ID: 961617093

View in Genome Browser
Species Human (GRCh38)
Location 3:128191426-128191448
Sequence CAGCTCACTGTGCCTGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 460
Summary {0: 1, 1: 1, 2: 3, 3: 37, 4: 418}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961617088_961617093 7 Left 961617088 3:128191396-128191418 CCACCTTAGCCTCTTGAGTAGCT 0: 68
1: 2138
2: 18056
3: 32737
4: 43070
Right 961617093 3:128191426-128191448 CAGCTCACTGTGCCTGGCCTGGG 0: 1
1: 1
2: 3
3: 37
4: 418
961617086_961617093 11 Left 961617086 3:128191392-128191414 CCTCCCACCTTAGCCTCTTGAGT 0: 56
1: 1490
2: 12414
3: 24647
4: 42500
Right 961617093 3:128191426-128191448 CAGCTCACTGTGCCTGGCCTGGG 0: 1
1: 1
2: 3
3: 37
4: 418
961617090_961617093 -2 Left 961617090 3:128191405-128191427 CCTCTTGAGTAGCTTAGACTTCA 0: 1
1: 4
2: 306
3: 6648
4: 68623
Right 961617093 3:128191426-128191448 CAGCTCACTGTGCCTGGCCTGGG 0: 1
1: 1
2: 3
3: 37
4: 418
961617089_961617093 4 Left 961617089 3:128191399-128191421 CCTTAGCCTCTTGAGTAGCTTAG 0: 2
1: 21
2: 1106
3: 18387
4: 137096
Right 961617093 3:128191426-128191448 CAGCTCACTGTGCCTGGCCTGGG 0: 1
1: 1
2: 3
3: 37
4: 418
961617087_961617093 8 Left 961617087 3:128191395-128191417 CCCACCTTAGCCTCTTGAGTAGC 0: 67
1: 2191
2: 24206
3: 126906
4: 217733
Right 961617093 3:128191426-128191448 CAGCTCACTGTGCCTGGCCTGGG 0: 1
1: 1
2: 3
3: 37
4: 418

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961617093 Original CRISPR CAGCTCACTGTGCCTGGCCT GGG Intronic
900140675 1:1138238-1138260 CAAGCCACTGTGCCCGGCCTGGG + Intergenic
900163517 1:1235674-1235696 CAGCTCTCTGGGCCAGCCCTGGG + Intergenic
900213463 1:1468547-1468569 CACCTCACGGAGCCTGGCCGCGG + Exonic
900221025 1:1509368-1509390 CACCTCACGGAGCCTGGCCGCGG + Intergenic
900226030 1:1534090-1534112 CAGCTCACGGAGCCTGGCCGCGG + Exonic
900320595 1:2081618-2081640 CACCACACTGTGCCCGGACTTGG + Intronic
900394956 1:2449603-2449625 CAGCAGCCTCTGCCTGGCCTGGG + Intronic
900428391 1:2590844-2590866 CAGGCCTCTGCGCCTGGCCTAGG - Exonic
900533665 1:3166829-3166851 AAGCTCACTGTGTCTGGCGCTGG + Intronic
900649244 1:3722947-3722969 CACCTCTCTGTGCCTGGCACAGG + Intronic
900649290 1:3723140-3723162 CACCTCTCTGTGCCTGGCACGGG + Intronic
901688093 1:10955557-10955579 TGGACCACTGTGCCTGGCCTAGG - Intronic
901700557 1:11043053-11043075 CAGCTGCCTGGGTCTGGCCTGGG + Intronic
903021513 1:20398668-20398690 ATGTCCACTGTGCCTGGCCTTGG + Intergenic
903472159 1:23594839-23594861 CAGCTCACAGGGTCTGGCCAAGG - Intronic
903586486 1:24419510-24419532 CATCCCACAGGGCCTGGCCTAGG - Exonic
903770774 1:25762982-25763004 TGAGTCACTGTGCCTGGCCTAGG - Intronic
904786135 1:32984426-32984448 GAACTGACTGTGCCTAGCCTAGG + Intergenic
904789846 1:33011274-33011296 CAGCTATGTGTGCCTGGTCTGGG - Intronic
905016891 1:34783905-34783927 CTGCTCCCTGTGCTGGGCCTGGG - Intronic
905403265 1:37717831-37717853 CAGCTCCCTGTGCCTTGGCAGGG - Exonic
906098315 1:43239160-43239182 CTGGTCACTGTGCCAGGCATGGG - Intronic
906323691 1:44831571-44831593 ATGCTCTCTGTTCCTGGCCTGGG + Intronic
906599560 1:47113305-47113327 CAGCTCAGCATGCCTCGCCTGGG + Intronic
907427294 1:54388424-54388446 CCACACACAGTGCCTGGCCTGGG + Intronic
907477736 1:54716915-54716937 CTTCTCACTGAGCCTGACCTTGG - Intronic
907652817 1:56311880-56311902 CAGATAACTGTGCCTGGGGTGGG - Intergenic
909727597 1:78854210-78854232 AAGCTCACTGTTCCAGGCATTGG + Intergenic
912053544 1:105565101-105565123 CAGCTCACTGTGCATAATCTTGG + Intergenic
912418806 1:109529915-109529937 CCGCTCCCTGTCCCGGGCCTGGG - Intergenic
913447809 1:118968802-118968824 AAGCTCCCTGTGCCTGGCTCTGG - Intronic
913688938 1:121260149-121260171 GAGCTACCTGTGCCTGGCCCAGG + Intronic
914148662 1:145020128-145020150 GAGCTACCTGTGCCTGGCCCAGG - Intronic
915565923 1:156712624-156712646 CAACTGACTGTCCCTGCCCTGGG - Intergenic
916170417 1:161997800-161997822 AAGTTCATTGTACCTGGCCTTGG - Intronic
916560572 1:165931197-165931219 CAGCTCCCTGAGCCTGGCCTGGG - Intergenic
918195105 1:182213762-182213784 CTGCTAACTGTTCCTGGCATGGG + Intergenic
918513456 1:185336672-185336694 TAGCTCATTGGGCATGGCCTGGG - Intergenic
920089479 1:203441980-203442002 CTGCTCACTTTCCCTGCCCTCGG - Intergenic
920178766 1:204119723-204119745 ATGACCACTGTGCCTGGCCTAGG - Intronic
