ID: 961618543

View in Genome Browser
Species Human (GRCh38)
Location 3:128204730-128204752
Sequence CAGCACACTTACCATGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961618543 Original CRISPR CAGCACACTTACCATGCCCT GGG (reversed) Intronic
901059519 1:6465662-6465684 CAGCCCACTTCCCAGGCCCCGGG + Intronic
901765830 1:11499466-11499488 CAGAGCAGTTACCATCCCCTCGG + Intronic
904612452 1:31732917-31732939 CACCACACCTGCCAGGCCCTTGG - Intronic
906730985 1:48080898-48080920 CAGCAGGCTTCCCAGGCCCTTGG - Intergenic
907706649 1:56838393-56838415 CAGTACGCTTACCTTGCACTTGG + Intergenic
912493596 1:110076896-110076918 CAGAACACTTACCATGTGCCAGG + Intergenic
914196315 1:145449821-145449843 CTCCACACTTCCCATTCCCTGGG + Intergenic
916246184 1:162690476-162690498 CAGCATACCTACCATGTGCTAGG + Intronic
916675436 1:167061363-167061385 CAGCACACCTACCATGACCATGG + Intronic
918439093 1:184547875-184547897 CAGCACATTTCTGATGCCCTGGG - Intronic
918656785 1:187036799-187036821 CCTCACCCTTACCATGCACTAGG + Intergenic
919830227 1:201535731-201535753 CTGAATACTCACCATGCCCTTGG + Intergenic
920089479 1:203441980-203442002 CTGCTCACTTTCCCTGCCCTCGG - Intergenic
921947424 1:220895627-220895649 CAGCGCAATTATCACGCCCTGGG - Intergenic
922551277 1:226496446-226496468 CTGCACATTTGCCGTGCCCTTGG + Intergenic
923476051 1:234332303-234332325 CAGGAGACTGACTATGCCCTAGG - Intergenic
923711292 1:236389325-236389347 AAACACACTTAGAATGCCCTGGG - Intronic
923936078 1:238762051-238762073 CAGCTCACTTACCCTGCACCTGG - Intergenic
1065274659 10:24073819-24073841 CAGCACACAGACACTGCCCTAGG + Intronic
1067180793 10:43984545-43984567 CATCACACTTCCCATGCACTAGG - Intergenic
1071370101 10:84942465-84942487 CACCACACTCACCATTCTCTTGG - Intergenic
1072660291 10:97359810-97359832 CAGCTCACCTACTGTGCCCTGGG - Intronic
1074738306 10:116459302-116459324 CAGCACACTTAGCTTGTCATAGG - Intronic
1076368222 10:129935805-129935827 CAGCCCACATTCTATGCCCTTGG - Intronic
1081083266 11:38769024-38769046 CAGCACACTGACCCTGAACTGGG + Intergenic
1082896257 11:58193359-58193381 GTGCACACTTACCATATCCTAGG + Intergenic
1084955143 11:72687210-72687232 CAGGACACAGACCCTGCCCTTGG - Intronic
1087412306 11:97807798-97807820 CAGCATTCTGTCCATGCCCTTGG + Intergenic
1089334559 11:117714160-117714182 CAGCACACTTACTATGCCCCAGG - Intronic
1090927352 11:131260390-131260412 CAACACACTTGCCACGACCTAGG + Intergenic
1093663614 12:21786239-21786261 CAGCACAATTCCTATGTCCTTGG - Intergenic
1094065659 12:26358452-26358474 CAGCACACTTTTCATGCTCAAGG - Intronic
1098183887 12:67876628-67876650 CACAACATTTACCATGACCTGGG - Intergenic
1099000291 12:77171082-77171104 CTGCACATTTCCCATGCCCTGGG + Intergenic
1100840011 12:98603411-98603433 CATCACTTTTACCATGCTCTTGG + Intronic
