intronic
1147164125 17:38584453-38584475 CAGCTCAGCCTGCCCCGCCTGGG + Intronic
1150147397 17:62780491-62780513 CAGCACACTGGGCCAGGCCTGGG + Intronic
1152234714 17:79132700-79132722 CTGCTCACTGGCCCTCCCCTGGG + Intronic
1152795802 17:82305560-82305582 CAGCTCAGTGTCCCTCAGCTGGG - Intergenic
1154942880 18:21132373-21132395 CAGCACACTGTGCCTAGCTCCGG - Intergenic
1155546873 18:26924695-26924717 CAGGTCAGTGTGTCTCTCCTGGG + Intronic
1161423317 19:4187699-4187721 CACCTCTTTGTGCCTGGCCTGGG + Intronic
1162475140 19:10895386-10895408 CAAGCCACTGTGCCTGGCCTAGG + Intronic
1164160671 19:22623734-22623756 CAGCTCCCTCTGCCTGGCGTTGG - Intergenic
925163101 2:1700615-1700637 CCTCCCACTGTGCCTGGCCTTGG - Intronic
925712895 2:6758716-6758738 CAGCTCTCTGTGCCTTTCTTGGG - Intergenic
925891704 2:8439775-8439797 CAGCTCACAGTGACTCCCCTGGG + Intergenic
926243089 2:11103106-11103128 CGGCTCACTGTGCCTCCTCCTGG - Intergenic
926339851 2:11895897-11895919 CACCACACTGGGCCTCTCCTGGG + Intergenic
926924677 2:17975596-17975618 CAGCTCACTCTCCCTCTGCTAGG - Intronic
927149763 2:20188859-20188881 CAGCTCCCTGCGCCTGGCCCTGG - Intergenic
929366616 2:41165961-41165983 CAGCTCACTGAGCCTCTGCAAGG + Intergenic
933726227 2:85429270-85429292 CAGGTCTCTGAGCCTCCCCTAGG - Intronic
934851989 2:97707434-97707456 CAGGGCACTGTGCCTGGCATGGG - Intergenic
935257971 2:101329261-101329283 AAGCTCACCCTGCCTGGCCTAGG + Intergenic
936095522 2:109528114-109528136 CAGGTCACTGTGACTCATCTGGG - Intergenic
937288462 2:120767675-120767697 CAGCCCCCACTGCCTCGCCTGGG + Intronic
940457298 2:153916438-153916460 CAAGTCACTGTGCCCAGCCTAGG + Intronic
1169021614 20:2335021-2335043 CAGCTCACCCTGCCTTGGCTTGG + Intronic
1169640755 20:7748757-7748779 CTCCTCACTGGGCCTTGCCTTGG - Intergenic
1172528575 20:35616075-35616097 CAGCTCAATGAGCATCACCTCGG + Exonic
1175193469 20:57226534-57226556 CACCTCACTGTTCCACGGCTTGG - Intronic
1175270520 20:57730781-57730803 CCGCTCACTGTTCCTCTCCTTGG + Intergenic
1176024385 20:62978387-62978409 CCGCTCCCTGGGCCTCGCCAGGG + Intergenic
1176150900 20:63590231-63590253 CTGCTCACGTTGCCTGGCCTGGG - Exonic
1176364832 21:6026526-6026548 CAGCCCCCTGTGCCTCACCCCGG + Intergenic
1177377971 21:20298489-20298511 CAGCCCACAGTGCCTTGGCTGGG + Intergenic
1179286172 21:39979080-39979102 CAGCTCACTGAGCCTGGGCAAGG + Intergenic
1179758686 21:43512019-43512041 CAGCCCCCTGTGCCTCACCCCGG - Intergenic
1180255412 21:46624129-46624151 CAGCCAAGTGGGCCTCGCCTGGG - Intergenic
1180664256 22:17497217-17497239 CAGCTCACTGCAGCTCTCCTGGG - Intronic
1181467113 22:23116235-23116257 CAACTCACTGTGCCTCGAGTAGG - Intronic
1182314816 22:29438556-29438578 CAGCTCGCTGTTCCTCACATGGG + Intergenic
1182695133 22:32193484-32193506 CAGCTCGCTGTTCCTCACATGGG - Intronic
1182716215 22:32357840-32357862 CAGCTCGCTGTTCCTCACATGGG + Intronic
1183340690 22:37279391-37279413 CAGTTCTCTGTGACTCCCCTGGG + Intergenic
1183431028 22:37765826-37765848 CAGCCCACTGTGCCCCCCCCAGG - Intronic
1183689016 22:39377657-39377679 CAGCACACTGTTCCCTGCCTCGG + Intronic
1184381472 22:44147411-44147433 CGCCTCACTGCCCCTCGCCTGGG - Intronic
1184723946 22:46332214-46332236 CAGATCACTCTGTCTGGCCTGGG - Intronic
950131736 3:10552055-10552077 AACCTCACTGTGCCTATCCTGGG + Intronic
951372150 3:21862710-21862732 CAGCTAGCTGTGCCTCCCCAAGG + Intronic
952137694 3:30441774-30441796 CAGGTATCTGTGCCTTGCCTAGG + Intergenic
956878701 3:73489100-73489122 CAGTGCACTGTGCCTTGGCTGGG - Intronic
960551303 3:118978536-118978558 GAGCTGACTGTGCCTGCCCTTGG - Intronic
961617042 3:128190900-128190922 CAGCTCACTGTGCCTCGCCTGGG + Intronic
961617093 3:128191426-128191448 CAGCTCACTGTGCCTGGCCTGGG + Intronic
962713166 3:138104128-138104150 CACCTCACTTTGCCCCGCTTAGG - Intronic
966321727 3:178708353-178708375 TAGCTCTCTGTGCCTGGCATTGG + Intronic