920476262 1:206278643-206278665 GAGCTACCTGTGCCTGGCCCAGG + Intronic
920699737 1:208208856-208208878 GAGCAAATTGTGCCTGGCCTAGG - Intronic
921265672 1:213418850-213418872 GAGTACACTCTGCCTGGCCTTGG - Intergenic
921382147 1:214534796-214534818 CAGTTCCCTGTGACTTGCCTGGG + Intronic
922501327 1:226098917-226098939 CACCTCACTGTGGCTGGGATAGG - Intergenic
922727283 1:227928323-227928345 CTGCCCACCCTGCCTGGCCTTGG - Intronic
922755232 1:228092875-228092897 CACCTCACTGTGCCTGAACAGGG - Intronic
922774441 1:228208295-228208317 CAGCTCCCTGTGGCGGGGCTGGG + Intronic
923108071 1:230869086-230869108 CAGCTCACCGCGCCAGGCCCCGG - Intronic
923189365 1:231605816-231605838 CAGCTCATAGTGCCTGGCTTGGG + Intronic
923533179 1:234827799-234827821 CAGTTCACTGGGACTGGCCGAGG - Intergenic
1062933756 10:1369785-1369807 AAGCTCAGTGTGCCTGCTCTAGG - Intronic
1063498688 10:6533478-6533500 CGAGCCACTGTGCCTGGCCTGGG + Intronic
1063926239 10:10980490-10980512 CAGCTCACTGTGCTTCTTCTGGG + Intergenic
1065857806 10:29844278-29844300 CATCCCACAGAGCCTGGCCTGGG + Intergenic
1066269814 10:33811171-33811193 CAGCTCAGTGCCCCTGACCTTGG + Intergenic
1066342506 10:34549919-34549941 CAGCTCTCTGGGCCTGGTCGTGG - Intronic
1066502469 10:36007549-36007571 CAGCTCTCTCTGCCTTACCTGGG + Intergenic
1067368563 10:45660200-45660222 CATACCACTGTGCCTTGCCTAGG - Intronic
1067435092 10:46271068-46271090 CTGCTCACTGTGCAAGGCCTCGG + Intergenic
1067808071 10:49407014-49407036 CAGACCTCTGTCCCTGGCCTGGG - Intergenic
1068144234 10:53045653-53045675 TAAGCCACTGTGCCTGGCCTAGG + Intergenic
1069599108 10:69692082-69692104 TAAGCCACTGTGCCTGGCCTTGG + Intronic
1069622140 10:69844233-69844255 CAGCTCAGTGTGGCTGTCCAGGG + Intronic
1069777395 10:70934980-70935002 CAGCTTACTGTGCCTGGGCAAGG + Intergenic
1070224202 10:74483346-74483368 CTGGTCCCTGAGCCTGGCCTAGG + Intronic
1070647916 10:78214298-78214320 CAGGTCCCTCTGCCTGTCCTGGG + Intergenic
1070682283 10:78456967-78456989 CTCCTCACTTTGCCTGGCCCCGG - Intergenic
1070995071 10:80771246-80771268 CAGCTCTCTGTGCAGGGCATAGG + Intergenic
1072135322 10:92539956-92539978 TGAGTCACTGTGCCTGGCCTAGG - Intronic
1072798063 10:98371841-98371863 TTGCTCCCCGTGCCTGGCCTGGG - Intergenic
1073158327 10:101367353-101367375 CCACTCACTGCGCCTGGCCTAGG + Intronic
1073448726 10:103596835-103596857 CAGATCTCTGTGCCTGGAATGGG - Exonic
1074390705 10:113055725-113055747 CACATCACTGTGCCTAGCTTTGG + Intronic
1075016735 10:118915184-118915206 CATCTCTGTGTGCCTGCCCTGGG - Intergenic
1075400126 10:122155055-122155077 CAGCTACCTGTGACTGCCCTGGG - Intronic
1075671590 10:124267062-124267084 CAGCTGTGTGTGCTTGGCCTGGG - Intergenic
1076097279 10:127741751-127741773 AAGCTGACTGTGCCATGCCTGGG - Intergenic
1076365153 10:129916812-129916834 CTGCTCACTGTGCCTCCCTTGGG - Intronic
1077305308 11:1866322-1866344 CAGCACTGAGTGCCTGGCCTGGG - Intronic
1077433565 11:2527655-2527677 CACCTGTCTGTGTCTGGCCTTGG + Intronic
1077511201 11:2964309-2964331 CTGTCCACTGTGCCAGGCCTTGG - Intronic
1080774815 11:35375718-35375740 CAGGTCACTGGGCCTGGACTGGG + Intronic
1083347398 11:62003205-62003227 CAGCCCACTGTCCCTGTCCCTGG + Intergenic
1083859831 11:65414152-65414174 CAAGCCACTGTGCCTGGCCTGGG - Intergenic
1083922712 11:65789067-65789089 CAGCACACTGAGCCTGGCTCAGG - Intronic
1084106850 11:66986045-66986067 CAGCTCACCTTGGCTGGTCTTGG + Intergenic
1084377160 11:68785262-68785284 CCTCCCACTGCGCCTGGCCTCGG - Intronic
1085637589 11:78170339-78170361 CAGCTCTCAGTTCCTGCCCTAGG - Intergenic
1090020426 11:123123540-123123562 AATCCCACTGTGCCTGGCCAAGG + Intronic
1090023853 11:123150984-123151006 CGAGCCACTGTGCCTGGCCTGGG + Intronic
1091784107 12:3231879-3231901 GAGCTCCCTGTGCCTGGGCCTGG + Intronic
1091980447 12:4860167-4860189 CAGCCCACTCTGCCCTGCCTGGG - Intergenic
1094214463 12:27925690-27925712 CAGCCACCTGTACCTGGCCTGGG + Intergenic
1094496072 12:30990210-30990232 CCCCTTACTGTGCCTGTCCTGGG + Intronic
1095890564 12:47231832-47231854 CAGCTCGATGTGCCTTCCCTGGG - Intronic
1096570298 12:52519263-52519285 CTGTGCACTGTGCCTGGCCCTGG + Intronic
1097805590 12:63961401-63961423 CTCCTCACTGTGCAGGGCCTTGG + Intronic
1100001077 12:89835875-89835897 CATATCACTGGGCCTGGCCCTGG - Intergenic