1100977937 12:100142220-100142242 CAGCACATTAACCAGGCACTTGG + Intronic
1104874934 12:132027110-132027132 CAGCACACCTCCGAGGCCCTGGG - Intronic
1108359978 13:49660050-49660072 CAGCACATAGACCAGGCCCTTGG - Intergenic
1108828188 13:54441591-54441613 TAGCACACTTACCAGGTTCTAGG + Intergenic
1110936313 13:81294100-81294122 CAACACATATACCATGCACTCGG - Intergenic
1112439741 13:99417013-99417035 AAGCACCTTTCCCATGCCCTGGG + Intergenic
1112665495 13:101567694-101567716 AGTCACACTTACCATGGCCTGGG - Exonic
1113235513 13:108268678-108268700 CTGAGCACTTACCAAGCCCTGGG - Intronic
1113443878 13:110350815-110350837 CAGCACACTTGCCATGGCGGGGG + Intronic
1113745472 13:112741496-112741518 CAGCACCATTACCCTGGCCTGGG + Intronic
1121828475 14:97029670-97029692 CAAAACAATTACCATGGCCTTGG - Intergenic
1126713905 15:51492212-51492234 CACCACACTTTCCTTCCCCTGGG - Intronic
1127992306 15:64129337-64129359 CAGCGTCCTTTCCATGCCCTAGG + Intronic
1128271541 15:66314672-66314694 CAGCCCACTGACCAATCCCTTGG + Intronic
1128368979 15:67025502-67025524 CAGACCACTTACCAGGCACTAGG - Intergenic
1129328788 15:74816301-74816323 GAGGACACTCACCATGCCCTGGG - Exonic
1129764916 15:78158333-78158355 TAGCACACTGAACATGTCCTAGG - Intronic
1131265659 15:90913713-90913735 CTGCACACTGCCCAGGCCCTGGG + Exonic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1134212208 16:12287188-12287210 CAGCACACTACACAGGCCCTGGG + Intronic
1135091667 16:19522589-19522611 CAGAGCACTTACCATGTCCCAGG + Intergenic
1136177595 16:28528579-28528601 CAGCACACTTAGTTTGCTCTTGG + Intergenic
1139421983 16:66854692-66854714 CTGCACACTTGCCCTTCCCTTGG - Intronic
1141148300 16:81547287-81547309 CTGCACACACCCCATGCCCTCGG - Intronic
1141148761 16:81550120-81550142 GAGCACCCTGCCCATGCCCTCGG + Intronic
1141647183 16:85373796-85373818 GAGCACAATCACCCTGCCCTGGG - Intergenic
1141721764 16:85759870-85759892 GATCACACTGCCCATGCCCTCGG - Intergenic
1144537788 17:16107744-16107766 CAGCACTCTTACCCTACCCTCGG + Intronic
1145788551 17:27609918-27609940 CAGAACACTGACCCTGCACTTGG - Intronic
1147436560 17:40420130-40420152 CAGAAGACTGACCAGGCCCTGGG + Intergenic
1152430152 17:80244318-80244340 CAGCATACTGGCCATGACCTTGG + Intronic
1153981116 18:10311515-10311537 CTGAACACTCACCATGTCCTTGG + Intergenic
1155902590 18:31409581-31409603 CAGTCCACTTACCCTGTCCTCGG - Exonic
1168604114 19:57744462-57744484 CAAGACATTTACCATGACCTGGG - Intronic
925121386 2:1421321-1421343 GAGCACACTTGCGAGGCCCTCGG + Intronic
929533934 2:42768806-42768828 CAGCAGACCTACCAGGACCTGGG + Intronic
930007016 2:46906102-46906124 CAGCCCACTAACCCTGCTCTTGG - Intronic
930177672 2:48316088-48316110 CAGCACAGTTACAAAGCCCCTGG - Intronic
