ID: 961618620

View in Genome Browser
Species Human (GRCh38)
Location 3:128205347-128205369
Sequence CTGAGCAGTGCAGAGATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 470
Summary {0: 1, 1: 2, 2: 4, 3: 51, 4: 412}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961618614_961618620 -7 Left 961618614 3:128205331-128205353 CCCCTTTTCAGTGCCTCTGAGCA 0: 1
1: 0
2: 2
3: 33
4: 235
Right 961618620 3:128205347-128205369 CTGAGCAGTGCAGAGATGGAGGG 0: 1
1: 2
2: 4
3: 51
4: 412
961618616_961618620 -9 Left 961618616 3:128205333-128205355 CCTTTTCAGTGCCTCTGAGCAGT 0: 1
1: 0
2: 1
3: 12
4: 221
Right 961618620 3:128205347-128205369 CTGAGCAGTGCAGAGATGGAGGG 0: 1
1: 2
2: 4
3: 51
4: 412
961618615_961618620 -8 Left 961618615 3:128205332-128205354 CCCTTTTCAGTGCCTCTGAGCAG 0: 1
1: 0
2: 0
3: 22
4: 260
Right 961618620 3:128205347-128205369 CTGAGCAGTGCAGAGATGGAGGG 0: 1
1: 2
2: 4
3: 51
4: 412
961618611_961618620 24 Left 961618611 3:128205300-128205322 CCCAGTCTACTGAGGAGACAAAC 0: 1
1: 0
2: 1
3: 21
4: 251
Right 961618620 3:128205347-128205369 CTGAGCAGTGCAGAGATGGAGGG 0: 1
1: 2
2: 4
3: 51
4: 412
961618609_961618620 29 Left 961618609 3:128205295-128205317 CCCTGCCCAGTCTACTGAGGAGA 0: 1
1: 0
2: 0
3: 34
4: 277
Right 961618620 3:128205347-128205369 CTGAGCAGTGCAGAGATGGAGGG 0: 1
1: 2
2: 4
3: 51
4: 412
961618613_961618620 -6 Left 961618613 3:128205330-128205352 CCCCCTTTTCAGTGCCTCTGAGC 0: 1
1: 0
2: 2
3: 20
4: 203
Right 961618620 3:128205347-128205369 CTGAGCAGTGCAGAGATGGAGGG 0: 1
1: 2
2: 4
3: 51
4: 412
961618608_961618620 30 Left 961618608 3:128205294-128205316 CCCCTGCCCAGTCTACTGAGGAG 0: 1
1: 0
2: 2
3: 13
4: 233
Right 961618620 3:128205347-128205369 CTGAGCAGTGCAGAGATGGAGGG 0: 1
1: 2
2: 4
3: 51
4: 412
961618610_961618620 28 Left 961618610 3:128205296-128205318 CCTGCCCAGTCTACTGAGGAGAC 0: 1
1: 0
2: 0
3: 10
4: 183
Right 961618620 3:128205347-128205369 CTGAGCAGTGCAGAGATGGAGGG 0: 1
1: 2
2: 4
3: 51
4: 412
961618612_961618620 23 Left 961618612 3:128205301-128205323 CCAGTCTACTGAGGAGACAAACA 0: 1
1: 0
2: 1
3: 37
4: 393
Right 961618620 3:128205347-128205369 CTGAGCAGTGCAGAGATGGAGGG 0: 1
1: 2
2: 4
3: 51
4: 412

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961618620 Original CRISPR CTGAGCAGTGCAGAGATGGA GGG Intronic
900125360 1:1066773-1066795 CTGTGGTGAGCAGAGATGGAGGG - Intergenic
900484219 1:2913902-2913924 CTGAGCAGTGCAGGGATCCCAGG - Intergenic
900993273 1:6107516-6107538 TGGAGCGGTGGAGAGATGGAGGG + Intronic
901136704 1:7001761-7001783 CTGATCAGAGCAGAGAGGAACGG + Intronic
901827789 1:11873906-11873928 CTGAGCAGGGGAGGGAAGGATGG - Intergenic
902202588 1:14845001-14845023 ATGAGTAGTGGATAGATGGATGG + Intronic
902325852 1:15700198-15700220 CTGAGCAGGGCAGAGCAGCAGGG - Intronic
902415489 1:16236536-16236558 CTGAGGAGAGCAGAGAGGCAGGG - Intronic
902623505 1:17663944-17663966 TTGAGAACTGCTGAGATGGAAGG - Intronic
903027400 1:20439153-20439175 CAGTGCAGTGCAGAGCTGGTGGG - Intergenic
904378548 1:30096457-30096479 CTGAGCTGTGGAGGCATGGAGGG + Intergenic
904860553 1:33534467-33534489 CTGAGCAGAGCAGGGAGGGAGGG - Intronic
904987443 1:34563529-34563551 CAGAGCAGGGCAGCGAAGGATGG - Intergenic