1100734532 12:97512580-97512602 CAGCACCCTGTGCCTAGCCCAGG - Intergenic
1102690026 12:114753241-114753263 CAGCTCACTCCACCTGGCCCAGG - Intergenic
1102739346 12:115193099-115193121 CACCTCCCTGTGCCTAGCCCCGG - Intergenic
1102969508 12:117155332-117155354 CAGCCCACTGCGCCGGCCCTGGG - Intronic
1103272850 12:119688018-119688040 CAGCGCCCGGTGCCTGCCCTGGG - Exonic
1103611877 12:122129115-122129137 CTGCTCTCTGTCCCTGTCCTAGG + Exonic
1104458799 12:128937361-128937383 CAGGGCCCTGTGCATGGCCTTGG + Intronic
1104658753 12:130593358-130593380 CGGGGCACTGTGCCTGTCCTTGG - Intronic
1104735034 12:131131312-131131334 CTGCTCAATGTGCCAGGCCCCGG - Intronic
1106540528 13:30686304-30686326 CACCTCATTGTGCCTGGCTCAGG + Intergenic
1106861721 13:33916605-33916627 CTGCTCCCTGTGAGTGGCCTTGG - Intronic
1108350676 13:49588166-49588188 TGACCCACTGTGCCTGGCCTAGG - Intergenic
1108353473 13:49608335-49608357 TAAGCCACTGTGCCTGGCCTTGG + Intergenic
1109116714 13:58398095-58398117 CAGCCCACTGGGCCTGCTCTTGG + Intergenic
1111402621 13:87761079-87761101 CAGGTCACTGCCCCTGGCCTAGG + Intergenic
1112436537 13:99394725-99394747 CACCTCCATGTGCCTGTCCTAGG + Intergenic
1113593646 13:111517370-111517392 CTGCCCTCTGTGCCTGGCCATGG + Intergenic
1114083651 14:19221211-19221233 AAGGCCACTGTGCCAGGCCTGGG + Intergenic
1114653742 14:24303455-24303477 CAGCTCACCGTGCCCGGCTGAGG + Intronic
1116012310 14:39366224-39366246 GAGCTGAGTGTGCCTGTCCTTGG + Intronic
1116325911 14:43533676-43533698 CAGCACTCTGTGCCTAGCTTGGG + Intergenic
1119731852 14:76956334-76956356 CAGCTCCCTGGGCCGGCCCTGGG + Intergenic
1120509890 14:85400387-85400409 CATCTCACTGTGCCTGTGTTAGG + Intergenic
1120623239 14:86792006-86792028 CAGCACCCTGGGCCTGGCCCAGG - Intergenic
1120999930 14:90444217-90444239 CAGCTCTCTGTGCCTCTCCAGGG + Intergenic
1121873647 14:97431599-97431621 CCCCTTACGGTGCCTGGCCTTGG + Intergenic
1122266269 14:100548360-100548382 CAGCCCATTGTGCCTGCCCTAGG - Intronic
1122296922 14:100711095-100711117 CCCCTCACTCTGCCGGGCCTTGG + Intergenic
1124181778 15:27482841-27482863 CACCTCACAGGGCCTGGACTCGG - Intronic
1126487001 15:49192931-49192953 TGGGCCACTGTGCCTGGCCTAGG + Intronic
1126798238 15:52277728-52277750 CAGCTCCCTGTCCCTGGGGTGGG - Intronic
1127129688 15:55849493-55849515 GGGATCACTGTGCCTGGCCCTGG + Intronic
1127371789 15:58348353-58348375 AAGCTCCCTGTCTCTGGCCTTGG + Intronic
1127624332 15:60765307-60765329 GTGCCCACTGAGCCTGGCCTGGG + Intronic
1129139239 15:73582120-73582142 CAAGACACTGCGCCTGGCCTTGG + Intronic
1129187493 15:73918875-73918897 CAGGTCACAGTGCCTGGGTTTGG - Intergenic
1129359382 15:75015026-75015048 TAGGTCACTGTGTCTGACCTGGG + Intronic
1129446508 15:75622664-75622686 CAGAGCACTGGACCTGGCCTGGG - Intronic
1129834654 15:78694545-78694567 CAGCTCAGTGTTCCTGGTCTTGG - Intronic
1129880326 15:79002364-79002386 GACCTCACTGTGCCAGACCTAGG - Intronic
1130416401 15:83698494-83698516 CAGGGCACTGAGCCAGGCCTAGG - Intronic
1131983333 15:98017189-98017211 CTGCTCACCATGCCTGTCCTAGG + Intergenic
1132584920 16:701937-701959 CAGCAGCCTGAGCCTGGCCTGGG + Intronic
1133144299 16:3772491-3772513 CAGCTCAGTGTGTTTGCCCTGGG - Intronic
1133284561 16:4684523-4684545 CCGTCCTCTGTGCCTGGCCTGGG - Intronic
1134470714 16:14522788-14522810 AAGCTCCCTGTCCATGGCCTGGG + Intronic
1134539688 16:15055045-15055067 CTGATCACTGTCCCTGCCCTCGG - Intronic
1134862022 16:17568696-17568718 CAGCACCCTGAGCCTGGCCTGGG + Intergenic
1135008311 16:18848637-18848659 CAGCTCAGTGAGCCTGGCAGAGG + Intronic
1135398551 16:22149526-22149548 CAGGCCACTGTGTCTGGCTTGGG + Intronic
1135674962 16:24407360-24407382 TAAGCCACTGTGCCTGGCCTGGG + Intergenic
1135992193 16:27224832-27224854 CAGCTCACTGTCCTTGCCCAGGG - Intergenic
1137614734 16:49839424-49839446 CTGCTCCCTGTGCCTGGCACTGG - Intronic
1139657143 16:68395967-68395989 CAACTCAGTGTGCCTGGCCTGGG + Intronic
1139777926 16:69328880-69328902 CAGCTCAGTCTGCCATGCCTTGG + Exonic
1140646989 16:77042683-77042705 GGGCTCACTGTTCCTGGTCTGGG - Intergenic
1141685579 16:85568006-85568028 CGAGCCACTGTGCCTGGCCTGGG + Intergenic
1142403344 16:89872684-89872706 CAGCTTCCTGTGCCTGGGGTTGG - Intergenic
1142599807 17:1048084-1048106 CATCTCCCTGTCCCTGGGCTGGG - Intronic
1142819966 17:2458161-2458183 TGGGCCACTGTGCCTGGCCTAGG + Intronic