967805926 3:193714734-193714756 CAGGTCCCTGTGCCTGGCCCAGG - Intergenic
968611385 4:1558731-1558753 CACCTCCCTGTGCCCCGCCACGG + Intergenic
970151898 4:13098667-13098689 CAGCTCACTTTGGCTTTCCTTGG - Intergenic
971026628 4:22595109-22595131 CAGGTCAGTGTGTCTCTCCTGGG + Intergenic
972530519 4:39957506-39957528 CAGGCCACTGTGCCTGGCCCAGG - Intronic
973822983 4:54679093-54679115 CAGCTCACAGTGTCACTCCTTGG - Intronic
975577542 4:75877531-75877553 CGGTTCACTGTTCCTGGCCTGGG + Intronic
983690645 4:170465196-170465218 CAGCTCACTTTCCCTCAACTGGG + Intergenic
984418155 4:179486879-179486901 CAGCTCACCGTGCAATGCCTGGG + Intergenic
985802338 5:2012983-2013005 CAGGTGACCGGGCCTCGCCTGGG - Intergenic
986166238 5:5273663-5273685 CACCTTACTGTGTCTCCCCTGGG + Intronic
987078477 5:14405363-14405385 CAGCCCCCTGTGCCTAGCCGAGG - Intronic
987291466 5:16512302-16512324 CAGGTCACTATGCCTTGGCTGGG + Intronic
991939737 5:71838969-71838991 CAGCTCTCTGTGCCTAGACTTGG - Intergenic
992645275 5:78805899-78805921 AAGCTCACAGTGCCTCTCCCTGG - Intronic
993352367 5:86866242-86866264 CAGCTCACTTTGACTGGCATTGG - Intergenic
993781098 5:92066321-92066343 CAGATCCCTGGGCCTAGCCTCGG - Intergenic
998172604 5:139881328-139881350 CAGCTGCCTCTGCCTCTCCTGGG + Intronic
999340475 5:150765869-150765891 CATCTCACTGTGCCTTACCTAGG + Intergenic
999514528 5:152287688-152287710 AAGCTCACCCTGCCTGGCCTTGG - Intergenic
1001311775 5:170616309-170616331 CACCTCAGTGTGCCTGGCCCAGG - Intronic
1007373851 6:41443372-41443394 CAGCGCACTGTGCTTGGCCGCGG + Intergenic
1014426439 6:121312509-121312531 GAGGTCACTGTGGCTCTCCTAGG - Intronic
1015846791 6:137528720-137528742 CCACTCACTGTGCCTTGCCCTGG + Intergenic
1018208556 6:161458411-161458433 CAGCTCCCTGGCCCTCGCCGCGG + Intronic
1020130976 7:5558402-5558424 CACGCCACTGTGCCTTGCCTTGG - Intronic
1024087480 7:45907428-45907450 CAGCTCCCTTTGCCCTGCCTCGG - Intergenic
1024252874 7:47519667-47519689 CAGCTCACTGTGGCTAGCATGGG - Intronic
1026461570 7:70619466-70619488 CAGCTCTCTCTTCCTCTCCTGGG - Intronic
1030935895 7:115584899-115584921 GAGCTCACTGTGCCCCGAGTAGG + Intergenic
1031802668 7:126268446-126268468 TAGATCACTTTGCCTCTCCTGGG - Intergenic
1031990868 7:128198042-128198064 CAGCTCCCTGGGCCACTCCTAGG + Intergenic
1031990883 7:128198110-128198132 CAGCTCCCTGGGCCACTCCTAGG + Intergenic
1031990912 7:128198244-128198266 CAGCTCCCTGGGCCACGCCTAGG + Intergenic
1033333250 7:140432432-140432454 CAGCTCTCTGTGACCCACCTGGG + Intergenic
1033907226 7:146219973-146219995 CAACTCAGTTTGCCTCTCCTGGG - Intronic
1037600167 8:20387201-20387223 CAGCTCACTGGGTCTTGCTTTGG + Intergenic
1039809875 8:41037168-41037190 GAGCCCACTGTGCCCAGCCTTGG + Intergenic
1039886026 8:41654261-41654283 CAGCTGGCAGTTCCTCGCCTCGG - Intronic
1040860549 8:51994405-51994427 CAGATCCCTTGGCCTCGCCTCGG + Intergenic
1041273287 8:56130978-56131000 CAGCTCACAGTGCCTGCCTTTGG - Intergenic
1041520710 8:58752867-58752889 CAGCACACTGTGCCTGGGCTAGG - Intergenic
1042945603 8:74151712-74151734 CAGCCCTCTCTGTCTCGCCTTGG + Intergenic
1060989721 9:127841404-127841426 CAGGTCCCTGTGCCTCCTCTGGG - Intronic
1187908300 X:24087545-24087567 CATCTCACTCTGTCTTGCCTAGG - Intergenic
1194903372 X:99542907-99542929 CAGGTCCCTGGGCCTAGCCTGGG - Intergenic
1197997117 X:132389574-132389596 TAGCTCACAGTGCATCTCCTGGG + Intronic
1198338674 X:135692826-135692848 CACCTCACTGAGCCTGACCTAGG - Intergenic
1199818245 X:151419244-151419266 CATCTCATTGTTCCTCACCTGGG - Intergenic
1200184191 X:154170934-154170956 CCGCTCACTGTGCATCTTCTCGG + Intergenic
1200189844 X:154208062-154208084 CCGCTCACTGTGCATCTTCTCGG + Intergenic
1200195597 X:154245871-154245893 CCGCTCACTGTGCATCTTCTCGG + Intergenic
1200201250 X:154282992-154283014 CCGCTCACTGTGCATCTTCTCGG + Intronic