905417474 1:37814081-37814103 CAGAGGGGGGCAGAGATGGAGGG + Exonic
905529643 1:38667435-38667457 GTGAAAAGTGCAGAGATAGAAGG - Intergenic
908879061 1:68710264-68710286 TAGAGCAGTGTAGAGAGGGAAGG + Intergenic
910085986 1:83403047-83403069 TTGATCATTGCAGAGGTGGAGGG + Intergenic
910168739 1:84355572-84355594 GTGAGCAGTTCAGGGATGGCAGG + Intronic
910896952 1:92079782-92079804 TTGAGCAGTGAAGTGATGGATGG - Intergenic
911304712 1:96219103-96219125 CTGAGAATTTCAGAGCTGGAAGG - Intergenic
911542021 1:99168136-99168158 GTGAGCAGTGGAGAAATGGAAGG + Intergenic
912361941 1:109102386-109102408 CTGAGCAATTCAGATATGAAAGG - Intergenic
912444166 1:109721790-109721812 ATGAGAAGGGCAGAGGTGGAGGG - Intronic
912823709 1:112886988-112887010 CTGACCAGTGCATAGAGAGATGG - Intergenic
913112169 1:115666463-115666485 CTGGTCAGGGCAGAGCTGGATGG + Intronic
913565245 1:120067384-120067406 CTCAGCAGAGCAGAGGTGGAGGG + Intronic
913632884 1:120726175-120726197 CTCAGCAGAGCAGAGGTGGAGGG - Intergenic
914285834 1:146226742-146226764 CTCAGCAGAGCAGAGGTGGAGGG + Intronic
914546866 1:148677495-148677517 CTCAGCAGAGCAGAGGTGGAGGG + Intronic
914619698 1:149393177-149393199 CTCAGCAGAGCAGAGGTGGAGGG - Intergenic
915350072 1:155218718-155218740 TTGAGCAAGGCACAGATGGAGGG - Intergenic
915353470 1:155240956-155240978 TTGAGCAAGGCACAGATGGAGGG - Intronic
915573421 1:156758897-156758919 GGCAGCAGTGCAGAGGTGGAAGG + Intronic
915687205 1:157645506-157645528 TTGTGCAGTGCAGAGCAGGAAGG + Intergenic
916057694 1:161079510-161079532 ATGGGGACTGCAGAGATGGATGG - Intronic
916339097 1:163708421-163708443 CTGAGCAGGGGAGAGAGAGAGGG - Intergenic
916717574 1:167458146-167458168 CTGAGCAGGGCACAGGTGGAAGG - Intronic
919775308 1:201190659-201190681 CAGAGGAGGTCAGAGATGGAAGG - Intergenic
919986904 1:202681781-202681803 CTGAGCAGTCAGGGGATGGAAGG + Intronic
920207699 1:204304809-204304831 CTGAGTAGGGCAGGTATGGAAGG + Intronic
920702019 1:208225114-208225136 TTCACCACTGCAGAGATGGAGGG - Intronic
920791448 1:209096815-209096837 CTGAGCAGTACTCAGATGGACGG - Intergenic
922748640 1:228060628-228060650 CTGAGCAGAGCAGAGACGGGCGG - Exonic
922959981 1:229637999-229638021 GTCAGCACTGCAGGGATGGAGGG + Exonic
923233569 1:232011071-232011093 GTGGGCAGGGCAGAGAAGGAGGG - Intronic
923483110 1:234403186-234403208 CAGAGCAGTCCCAAGATGGAGGG - Intronic
923610669 1:235490032-235490054 CTGAGCAGGCCACAGAAGGAAGG - Intronic
924224409 1:241908920-241908942 CACAGCAGTGCAGTGATGGAAGG - Intergenic
924478710 1:244406560-244406582 CTGGGCAGGACAGAGAAGGATGG - Intergenic
924514008 1:244751322-244751344 GTGAGCAGGGCAAAAATGGAGGG - Intergenic
1062768295 10:81572-81594 GGGAGCAGTGCAGTGACGGAGGG - Intergenic
1062768300 10:81610-81632 GGGAGCAGTGCAGTGACGGAGGG - Intergenic
1062768305 10:81648-81670 GGGAGCAGTGCAGTGACGGAGGG - Intergenic
1063375601 10:5552505-5552527 CTCAGCTGGGTAGAGATGGACGG - Intergenic
1064093765 10:12407460-12407482 CTCAGCAGAGCAGACAGGGATGG - Intronic
1065112818 10:22456700-22456722 CAGAGCAGTGCAGACGTGGAGGG - Intergenic
1065881852 10:30043847-30043869 CTGCTCAGTGCAGCAATGGAGGG - Intronic
1065968754 10:30789277-30789299 CTGAGCACAGCAGAGATGACAGG - Intergenic