1143255965 17:5558242-5558264 ATGCTCACTGAGCCTGGCCGGGG - Intronic
1143384026 17:6515895-6515917 TATGTCACTGTGCCAGGCCTGGG - Intronic
1144495054 17:15740801-15740823 GAGGCCACTGTGCCAGGCCTGGG - Intronic
1144534017 17:16069400-16069422 CAGCTCACAGTGCCCAGCCCAGG + Intronic
1144729846 17:17520024-17520046 CAGCTCAGCGTGCCAGCCCTGGG + Intronic
1144771165 17:17760442-17760464 CAGCCCAGTGTCCCTGGCCTGGG + Intronic
1144847536 17:18227760-18227782 CAGCCCACTCTGGCTAGCCTTGG + Intronic
1145210824 17:21011720-21011742 CAGGCCACCGGGCCTGGCCTGGG - Intronic
1146489950 17:33273750-33273772 CAGTTCACTGAGCGTGACCTTGG - Intronic
1147928324 17:43959924-43959946 GAGCTGACTGTGTCTGACCTAGG - Intronic
1147952134 17:44113133-44113155 CAGCTCTCTCTGCCTGCCCCAGG + Intronic
1147988785 17:44321091-44321113 GCGCTCACTGTGGCTGGGCTGGG - Exonic
1148599778 17:48885350-48885372 CAGGCCACTGCGCCTGGCCCGGG - Intergenic
1149392363 17:56204622-56204644 CAAGTCACTGTGCCTGGCTCAGG + Intronic
1149754192 17:59174132-59174154 CAGATCACTGGGGCTGACCTTGG - Intronic
1150112452 17:62513969-62513991 GAGCCCACCGTGCCTGGCCAAGG + Intronic
1150147397 17:62780491-62780513 CAGCACACTGGGCCAGGCCTGGG + Intronic
1150218136 17:63481512-63481534 GAGCCCACTCTGGCTGGCCTGGG - Intergenic
1150988206 17:70223983-70224005 TAAGCCACTGTGCCTGGCCTAGG - Intergenic
1151329832 17:73400274-73400296 TTGCTCTCTGTGCCAGGCCTAGG + Intronic
1151330881 17:73407227-73407249 CCCCTCACTGTGCCAGGCATCGG - Intronic
1151560737 17:74868167-74868189 TAGCCCCCTGTGGCTGGCCTGGG - Intronic
1151732008 17:75917245-75917267 CAGGCCACTGTGCCTGGCTAAGG + Intronic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1152590094 17:81207382-81207404 CTGACCACTGTGCCTGGCCAGGG + Intronic
1152806251 17:82357669-82357691 CAGCTGTCTGTGCCTGGCTCAGG - Intergenic
1154942880 18:21132373-21132395 CAGCACACTGTGCCTAGCTCCGG - Intergenic
1155401142 18:25441063-25441085 CAGCCCACTGTCCACGGCCTAGG + Intergenic
1157249324 18:46080827-46080849 AATATCACTGTGCCTGGCGTGGG + Exonic
1157578532 18:48759746-48759768 CAGACCACTGTTCCTGCCCTGGG + Intronic
1160701910 19:511624-511646 CAGGGCTCTGTGCCTGGCCCAGG - Intronic
1160779812 19:872747-872769 CAGCTCCCTGCGCCTGGGGTGGG - Intronic
1160817986 19:1044992-1045014 CATCCCACAGTGCCTGTCCTTGG + Exonic
1160841930 19:1150195-1150217 AACCTCACTATGCCTGCCCTTGG + Intronic
1161005479 19:1933711-1933733 CTGCCCTCTGTGGCTGGCCTTGG + Intergenic
1161118330 19:2511816-2511838 GAGCTATCTGTGCTTGGCCTGGG + Exonic
1161423317 19:4187699-4187721 CACCTCTTTGTGCCTGGCCTGGG + Intronic
1161698526 19:5783247-5783269 CCGCTCGCTGTGCCTGCCCGAGG - Exonic
1162475140 19:10895386-10895408 CAAGCCACTGTGCCTGGCCTAGG + Intronic
1164137541 19:22427961-22427983 CCGCTCCCTCTGCCTGGCGTTGG + Intronic
1164160671 19:22623734-22623756 CAGCTCCCTCTGCCTGGCGTTGG - Intergenic
1165076770 19:33283646-33283668 GTGTCCACTGTGCCTGGCCTTGG - Intergenic
1165472350 19:36010756-36010778 CACCTCCCTGTCCCTGGCTTGGG - Intronic
1165935342 19:39385355-39385377 GAGCTGACTGTGCCTGGCACTGG + Intronic
1166125444 19:40713058-40713080 GAAGCCACTGTGCCTGGCCTGGG - Intronic
1166966212 19:46530699-46530721 AGACTCACTGTACCTGGCCTGGG - Intronic
1167450972 19:49569083-49569105 GAGCCCACTGCGCCCGGCCTGGG + Intronic
1168425116 19:56233912-56233934 GTGCTCACGGTGCCTGGCCCGGG - Intronic
925163101 2:1700615-1700637 CCTCCCACTGTGCCTGGCCTTGG - Intronic
925577665 2:5377229-5377251 CTGCACTGTGTGCCTGGCCTGGG + Intergenic
925712895 2:6758716-6758738 CAGCTCTCTGTGCCTTTCTTGGG - Intergenic
925891704 2:8439775-8439797 CAGCTCACAGTGACTCCCCTGGG + Intergenic
927139283 2:20118714-20118736 CAGCTCTTTGTGCCTGTGCTGGG + Intergenic
927149763 2:20188859-20188881 CAGCTCCCTGCGCCTGGCCCTGG - Intergenic
929353089 2:40984399-40984421 CATGTCACTGTGCCTGACTTTGG - Intergenic
929942883 2:46348171-46348193 CAGCTCAGTGGGCCTGGGGTTGG + Intronic
932188818 2:69721415-69721437 AAGATCACTCTGGCTGGCCTTGG + Intronic
932593523 2:73080727-73080749 CAGCTGATGATGCCTGGCCTTGG - Intronic
934667146 2:96180136-96180158 TAAGCCACTGTGCCTGGCCTAGG - Intergenic
934851989 2:97707434-97707456 CAGGGCACTGTGCCTGGCATGGG - Intergenic
935257971 2:101329261-101329283 AAGCTCACCCTGCCTGGCCTAGG + Intergenic