938071816 2:128312404-128312426 CTGCACACTTAGCAGGCACTTGG - Intronic
941738279 2:169004937-169004959 CAGCAAAGTTACCAGGCTCTGGG + Intronic
941758209 2:169211668-169211690 CAGCACCGTCAGCATGCCCTGGG + Intronic
945504456 2:210621125-210621147 CAGCTTCCCTACCATGCCCTTGG - Intronic
945814295 2:214585209-214585231 CTGCACACTTAACATGCACTTGG + Intergenic
1169069747 20:2717245-2717267 CAGTACACTTACCAGGTTCTAGG + Intronic
1169449396 20:5698626-5698648 CAGCACACTTACTATGTACCAGG + Intergenic
1172608494 20:36231762-36231784 CAGCACACTTTCCATACACCAGG + Exonic
1174038224 20:47681177-47681199 CAGCAGTCTTACAATGCCATTGG - Intronic
1174252622 20:49230900-49230922 CTGCAACCTTAGCATGCCCTGGG - Intronic
1174452496 20:50628862-50628884 CAGCTCACTAACCTTTCCCTGGG - Intronic
1177963991 21:27704191-27704213 CAGAGGACTTACTATGCCCTAGG + Intergenic
1178083070 21:29085733-29085755 CAACATACTAACCATGCCGTTGG - Intronic
1180165021 21:46020940-46020962 CATCGTACTTACCACGCCCTTGG - Intergenic
1180655582 22:17418171-17418193 CACCACACATACCCTGCCCCAGG + Intronic
1180861895 22:19088153-19088175 CAGCACACCTTTCATGTCCTAGG + Intronic
1181161629 22:20963256-20963278 CAGCACTTTTAGCCTGCCCTTGG + Intergenic
1183384923 22:37509252-37509274 CAGGACACTAAGCAAGCCCTAGG + Intronic
951690037 3:25385769-25385791 CAGAACACTTTTCAAGCCCTTGG - Intronic
955072116 3:55580575-55580597 TATCACACTTACCAAGCCCTTGG - Intronic
956065675 3:65395064-65395086 CAGCACACTTAGGAGGGCCTGGG - Intronic
956718955 3:72101355-72101377 CATAGCACTTACCCTGCCCTAGG - Intergenic
958671020 3:97204309-97204331 CAGAGCACTTACCATGTACTAGG + Intronic
961372235 3:126438533-126438555 CAGGACACTGACCAGGCCCGTGG + Intronic
961618543 3:128204730-128204752 CAGCACACTTACCATGCCCTGGG - Intronic
967670499 3:192228572-192228594 TATCACAATCACCATGCCCTCGG + Intronic
967989590 3:195121111-195121133 CAGCACACCGGCCATGCCCTTGG + Intronic
970291877 4:14581867-14581889 AATCACACTCACCAAGCCCTTGG - Intergenic
973962177 4:56122458-56122480 CAGCATACTTCCACTGCCCTGGG + Intergenic
974786347 4:66623458-66623480 TAGCACACTTTCACTGCCCTAGG + Intergenic
979556674 4:122055821-122055843 CACCACACTTACCATTTCATGGG - Intergenic
981623963 4:146735708-146735730 CACAACATTTACCATGACCTGGG - Intronic
986997578 5:13624917-13624939 CAGCTGACTTTGCATGCCCTTGG + Intergenic
993421208 5:87702852-87702874 CAGCACACTCAGCATGCCTGGGG - Intergenic
997600483 5:135135190-135135212 CACCACACGTCCCATGCCCCAGG + Intronic
998018523 5:138751914-138751936 CAGCACATTGCCCATCCCCTAGG - Intronic
1006094582 6:31647852-31647874 CAGCAGTCTTACCCTGCCTTTGG - Intronic
1007030134 6:38619636-38619658 CATCACACTTACTGAGCCCTGGG + Intronic
1008891737 6:56501134-56501156 CTGCTCACTTAGCAAGCCCTCGG + Exonic