1066395788 10:35020265-35020287 CTGAGAAGTGGGGAGGTGGAAGG + Intronic
1066509953 10:36084314-36084336 CTGAGGATTGCAGAGATCCATGG + Intergenic
1066650208 10:37647965-37647987 GTGGGCAGTACAGAAATGGAAGG + Intergenic
1067033137 10:42893756-42893778 GTGGGCAGTACAGAAATGGAAGG + Intergenic
1067715243 10:48685444-48685466 CTGAGGAGTGCAGAGTTGGAGGG + Intronic
1069649242 10:70032241-70032263 CAGAGCAATGCAGATAGGGATGG - Intergenic
1072560254 10:96566723-96566745 CTGAGCAGTGAAGCAACGGAGGG + Intronic
1072643252 10:97230467-97230489 CTAAGCTGTTCAGAGATGAAAGG - Intronic
1072794025 10:98340524-98340546 AAGAGCAGTGCAGAGAAGGGAGG + Intergenic
1073472551 10:103731851-103731873 CTGGGAAGTGCAGAGGGGGAGGG + Intronic
1073558778 10:104479754-104479776 CCCAGCAGGGCAGAGATAGACGG + Intergenic
1074939059 10:118217123-118217145 TGGAGCAGTGCAGAGATGCAGGG + Intergenic
1075361621 10:121841561-121841583 CTGAGTAGTATAGAAATGGAAGG - Intronic
1076433250 10:130422320-130422342 CTGGGCAGGCCAGAGATGAAGGG - Intergenic
1076507429 10:130987391-130987413 CAGAGCAGTGCTGGGATTGATGG - Intergenic
1076823253 10:132952560-132952582 CTGAGGTGTGCAGAGAGAGAGGG + Intergenic
1077232469 11:1464090-1464112 CTGAGCAGTGGGGAGCTGGCAGG - Intergenic
1078540133 11:12206610-12206632 CTGAGCAGTGCTGAGTATGATGG - Intronic
1078559836 11:12361840-12361862 CTCAGCAGGGCAGAGGTGGCAGG + Intergenic
1078650959 11:13191661-13191683 CAGGGCAGTGCAGAGAAGAAAGG - Intergenic
1078827817 11:14947983-14948005 AGGAGCAGTGGAGAGAAGGATGG - Intronic
1079051161 11:17160973-17160995 GTGAGCAGTTCACACATGGATGG + Intronic
1079478069 11:20852002-20852024 CTCAGCAGCTAAGAGATGGATGG + Intronic
1080673796 11:34405792-34405814 AAGAGAAGTGGAGAGATGGAAGG - Intergenic
1081562928 11:44235663-44235685 ATAAACAGTGAAGAGATGGAAGG - Intronic
1082768385 11:57186575-57186597 CTGAGCTGTGCAGAGATCGAGGG + Intronic
1083261857 11:61527525-61527547 CTGAGGAGGGCAGGGAGGGAGGG - Intronic
1084031330 11:66482369-66482391 CTGAGCAGAGCATAGATGTAGGG - Exonic
1084765901 11:71308154-71308176 ATCTGCAGTGCAGAGAGGGAGGG - Intergenic
1085139278 11:74125856-74125878 CTAAGGAGTGCAGAGGTGGAGGG - Intronic
1085696369 11:78708263-78708285 CTTATCAGTGCAAAGATGAATGG + Intronic
1087133892 11:94694928-94694950 GTGAGGAGTGCAGAGACAGAAGG + Intergenic
1088099253 11:106136443-106136465 CTGTCCAGTGCAGAGATGTAGGG - Intergenic
1089158300 11:116418633-116418655 CTGAGCAGAGCAGATAACGAGGG + Intergenic
1089730135 11:120514061-120514083 CTCAGCCATCCAGAGATGGAAGG + Intronic
1202806793 11_KI270721v1_random:9873-9895 CTGAGCAGCGCAGGAATGAAGGG + Intergenic
1091675883 12:2488948-2488970 GTGGGCAGTGCAGACAAGGAGGG + Intronic
1091815651 12:3435839-3435861 CTGAGCGGTTCAGAGAAGGTGGG - Intronic
1091917799 12:4281935-4281957 CTGGGCAGTGCAGGCATGGGTGG + Intronic
1093742562 12:22705115-22705137 ATGAGCTGGTCAGAGATGGAAGG + Intergenic
1093983397 12:25500148-25500170 ATTATCAGTGCAGAGATTGAAGG + Intronic
1094487491 12:30936643-30936665 GTGAGCACTGCATAGGTGGATGG + Intronic
1096228305 12:49883226-49883248 CTGTGCTGTGCATAGATGCAGGG + Intronic
1096779038 12:53981814-53981836 GTGAGCAATGCAGAGGAGGAGGG - Intergenic