938492931 2:131775422-131775444 AAGGCCACTGTGCCAGGCCTGGG - Intergenic
938499540 2:131823219-131823241 AAGGCCACTGTGCCAGGCCTGGG + Intergenic
940457298 2:153916438-153916460 CAAGTCACTGTGCCCAGCCTAGG + Intronic
941879974 2:170471331-170471353 TGACCCACTGTGCCTGGCCTGGG + Intronic
945143765 2:206715101-206715123 CTGCTCACTGTGGCTGGAATGGG + Intronic
947792111 2:232874437-232874459 CAGCTCAATGTTCCTGGACGGGG - Intronic
948118722 2:235513228-235513250 CAGATCACTGTGCCGGGCGCGGG + Intronic
948140820 2:235670627-235670649 CAGCTCCGGGAGCCTGGCCTGGG + Intronic
948570410 2:238913981-238914003 CACCTCACTGTGTGTGGCATGGG + Intergenic
1169021614 20:2335021-2335043 CAGCTCACCCTGCCTTGGCTTGG + Intronic
1169640755 20:7748757-7748779 CTCCTCACTGGGCCTTGCCTTGG - Intergenic
1170240772 20:14164343-14164365 GAGCTGAGTGTGCCTGTCCTTGG + Intronic
1170767149 20:19300017-19300039 CCTCTCATTGTGCCTGGCTTTGG - Intronic
1171406481 20:24915311-24915333 CAGCTCACTGTGGCTGGAGCAGG - Intergenic
1171492584 20:25531867-25531889 CAGCTGGGGGTGCCTGGCCTTGG + Intronic
1172244652 20:33437692-33437714 CACCTCCCTGTGCCTGTTCTGGG + Intronic
1174307030 20:49620494-49620516 CAGGTCACTGCTCCTGGCCAAGG + Intergenic
1175270520 20:57730781-57730803 CCGCTCACTGTTCCTCTCCTTGG + Intergenic
1175281908 20:57809477-57809499 CAGGGCCCTGTGCCAGGCCTGGG - Intergenic
1175688398 20:61047782-61047804 CAGCCCACTGTGCCTGAACCTGG + Intergenic
1175964636 20:62654408-62654430 CTGCTCACTGGGCCTGCGCTGGG - Intronic
1176027749 20:62994542-62994564 CCGCTGTCTGGGCCTGGCCTGGG + Intergenic
1176150900 20:63590231-63590253 CTGCTCACGTTGCCTGGCCTGGG - Exonic
1177377971 21:20298489-20298511 CAGCCCACAGTGCCTTGGCTGGG + Intergenic
1177624926 21:23646830-23646852 CGGCTCAGTGTGCATGCCCTTGG - Intergenic
1179286172 21:39979080-39979102 CAGCTCACTGAGCCTGGGCAAGG + Intergenic
1179480077 21:41671417-41671439 CTGCTCACAGTTCCAGGCCTGGG - Intergenic
1180294324 22:10872056-10872078 AAGGCCACTGTGCCAGGCCTGGG - Intergenic
1180497130 22:15901470-15901492 AAGGCCACTGTGCCAGGCCTGGG - Intergenic
1180758978 22:18184371-18184393 CACCCCAGTGTGCCTGGCATGGG + Intergenic
1180769265 22:18368162-18368184 CACCCCAGTGTGCCTGGCATGGG + Intergenic
1180777047 22:18494233-18494255 CACCCCAGTGTGCCTGGCATGGG - Intergenic
1180809769 22:18751571-18751593 CACCCCAGTGTGCCTGGCATGGG - Intergenic
1180827137 22:18871391-18871413 CACCCCAGTGTGCCTGGCATGGG + Intergenic
1180841087 22:18959262-18959284 CAGGTCTCTGTGCTGGGCCTGGG + Intergenic
1181060410 22:20279531-20279553 CAGGTCTCTGTGCTGGGCCTGGG - Intronic
1181195907 22:21185794-21185816 CACCCCAGTGTGCCTGGCATGGG - Intergenic
1181213621 22:21307330-21307352 CACCCCAGTGTGCCTGGCATGGG + Intergenic
1181467113 22:23116235-23116257 CAACTCACTGTGCCTCGAGTAGG - Intronic
1183510337 22:38230875-38230897 CCTCTCCCTGTGCTTGGCCTCGG - Intronic
1183630569 22:39030131-39030153 CAGCCCACAGTGACTGGCCCAGG - Intronic
1183634025 22:39050223-39050245 CAGCCCACAGTGACTGGCCCAGG - Intronic
1183661741 22:39225383-39225405 CAGCTCCCTGCCCCTGGCATCGG - Intronic
1183689016 22:39377657-39377679 CAGCACACTGTTCCCTGCCTCGG + Intronic
1183932964 22:41246561-41246583 CAGCTCACTGGTCCAGGCCAAGG + Exonic
1184154638 22:42659268-42659290 CATCTCACTGTGCTTGGTGTTGG + Intergenic
1184503563 22:44888184-44888206 CAGCTGCCTGGGCCTGGCCCTGG - Intronic
1184723946 22:46332214-46332236 CAGATCACTCTGTCTGGCCTGGG - Intronic
1185169217 22:49282718-49282740 CAGGTCCCTGTGCCTGGACCCGG + Intergenic
1185233787 22:49699590-49699612 CACCCCGCTGAGCCTGGCCTGGG - Intergenic
1185415776 22:50709379-50709401 CAGCTCCCCGTGACTGACCTTGG - Intergenic
1203230894 22_KI270731v1_random:109047-109069 CACCCCAGTGTGCCTGGCATGGG + Intergenic
1203277282 22_KI270734v1_random:97296-97318 CACCCCAGTGTGCCTGGCATGGG + Intergenic
950131736 3:10552055-10552077 AACCTCACTGTGCCTATCCTGGG + Intronic
950142191 3:10623025-10623047 CTGAGCACTCTGCCTGGCCTTGG + Intronic
950357306 3:12422594-12422616 TAAGCCACTGTGCCTGGCCTTGG - Intronic
951584156 3:24198081-24198103 CAGGTGGCTTTGCCTGGCCTGGG + Intronic
952137694 3:30441774-30441796 CAGGTATCTGTGCCTTGCCTAGG + Intergenic
953941625 3:47104256-47104278 TAAACCACTGTGCCTGGCCTTGG - Intronic