1009881867 6:69578123-69578145 CAGCACACTTACAATGAACTAGG + Intergenic
1010418814 6:75647791-75647813 CTGCACACTTACCAACACCTTGG - Exonic
1013182707 6:107731658-107731680 CAGGACACTGACCATTGCCTGGG - Intronic
1015312742 6:131783074-131783096 CTGCCCACTTATCTTGCCCTGGG - Intergenic
1016319524 6:142827626-142827648 GAGCACACTTGCCACACCCTTGG - Intronic
1019255164 7:45024-45046 TAGCACATACACCATGCCCTGGG - Intergenic
1019526987 7:1484920-1484942 CAGCACAGAGACCCTGCCCTGGG - Intronic
1021049381 7:15963940-15963962 CAGGACATTTACTATGCCCTAGG + Intergenic
1025196996 7:56941242-56941264 CAGCATACTCATCATGGCCTGGG - Intergenic
1025674952 7:63635695-63635717 CAGCATACTCATCATGGCCTGGG + Intergenic
1025978443 7:66388118-66388140 CTCCCCACTTACCTTGCCCTGGG + Intronic
1027956307 7:84882964-84882986 CAGCATTCTTCCAATGCCCTGGG + Intergenic
1028464511 7:91135312-91135334 TAGCACAATTACCATACCTTAGG + Intronic
1030209214 7:106979891-106979913 CATCACCCTTACCGTGTCCTTGG + Intergenic
1033436700 7:141339327-141339349 CAGCACACTGCCCATTCTCTGGG - Intronic
1034685530 7:152967624-152967646 CATAGCACTTACCATGACCTGGG + Intergenic
1035221300 7:157407972-157407994 CAGCACACAGGCCATGCCCGCGG - Intronic
1035692633 8:1570238-1570260 CAGCACAGTTAACATGACCCTGG - Intronic
1036749407 8:11434476-11434498 CAGCAAACTCACCATTCCCCAGG - Intronic
1037984953 8:23284703-23284725 CAGCACACTCTCCTTGCCGTGGG - Intronic
1041062931 8:54053531-54053553 CATCACTCTGACCATGCCCATGG + Intronic
1045162270 8:99561636-99561658 CAGAACACTTACATTGGCCTTGG - Intronic
1049045512 8:140148137-140148159 CTGCACACTTCCCTAGCCCTGGG - Intronic
1052836718 9:33255489-33255511 CAGCATTCTGACCATGCTCTAGG + Intronic
1057266009 9:93618294-93618316 CACCACACTCACCTTGCCCCTGG - Intronic
1058749253 9:108023012-108023034 AAGCTAACTTACCATGTCCTGGG + Intergenic
1059391711 9:114003271-114003293 CTGCTCACTTACCAGGCGCTTGG - Intronic
1059628733 9:116096438-116096460 CTGCACACCTGCCAAGCCCTTGG + Intergenic
1062698418 9:137887014-137887036 CTCCACACTTCCCATTCCCTGGG - Intronic
1187968942 X:24640330-24640352 CATGAAACTTACCCTGCCCTTGG + Intronic
1192338126 X:70238874-70238896 CAAAACACTTACCATGTCCCTGG + Intronic
1193312699 X:80026149-80026171 CATCACACATACCATACACTGGG - Intronic
1193969959 X:88039088-88039110 CACCACACTCTCCATTCCCTGGG - Intergenic
1194165422 X:90508513-90508535 CAGCAGGCCTACCAGGCCCTGGG - Intergenic
1194950771 X:100122949-100122971 CATGACACTTACCATGCTCCAGG + Intergenic
1198179472 X:134192083-134192105 CAGGACACTCACCATTCACTAGG - Intergenic
1200289276 X:154856403-154856425 AACCACACTTACCTTGCCTTTGG - Intronic
1200511690 Y:4086323-4086345 CAGCAGGCCTACCAGGCCCTGGG - Intergenic
1201418158 Y:13769085-13769107 CAACACATTTACCATGCCAAAGG - Intergenic