1097773364 12:63616524-63616546 CTGATCAGTGTGGAGATGGGAGG + Intronic
1098014546 12:66090555-66090577 CTCAGCAGGTCAGAGCTGGAAGG + Intergenic
1098909820 12:76197509-76197531 CTCAGCAGTGTAGAGCTGCAAGG - Intergenic
1099758897 12:86893102-86893124 CTCAACAGTGCTTAGATGGAAGG + Intergenic
1100306181 12:93352042-93352064 CTGAACAGTGAAGAGATTAAGGG - Intergenic
1101676085 12:106917846-106917868 CTGGGCAGTGCGGAGGAGGAGGG + Intergenic
1102576333 12:113858413-113858435 CAGAACAGTGCAGAGAGGGCAGG - Intronic
1102785960 12:115605009-115605031 GTGGGCAATGCATAGATGGATGG + Intergenic
1102999042 12:117371149-117371171 CAGAGCAGTGCAGGGACAGAGGG - Intronic
1103063089 12:117874899-117874921 CTGGGCAGTGCAGAGTCAGACGG - Intronic
1103948735 12:124540708-124540730 GTGGGGAGTGGAGAGATGGAGGG + Intronic
1104476670 12:129076055-129076077 CTCAGCATTGCTGAGATTGATGG - Intronic
1104897588 12:132171905-132171927 CTGAGCAAGCCTGAGATGGAGGG - Intergenic
1106382648 13:29255214-29255236 CTGAGCAGAGCAGAGACGGAAGG + Intronic
1106481129 13:30137642-30137664 TAGAGAAGTGCTGAGATGGAGGG + Intergenic
1106601867 13:31195211-31195233 ATGAGCAGTGGATAGATGGAAGG - Intergenic
1107446162 13:40471957-40471979 CTGAGCAATTCAGGGATAGAAGG - Intergenic
1108676384 13:52740381-52740403 CTAAGCAGAGCAGGGCTGGAGGG + Intergenic
1109312972 13:60717091-60717113 CTGGGAAGAGCAGGGATGGATGG + Intergenic
1109368882 13:61395795-61395817 TTTAGCAGTGCAGATAAGGAAGG + Intergenic
1109759126 13:66803717-66803739 CTGCTCAGTGCAGAAATGGGTGG + Intronic
1110976399 13:81841300-81841322 CTGAGCAGTTCACAGCTTGAAGG - Intergenic
1111572683 13:90107662-90107684 CTGAGCTGAGCAGAAAAGGATGG - Intergenic
1112440223 13:99419734-99419756 GTGTGGAGTGCAGGGATGGAAGG - Intergenic
1113053499 13:106240693-106240715 CAGAGCAGTGCTGAGTTGAATGG + Intergenic
1114556027 14:23562837-23562859 TTAGGCAGTGCAGAGATGGTGGG + Intronic
1115161300 14:30398848-30398870 CAGAGCAGGGCAGAGAAGAACGG - Intergenic
1115472414 14:33782238-33782260 CTGAGCAATGGAGAACTGGAGGG - Intronic
1117278579 14:54214676-54214698 CTGACCAGAGCAGAGAGGAATGG - Intergenic
1117536195 14:56705422-56705444 CTGAGGAGGGCAGAGATGAGAGG - Intronic
1118286211 14:64476006-64476028 CCCAGGAGTGCAGAAATGGAAGG - Intronic
1119661707 14:76456845-76456867 CTGGGCAACGCAGAGATGAAAGG + Intronic
1119936498 14:78596980-78597002 CTGAGTAGTGCAAAGAGGGCTGG + Intronic
1120149591 14:81018540-81018562 CTGAGCACCGAAGAGTTGGAGGG + Intronic
1120738457 14:88081118-88081140 CTGAGCCATGCAAAGATGAAAGG - Intergenic
1121445224 14:93974435-93974457 CTCTGCAGCGCAGAAATGGAAGG + Intronic
1122102536 14:99424761-99424783 CTCAGCAGTGCAGGGATGAGGGG + Intronic
1122325382 14:100878454-100878476 CTGGGCAGTGCAGGGAAGGAAGG + Intergenic
1122374543 14:101249191-101249213 TTGACCAGGACAGAGATGGATGG - Intergenic
1122390406 14:101377263-101377285 CTGAGCAAGTCAGCGATGGAGGG + Intergenic
1123138444 14:106052076-106052098 CTGAGTAAAGGAGAGATGGACGG - Intergenic
1202863069 14_GL000225v1_random:96356-96378 GTGATCAGTGCAGAGATACATGG - Intergenic
1123699700 15:22905079-22905101 CTGAGCAGGGCAGGCAGGGAAGG - Intronic
1124223829 15:27871702-27871724 CTGTGCAGCCCAGAGATGAAGGG - Intronic