954374706 3:50188119-50188141 CAGCTGCCTGTGCCTGCCATGGG + Exonic
954483359 3:50822775-50822797 TGGGCCACTGTGCCTGGCCTTGG + Intronic
955732288 3:61999328-61999350 CAAGCCACCGTGCCTGGCCTGGG + Intronic
956489164 3:69753095-69753117 CAGAGCCCTGTGCCTGGCCCAGG - Intronic
956708409 3:72019354-72019376 CATCTAACTGTACCAGGCCTGGG + Intergenic
956878701 3:73489100-73489122 CAGTGCACTGTGCCTTGGCTGGG - Intronic
959389804 3:105759680-105759702 CTGCTCACAGTGCCTGCTCTGGG - Intronic
960551303 3:118978536-118978558 GAGCTGACTGTGCCTGCCCTTGG - Intronic
961617042 3:128190900-128190922 CAGCTCACTGTGCCTCGCCTGGG + Intronic
961617093 3:128191426-128191448 CAGCTCACTGTGCCTGGCCTGGG + Intronic
961673343 3:128550190-128550212 CATCCCACAGTGACTGGCCTAGG + Intergenic
962685897 3:137847480-137847502 CAGCAGGCTGTGCCTGCCCTGGG + Intergenic
963107294 3:141658307-141658329 CCCCTCACTGTCCCTGTCCTCGG + Intergenic
966321727 3:178708353-178708375 TAGCTCTCTGTGCCTGGCATTGG + Intronic
967805926 3:193714734-193714756 CAGGTCCCTGTGCCTGGCCCAGG - Intergenic
968585252 4:1413361-1413383 CGGCTCAGTGTGTCTGCCCTTGG - Intergenic
968683762 4:1941472-1941494 GAGCTCAGTCTCCCTGGCCTAGG + Intronic
968917965 4:3505482-3505504 CAGCTGCCTGTGCCTGGCAGGGG + Intergenic
968955509 4:3716860-3716882 CAACTCACAGGGCCTGGCCCAGG - Intergenic
969858585 4:10018941-10018963 CAGCGCCCTCTGCCGGGCCTTGG + Intronic
970151898 4:13098667-13098689 CAGCTCACTTTGGCTTTCCTTGG - Intergenic
970400239 4:15710249-15710271 CAGGCCACAGTACCTGGCCTTGG + Intronic
971508411 4:27392374-27392396 GAACCCACTGTACCTGGCCTTGG + Intergenic
971926873 4:33022594-33022616 TGGGCCACTGTGCCTGGCCTAGG + Intergenic
972530519 4:39957506-39957528 CAGGCCACTGTGCCTGGCCCAGG - Intronic
973573126 4:52260674-52260696 CTGTTCACTTGGCCTGGCCTGGG + Intergenic
975577542 4:75877531-75877553 CGGTTCACTGTTCCTGGCCTGGG + Intronic
978959752 4:114662344-114662366 CAGCTCACTGTCACTGTCCCAGG + Intronic
980762490 4:137254014-137254036 CAGCTCACTGTTGATGACCTAGG + Intergenic
981698576 4:147583474-147583496 TGAGTCACTGTGCCTGGCCTTGG - Intergenic
983522918 4:168729445-168729467 TAAGCCACTGTGCCTGGCCTGGG + Intronic
984418155 4:179486879-179486901 CAGCTCACCGTGCAATGCCTGGG + Intergenic
984673026 4:182513882-182513904 GAGCTCTCTGTACCTGGCCCTGG - Intronic
985491664 5:183300-183322 AAACTCACAGTGCCTGACCTCGG + Exonic
985602376 5:841957-841979 CAGCTCCATGTGCCTGGGCCGGG + Intronic
986299516 5:6466958-6466980 CTGCTCACTGTTCTGGGCCTGGG + Intronic
986410536 5:7474907-7474929 CTGCCCATTGTGGCTGGCCTGGG - Intronic
986523887 5:8651627-8651649 TGGGTCACTGTGCCTGGGCTAGG + Intergenic
986997578 5:13624917-13624939 CAGCTGACTTTGCATGCCCTTGG + Intergenic
987078477 5:14405363-14405385 CAGCCCCCTGTGCCTAGCCGAGG - Intronic
987291466 5:16512302-16512324 CAGGTCACTATGCCTTGGCTGGG + Intronic
987326076 5:16812544-16812566 CAGCTCACAGCACATGGCCTTGG - Intronic
988037888 5:25851603-25851625 CAGCTCAGTGTGACAGCCCTCGG + Intergenic
988899115 5:35712376-35712398 CATGTCACTGTACCTGGCTTTGG + Intronic
988968713 5:36445003-36445025 CAGCTAACTCTGCCTGTCATGGG - Intergenic
989637227 5:43549215-43549237 CAGGCCACTGCGCCTGGCCCAGG + Intronic
990145433 5:52754654-52754676 CTGCTCACTCTTCCTGGTCTAGG - Intergenic
990280503 5:54245869-54245891 CGAGCCACTGTGCCTGGCCTAGG + Intronic
991939737 5:71838969-71838991 CAGCTCTCTGTGCCTAGACTTGG - Intergenic
993352367 5:86866242-86866264 CAGCTCACTTTGACTGGCATTGG - Intergenic
993781098 5:92066321-92066343 CAGATCCCTGGGCCTAGCCTCGG - Intergenic
994165328 5:96602322-96602344 CTGGTCACTGTGCCAGGCCCTGG + Intronic
995569329 5:113462814-113462836 CAGGTTACTGTGCTAGGCCTGGG + Intronic
995624133 5:114058150-114058172 TAGCTCAAGGTGCCAGGCCTTGG - Intergenic
995770319 5:115662815-115662837 CAAGCCACTGTGCCTGGCCCTGG + Intergenic
997249252 5:132376282-132376304 CAACTCTCTGGGCCTGGCTTTGG - Intronic
997630896 5:135368328-135368350 CAGCTCCTTGAGCCTGTCCTGGG + Intronic
998289723 5:140902319-140902341 TAACTCACTTCGCCTGGCCTAGG + Intronic
999340475 5:150765869-150765891 CATCTCACTGTGCCTTACCTAGG + Intergenic
999514528 5:152287688-152287710 AAGCTCACCCTGCCTGGCCTTGG - Intergenic
1000674778 5:164106976-164106998 CAGCATCCTGTGCTTGGCCTTGG + Intergenic