1124995110 15:34716267-34716289 CTGGACAGGGCAGAGATGGCTGG - Intergenic
1125254195 15:37744687-37744709 CTGAGCAGTGCGGAGGAGGATGG - Intergenic
1127113412 15:55698838-55698860 AGGAGCAGTACAGAGAGGGATGG + Intronic
1128912427 15:71528203-71528225 CTGACAATGGCAGAGATGGAGGG - Intronic
1129641193 15:77380362-77380384 CTGATCAGTGCAGTTTTGGAAGG + Intronic
1130819575 15:87480163-87480185 GTAGGCAATGCAGAGATGGAAGG - Intergenic
1131849921 15:96527923-96527945 ATAAGCAGTGCAAAGATGGAAGG - Intergenic
1132395961 15:101474664-101474686 CTGAGCAGGGCAGAGAATGGTGG - Intronic
1132423020 15:101690220-101690242 CAGTGCAGGGCAGAGAAGGAAGG - Intronic
1132457194 16:30703-30725 GGGAGCACTGCAGTGATGGAGGG - Intergenic
1133003660 16:2865190-2865212 CTGGGCAGGGCAGGCATGGATGG - Intergenic
1133780669 16:8936606-8936628 CAGAGCCATGCAGAGATGGCTGG - Intronic
1135589044 16:23692150-23692172 CTGGGCAGGGCAGAGAAGGGAGG - Intronic
1135658234 16:24270573-24270595 CTGAGCAGTTGGGAGATGGCAGG + Intronic
1135773961 16:25239863-25239885 CAGGGCAATACAGAGATGGAGGG + Exonic
1136061519 16:27729924-27729946 ATGAGCAGTGGAGGGAAGGATGG - Intronic
1136626091 16:31462946-31462968 GTGAGCAGTGCAGTGATGTGGGG + Intronic
1136871337 16:33810646-33810668 CTGAGAAGTGCAGTCATAGAGGG + Intergenic
1137399302 16:48140498-48140520 CAGAGGAGTTCAGAGAGGGAGGG - Intronic
1137563824 16:49521114-49521136 CTCATAAGTGCAGAGGTGGAGGG - Intronic
1137668416 16:50265557-50265579 TTGAGGAGGGCAGAGATGGGAGG - Intronic
1137985031 16:53100008-53100030 CTGAGGAGCCCAGAGAGGGAGGG - Intronic
1139308362 16:66007151-66007173 CTGAGCAGAGCAGACTTAGAGGG - Intergenic
1139685052 16:68596966-68596988 CTTAGCAGTGCTGGGAAGGAAGG - Intergenic
1141102543 16:81208667-81208689 CAGAGCTGTACAGAGATGAATGG + Intergenic
1203100835 16_KI270728v1_random:1305412-1305434 CTGAGAAGTGCAGTCATAGAGGG - Intergenic
1143093377 17:4462885-4462907 CTGAGAAGTGAAGGGATGGATGG - Intronic
1143159629 17:4860689-4860711 CTGAGCAGAGCAAAGAAGCAAGG + Intronic
1143976158 17:10831490-10831512 ATGTGCAGAGGAGAGATGGAAGG + Intronic
1144336093 17:14270232-14270254 ATGAGCAGTGAAGGGAGGGAAGG - Intergenic
1145110071 17:20154814-20154836 GTGAGAAGTGCTGAGATGTAGGG + Intronic
1146628702 17:34454582-34454604 CTGAGAAGTGCAGAGAGAGAGGG - Intergenic
1146691415 17:34878755-34878777 CTGGGCTGTGCAGAAATGGAAGG - Intergenic
1146958660 17:36953461-36953483 CAGATCAGTGCAGAAATGGCTGG - Intronic
1147653579 17:42075860-42075882 CAGAGGAGGGCAGAGATGGGGGG - Intergenic
1147970374 17:44216284-44216306 CTGAGCTGTGCTGAGATTGACGG - Intronic
1150447611 17:65239404-65239426 TAGAGGAGTGCATAGATGGATGG - Intergenic
1150455739 17:65305159-65305181 GTGAGCACTGCAGGGAAGGAGGG + Intergenic
1151476337 17:74346147-74346169 CTGAGGAGGGCTGAGATGGCCGG - Intronic
1152218721 17:79049217-79049239 CAGAGCAGGGGAGAGCTGGAAGG + Exonic
1152292427 17:79447729-79447751 CTGAGCAATGCTCACATGGATGG - Intronic
1152961177 18:81427-81449 GGGAGCAGTGCAGTGATGGAGGG - Intergenic
1152961182 18:81465-81487 GGGAGCAGTGCAGTGACGGAGGG - Intergenic
1153946010 18:10018077-10018099 CTGAGAAGGGCAGAGCTGGCCGG + Intergenic
1153948280 18:10035890-10035912 GTGAGCACTCCAGATATGGAAGG + Intergenic
1153948489 18:10037510-10037532 AGGAGCAATGCAGGGATGGAAGG - Intergenic
1154192029 18:12237731-12237753 CTGAACAATGCAGAAAAGGAAGG + Intergenic
1155247165 18:23921763-23921785 CTGGGCAGTGGAAAGAAGGAGGG + Intronic
1155845410 18:30699504-30699526 CTGAGCAGAGCAGAGAATGCTGG + Intergenic
1155989428 18:32264446-32264468 CTGAGAAGTCCAGGGATGGGAGG - Intronic
1156454418 18:37285007-37285029 GTGGTCTGTGCAGAGATGGAGGG - Intronic
1156794632 18:41028709-41028731 CTGAGAAATGCAGAGGTGCAGGG - Intergenic
1157401787 18:47394890-47394912 CTTTGCAGGGTAGAGATGGAGGG + Intergenic
1157797744 18:50590718-50590740 ATGAGCTGTGCAGAGACAGAGGG + Intronic
1157976982 18:52339160-52339182 GTGAGGAGTGCAAAAATGGATGG + Intergenic
1158166315 18:54545089-54545111 CTGAACAGTTCAGAAAGGGAAGG + Intergenic
1158345370 18:56511001-56511023 CTAAGCAGTGAAGACATTGAAGG - Intergenic
1158697882 18:59718870-59718892 CTGAGCAGTGAAGAGTTTCAGGG - Intergenic
1159281394 18:66290723-66290745 CTGATTAGTGGAGAGAAGGATGG - Intergenic
1160521668 18:79511583-79511605 CTGAGCTGTGGAGGGGTGGAGGG + Intronic
1160757476 19:765187-765209 CTGGGCAGAGCAGAGACTGAGGG + Intergenic
1161852250 19:6743685-6743707 CTGAAGAATGCAGAGGTGGAAGG - Intronic
1161994491 19:7703929-7703951 CTGAGCATTGGAGAGGTGGCTGG - Intergenic
1163761082 19:19137224-19137246 CTGAGCTGTGGGGAGGTGGAGGG - Intronic
1163856634 19:19707517-19707539 CTGAGCTGTGCAGCCATGGTAGG - Intergenic
1164775063 19:30846535-30846557 CTGAGCTTTGTAGAGAAGGAAGG + Intergenic
1165101360 19:33440436-33440458 CTGTCCAAAGCAGAGATGGAGGG - Intronic
1165642507 19:37402415-37402437 CTGAGCAGTCCAGGGCTGGTGGG - Intergenic
1165900387 19:39166924-39166946 CTGTGCAGTGCCCAGAGGGAAGG + Intronic
1166836031 19:45668609-45668631 CTGAGAGGCGCAGAGACGGAGGG - Intronic
1167213486 19:48148651-48148673 TTGAGCATGGCAGAGATGGGGGG + Intronic
1168251605 19:55145448-55145470 GTGAGAAAGGCAGAGATGGAGGG - Intronic
1168314414 19:55478191-55478213 CTCAGCAGTGCTGAGATGTGGGG - Intronic
1168415466 19:56165061-56165083 TTGAGCAGTCTAGGGATGGATGG - Intergenic
1168453822 19:56488750-56488772 CAGAAAAGTGCAGAGATTGAGGG + Intergenic
1168499967 19:56885144-56885166 ATAAGGAGTGCAGAGCTGGAAGG - Intergenic
926168755 2:10537586-10537608 CAGAGCAGCTCAGAGATGGAAGG + Intergenic
926235623 2:11041239-11041261 CAGAGCAGAGCAGAGTGGGAAGG - Intergenic
926301613 2:11608807-11608829 ATGAGCAGTGCACATATGTAAGG - Intronic
926318127 2:11726476-11726498 ATGAGCAGAGAAGAGATGGGGGG - Intronic
927278438 2:21281815-21281837 ATGAGCAGTGGAGAAAGGGAAGG + Intergenic
927948612 2:27152553-27152575 CTGATCAGAGCAGTGATGGCTGG + Intronic
928343083 2:30462444-30462466 CTTAGCATTGAAGAGATGGTAGG + Intronic
928413508 2:31072155-31072177 CTGTGGGGTGCAGAGGTGGAGGG + Intronic
931209176 2:60176486-60176508 CTGAGCAGAGCACACATGGGGGG + Intergenic
931289652 2:60861495-60861517 CAGAGCAGGGCAGAGAAGGGTGG - Intergenic
934558733 2:95301225-95301247 ATGAGCAGTGCAGGGCTGGGAGG + Intronic
934754998 2:96818629-96818651 CTGAGCAGTTCGGAGATTGAAGG + Intronic
935585991 2:104800864-104800886 CTGAACACTGCTGAGATGGAGGG - Intergenic
936349791 2:111703892-111703914 GTGGGAATTGCAGAGATGGAAGG + Intergenic