1001284603 5:170413310-170413332 AAACTCATCGTGCCTGGCCTTGG + Intronic
1001311775 5:170616309-170616331 CACCTCAGTGTGCCTGGCCCAGG - Intronic
1001563044 5:172682667-172682689 CAGAGCACAGTGCCTGGCCCTGG - Intronic
1002135566 5:177105616-177105638 CACCTGACTGTGCCTGGACCTGG - Intergenic
1002439621 5:179257524-179257546 CAGCTCTGTCTGCCTGGGCTGGG + Intronic
1002581853 5:180213419-180213441 CAACCCACTGAGCCTGGGCTGGG + Intergenic
1003229704 6:4241035-4241057 CAGCTCAATCTGGATGGCCTTGG - Intergenic
1005827339 6:29641975-29641997 CAGCTCCCTCTGCCTGGGCGTGG + Intergenic
1005995756 6:30930448-30930470 AAGGTCACGGTGCCTGGCCGAGG - Intergenic
1006405231 6:33841231-33841253 CCCCTCACTGTGCCTGCCCCAGG - Intergenic
1006440979 6:34053466-34053488 AGGCTCACAGCGCCTGGCCTGGG + Intronic
1006628508 6:35414552-35414574 CAGCTCACAGTGACAGACCTGGG - Intronic
1006747245 6:36351908-36351930 CATCCCACTTTGCCAGGCCTAGG + Intergenic
1006929572 6:37679651-37679673 CAGCTTCCTGAGCCAGGCCTCGG + Intronic
1007266357 6:40599272-40599294 CAGCTGTCTGTTTCTGGCCTAGG - Intergenic
1007286327 6:40750269-40750291 CAGCTCATTGTGCCAGGGGTGGG - Intergenic
1007373851 6:41443372-41443394 CAGCGCACTGTGCTTGGCCGCGG + Intergenic
1007406289 6:41637970-41637992 CAGATCCCTGTCCCTGGCTTAGG + Intronic
1009810086 6:68651168-68651190 CAGTTCTCTTTGGCTGGCCTTGG + Intronic
1010399456 6:75431682-75431704 CAGCTGGCTGTGCCTGGTGTGGG - Intronic
1013493461 6:110673877-110673899 TAAACCACTGTGCCTGGCCTAGG + Intronic
1013612911 6:111811864-111811886 CAGCTCCCTCTGCTTGTCCTTGG - Intronic
1015846791 6:137528720-137528742 CCACTCACTGTGCCTTGCCCTGG + Intergenic
1016880876 6:148910996-148911018 CAGTTCACTAGGCCTGGTCTTGG + Intronic
1017625177 6:156340730-156340752 CAGCTAGCTGTCCCTGGACTTGG - Intergenic
1019329458 7:455469-455491 CTCCTCCCTGTGCCAGGCCTGGG + Intergenic
1019811505 7:3168536-3168558 CAGCTCCCTGTGCCAGAGCTTGG - Intronic
1020044465 7:5030921-5030943 CAGATCACTGGGGCTGCCCTTGG - Intronic
1020130976 7:5558402-5558424 CACGCCACTGTGCCTTGCCTTGG - Intronic
1020174498 7:5871468-5871490 CATCTCACCCTGCCTGACCTGGG + Intergenic
1020730088 7:11869420-11869442 CAGCCCCCTGGGCCTGGCCCAGG - Intergenic
1021869302 7:24987776-24987798 CTGCTCACTGGGCCTGGAATGGG - Intergenic
1022521511 7:31010779-31010801 AAGCCCACTGTGCCTGGACAGGG + Intergenic
1023825882 7:44008433-44008455 CAGATCACTGGGGCTGACCTTGG + Intronic
1023956889 7:44893735-44893757 CAGCACGGGGTGCCTGGCCTGGG - Intergenic
1024087480 7:45907428-45907450 CAGCTCCCTTTGCCCTGCCTCGG - Intergenic
1024252874 7:47519667-47519689 CAGCTCACTGTGGCTAGCATGGG - Intronic
1024541550 7:50479261-50479283 CTGCTCTCTGTGCCTGGCGCTGG - Intronic
1024586842 7:50849531-50849553 CTGCTCCCTGTGCATGTCCTTGG + Intergenic
1025813732 7:64891003-64891025 CAGATGGCTGTGCTTGGCCTGGG + Intronic
1025908074 7:65804444-65804466 CAAGCCACTGTGCCTGGCCAAGG + Intergenic
1026089454 7:67287284-67287306 CAGATCACTGGGGCTGACCTTGG + Intergenic
1026746957 7:73021412-73021434 CAGATCACTGGGGCTGACCTTGG - Intergenic
1026750609 7:73049555-73049577 CAGATCACTGGGGCTGACCTTGG - Intergenic
1026754256 7:73077665-73077687 CAGATCACTGGGGCTGACCTTGG - Intergenic
1026757908 7:73105698-73105720 CAGATCACTGGGGCTGACCTTGG - Intergenic
1026833386 7:73623375-73623397 CAGGGCACTGGGCCAGGCCTCGG + Intronic
1027033062 7:74905983-74906005 CAGATCACTGGGGCTGACCTTGG - Intergenic
1027089495 7:75287786-75287808 CAGATCACTGGGGCTGACCTTGG + Intergenic
1027093140 7:75315714-75315736 CAGATCACTGGGGCTGACCTTGG + Intergenic
1027096783 7:75343681-75343703 CAGATCACTGGGGCTGACCTTGG + Intergenic
1027119049 7:75502602-75502624 CAGATCACTGGGGCTGACCTTGG + Intergenic
1027272777 7:76533006-76533028 CAGATCACTGGGGCTGACCTTGG - Intergenic
1027322564 7:77023999-77024021 CAGATCACTGGGGCTGACCTTGG - Intergenic
1027326226 7:77052091-77052113 CAGATCACTGGGGCTGACCTTGG - Intergenic
1027444020 7:78251857-78251879 TGAGTCACTGTGCCTGGCCTAGG - Intronic
1028787650 7:94814062-94814084 TGAGTCACTGTGCCTGGCCTAGG + Intergenic
1029397893 7:100320657-100320679 CAGATCACTGGGGCTGACCTTGG + Intronic
1029494432 7:100889522-100889544 GAGGACGCTGTGCCTGGCCTGGG - Exonic
1029718448 7:102347415-102347437 CAGATCACTGGGGCTGACCTTGG - Intergenic