936685728 2:114823917-114823939 CAGAGCAGGGCAAGGATGGATGG + Intronic
937064324 2:119005866-119005888 CTGGGCAGGACAGAGATGGTAGG + Intergenic
938102184 2:128504700-128504722 CAGGGCAGTGCAGGGCTGGATGG + Intergenic
938125708 2:128669799-128669821 CTAATCAGTAAAGAGATGGAGGG + Intergenic
940791494 2:158034163-158034185 AAGAGCAGTTCAGAGGTGGAAGG - Intronic
943291674 2:186079918-186079940 TGGAGCAGTGCAGAGATAGAAGG - Intergenic
944330146 2:198456068-198456090 CTCAGAAGAGCAGAGAAGGATGG + Intronic
944375788 2:199040153-199040175 CTAACCAGTGCAGATGTGGAGGG - Intergenic
945135858 2:206626993-206627015 ATGAGCAGTCCAGAGCTGGTAGG + Intergenic
945975517 2:216267464-216267486 CTGTGGAGCCCAGAGATGGAAGG + Intronic
945986263 2:216356263-216356285 CTGAGCAGTGCAGTGTTGAGGGG - Intronic
946159124 2:217825431-217825453 CTGGGCAGAGCAGTGAGGGATGG - Intronic
946404203 2:219483986-219484008 CTGGGCCGTGCAGGGCTGGATGG - Exonic
946967229 2:225049581-225049603 CTGAGCTATGTAGAGATGAAAGG - Intergenic
948071081 2:235126676-235126698 CTGATCTGTGCAGAGATGACTGG + Intergenic
948920392 2:241063605-241063627 CTCACCCGTGCAGAAATGGAGGG + Exonic
948941010 2:241196442-241196464 CAGAGGAGGGCAGAGAAGGAAGG - Intronic
1170389355 20:15854924-15854946 CTCACCAGTGCAGGGTTGGATGG - Intronic
1170798311 20:19569522-19569544 CAGAGCAGGGCAGAGAAGAATGG - Intronic
1170850469 20:19999491-19999513 CTCAGCAGTGAAGGGAAGGAGGG - Intronic
1171279551 20:23884179-23884201 CTGAGCAATGCAGACCTGGCAGG - Intergenic
1171374777 20:24685152-24685174 CTGAGCCCTGCAGAGGTGAAGGG - Intergenic
1172099193 20:32475345-32475367 CCCAGAAGTGCAGAGAAGGAAGG + Intronic
1172106418 20:32519733-32519755 CTGGGCAGGACAGAGCTGGAGGG + Intronic
1172331702 20:34080105-34080127 CTGGGCAGTGCAGACAGGGAGGG - Exonic
1172614014 20:36271737-36271759 CAGAGCAGCGCAGTGAAGGATGG - Intergenic
1173856834 20:46255648-46255670 CAGAGCAGTGAAGAGTTGGCAGG - Intronic
1176047134 20:63098567-63098589 GTGAGCAATGGACAGATGGATGG + Intergenic
1176107840 20:63397948-63397970 CTGAGCAGTGCCAGGCTGGAGGG + Intergenic
1177237098 21:18406107-18406129 CTGGGAAGTGAAGAGATGGAGGG + Intronic
1177776854 21:25577529-25577551 CTGAGCATTACAGAGAAGGGCGG - Intergenic
1178423576 21:32461111-32461133 CTGAGAACTGCAGGGATGGAGGG + Intronic
1178517905 21:33264269-33264291 GTGAGCAGTGGAGAGAAGGGGGG + Exonic
1179335909 21:40453595-40453617 CTAAGCAATGCTCAGATGGATGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180600418 22:17011804-17011826 GGGAGCAGTGCAGTGATGGAGGG + Intergenic
1180706045 22:17810584-17810606 CAGAGCAGAGCAGAGGTAGACGG - Intronic
1181024546 22:20120575-20120597 CAGAGCTGTGCACAGAGGGAGGG + Intronic
1181327150 22:22058511-22058533 CTCAGATGTGCAGAGAGGGAGGG - Intergenic
1182785153 22:32901493-32901515 GTGAGCTGTGCAGTGAGGGAAGG - Intronic
1182935306 22:34216543-34216565 CTGATCAATGAAGAGATGTAAGG - Intergenic
949710496 3:6864748-6864770 CTGAGCACTGAAGGGAAGGAGGG + Intronic
951803895 3:26624637-26624659 CTGGGGAGCGCAGAGCTGGAGGG + Intronic
953789990 3:45939994-45940016 CTGACCAGTGCAGGTTTGGAAGG + Intronic
954264321 3:49461136-49461158 CAGAGCATCCCAGAGATGGATGG + Intergenic