1029754167 7:102561840-102561862 CAGATCACTGGGGCTGACCTTGG + Intronic
1029772117 7:102660930-102660952 CAGATCACTGGGGCTGACCTTGG + Intronic
1029852332 7:103476033-103476055 ATGGCCACTGTGCCTGGCCTGGG + Intronic
1031990912 7:128198244-128198266 CAGCTCCCTGGGCCACGCCTAGG + Intergenic
1035044060 7:155952612-155952634 CTGCTAACGGTGCCTGCCCTGGG + Intergenic
1035344470 7:158188979-158189001 CAGTACACTGTGCTCGGCCTAGG + Intronic
1037360471 8:18068714-18068736 CAGCTCAGGATGCCCGGCCTGGG - Intronic
1037600167 8:20387201-20387223 CAGCTCACTGGGTCTTGCTTTGG + Intergenic
1037726916 8:21490548-21490570 CACTTCACTCTTCCTGGCCTGGG + Intergenic
1038324213 8:26560183-26560205 CAGCTCACTCTGCCTGAACCTGG + Intronic
1039187642 8:34934850-34934872 CAGATGACTCTGCCTGCCCTTGG + Intergenic
1039809875 8:41037168-41037190 GAGCCCACTGTGCCCAGCCTTGG + Intergenic
1041273287 8:56130978-56131000 CAGCTCACAGTGCCTGCCTTTGG - Intergenic
1041520710 8:58752867-58752889 CAGCACACTGTGCCTGGGCTAGG - Intergenic
1045724936 8:105161096-105161118 CAGGCCACTGTCCATGGCCTAGG - Intronic
1047222134 8:122927209-122927231 TGAGTCACTGTGCCTGGCCTGGG - Intronic
1047760003 8:127947493-127947515 AGGCTCAGTGTGCCTGGCATTGG - Intergenic
1048256123 8:132906537-132906559 AAGCTCTCAGGGCCTGGCCTGGG - Intronic
1048326912 8:133446937-133446959 CAGCACACTCTTCCTGGCCATGG - Intergenic
1050102853 9:2136596-2136618 CAACACACTGTGATTGGCCTGGG + Intronic
1051356992 9:16248469-16248491 CAGCTCATTGTGACTGGCTATGG + Intronic
1051649008 9:19301651-19301673 TGCCACACTGTGCCTGGCCTGGG - Intronic
1052551964 9:29963448-29963470 CACCTATCTGTGCTTGGCCTAGG + Intergenic
1053486617 9:38461944-38461966 GGGCTCTCTGTGCCAGGCCTAGG - Intergenic
1053528576 9:38854684-38854706 CCACTCACTGTGCCAGTCCTGGG + Intergenic
1054200803 9:62079117-62079139 CCACTCACTGTGCCAGTCCTGGG + Intergenic
1054637556 9:67509246-67509268 CCACTCACTGTGCCAGTCCTGGG - Intergenic
1055106360 9:72517116-72517138 TGAGTCACTGTGCCTGGCCTAGG + Intergenic
1056760559 9:89411751-89411773 CAGCTCACTCTTCCCGTCCTTGG - Intronic
1057592140 9:96381832-96381854 AAGATCACTGTGCCTGGGCGGGG - Intronic
1057960512 9:99451548-99451570 GAGCTATCTGTGCCTGCCCTTGG - Intergenic
1058461382 9:105187110-105187132 TGGACCACTGTGCCTGGCCTTGG + Intergenic
1059337859 9:113580439-113580461 CTCCTCACAGTGCCTGGCCCTGG - Intronic
1060526093 9:124322132-124322154 CAGGTCTCTTTTCCTGGCCTGGG + Intronic
1061357684 9:130118869-130118891 CAGCTGGGTGTGCCTGCCCTTGG - Intronic
1062012293 9:134273652-134273674 CATCTCTGTGTGCCAGGCCTGGG - Intergenic
1062334318 9:136058333-136058355 CGGCTCCCAGTGCCTGGCCCAGG + Intronic
1062423427 9:136494990-136495012 CAGCTCAATGTGCCCGGCTCTGG + Exonic
1062537362 9:137026900-137026922 CAGCTCCAGGTGCCTGGCCAGGG + Intronic
1062687309 9:137820790-137820812 CTGCTGACTGTTCTTGGCCTGGG + Intronic
1187908300 X:24087545-24087567 CATCTCACTCTGTCTTGCCTAGG - Intergenic
1189478470 X:41375167-41375189 CAGCACAGTCAGCCTGGCCTGGG + Intergenic
1190311826 X:49122390-49122412 CAGCTCACTGTCTCTGCCCGGGG + Exonic
1194399295 X:93422931-93422953 CAATTCACTGTGAATGGCCTTGG + Intergenic
1194903372 X:99542907-99542929 CAGGTCCCTGGGCCTAGCCTGGG - Intergenic
1198183202 X:134230101-134230123 CACCTCAATGTGCCTGGAATTGG - Intergenic
1198338674 X:135692826-135692848 CACCTCACTGAGCCTGACCTAGG - Intergenic
1198520305 X:137445731-137445753 CAGCACACAGTGCCAGGTCTGGG + Intergenic
1200684492 Y:6246548-6246570 CAGCAGGCTGTGCCTGGCCCTGG + Exonic
1200990021 Y:9337807-9337829 CAGCAGGCTGTGCCTGGCCCTGG + Exonic
1200992683 Y:9358122-9358144 CAGCAGGCTGTGCCTGGCCCTGG + Exonic
1200995337 Y:9378401-9378423 CAGCAGGCTGTGCCTGGCCCTGG + Intronic
1200998001 Y:9398746-9398768 CAGCAGGCTGTGCCTGGCCCTGG + Exonic
1201000510 Y:9467280-9467302 CAGCAGGCTGTGCCTGGCCCTGG + Exonic
1201003178 Y:9487610-9487632 CAGCAGGCTGTGCCTGGCCCTGG + Exonic
1201005835 Y:9507892-9507914 CAGCAGGCTGTGCCTGGCCCTGG + Intergenic
1201008491 Y:9528205-9528227 CAGCAGGCTGTGCCTGGCCCTGG + Exonic
1201901646 Y:19049867-19049889 CACCTCTTTGTGCCTGGCGTGGG + Intergenic
1202381519 Y:24279095-24279117 CAGTTCCCTGAGCCTGTCCTTGG + Intergenic
1202489266 Y:25391031-25391053 CAGTTCCCTGAGCCTGTCCTTGG - Intergenic