954622270 3:52002980-52003002 CTGAGCTGGGAAGAGAGGGAGGG - Intergenic
955390394 3:58518389-58518411 CTGGGCTGTGGAGAGAAGGAGGG - Intronic
955614082 3:60787322-60787344 TTGAGCAGTGCTCAGAAGGATGG - Intronic
956916327 3:73875566-73875588 CTGAGGATTGCAGAGGGGGAGGG + Intergenic
958034143 3:88150068-88150090 CTCAGCTTTTCAGAGATGGAGGG + Exonic
960570663 3:119182249-119182271 CTGTGCAGTGAACAGAGGGAAGG + Intronic
961618620 3:128205347-128205369 CTGAGCAGTGCAGAGATGGAGGG + Intronic
961668611 3:128509945-128509967 CTCACCTGTGCAGAGAGGGAAGG + Intergenic
962202776 3:133414685-133414707 GTGAGTAGAGCAGAGATGGCAGG - Intronic
962275772 3:134012217-134012239 CTGAGCAGTCCACAGTTAGAGGG + Intronic
963052544 3:141154237-141154259 CAGAGCAGGGCAGAGGAGGAGGG + Intergenic
965701725 3:171465084-171465106 CTGAGAAGTGCAGAGAAGTCTGG + Intergenic
965962579 3:174446048-174446070 CTGAGCAGTTCAGATAAGAAAGG + Intronic
967952375 3:194851263-194851285 CTGGCCAGTTCAGAGATAGAGGG + Intergenic
969112896 4:4854702-4854724 CTGCGCAGGGCAGAGCTGGAGGG + Intergenic
969424850 4:7118194-7118216 CTGAGGAATGGAGAGATGGATGG + Intergenic
969476068 4:7423003-7423025 CTGAGAAGTGGAGAGAGGGGTGG - Intronic
969617808 4:8263497-8263519 CTGAGCAGTTCACGGCTGGAGGG + Intergenic
970200724 4:13601774-13601796 ATAAGCAGTGAAGAGGTGGATGG - Exonic
970250805 4:14113979-14114001 CTGAGTAGTGCACAGACGGCAGG + Intergenic
971727897 4:30336956-30336978 CTAATCAGAGCAGAGATGCAGGG + Intergenic
973325312 4:48854668-48854690 CAGAGCAGTGGATGGATGGATGG - Intronic
974317620 4:60303031-60303053 CTGAACAGTTCAGATATAGAAGG + Intergenic
974626159 4:64431080-64431102 CTGAGCAGAGGATAGATGTAGGG - Intergenic
977334257 4:95676171-95676193 CTGAACAGATCAGTGATGGAAGG - Intergenic
977731897 4:100363660-100363682 ATGGGCAGTGCATGGATGGATGG + Intergenic
978504678 4:109443891-109443913 CTGAGCAGTGCAGGGGTACAAGG + Intronic
979063390 4:116097079-116097101 CTGGGCAGTGTGAAGATGGAGGG - Intergenic
979270706 4:118757358-118757380 CTGAGCATGGCAGAGTTCGAAGG - Intronic
979577188 4:122307445-122307467 CACAGCAGTGTATAGATGGAGGG - Intronic
982097741 4:151938108-151938130 CTGAGCAGAGCAGACTGGGAGGG + Intergenic
983411587 4:167405173-167405195 ATCAGCAATGAAGAGATGGAAGG - Intergenic
984126088 4:175812671-175812693 CTGAGCTGTGAACAGATGGAGGG + Intronic
985131752 4:186745538-186745560 CAGGGCAGTGCAGTGATGGCAGG + Intergenic
985392455 4:189504637-189504659 CTGCCCAGGGCAGAGCTGGATGG + Intergenic
985574195 5:665947-665969 GTGAGCAGGGCGGGGATGGAAGG - Intronic
985678443 5:1244044-1244066 CTGGGGAGGGCAGGGATGGAGGG + Intronic
986299355 5:6466082-6466104 CTGAGCAGTGCGGGGAGGCATGG + Intronic
987252922 5:16118854-16118876 CAGGGCAGTGAAGAGGTGGAAGG + Intronic
987360912 5:17105675-17105697 GTGAGCTGTGCAGATATGTAGGG + Intronic
988557376 5:32249298-32249320 CTGAGGCTTGGAGAGATGGAAGG + Intronic
989339066 5:40354229-40354251 CCCAGGAGTGCAGAGATGGCTGG - Intergenic
990504917 5:56434487-56434509 CAGAGCATTGTAGAGGTGGAAGG - Intergenic
991729757 5:69573939-69573961 CTGGGCAGGACAGAGAGGGAAGG - Intronic
991806189 5:70429079-70429101 CTGGGCAGGACAGAGAGGGAAGG - Intergenic
991865197 5:71053935-71053957 CTGGGCAGGACAGAGAGGGAAGG + Intronic
992208722 5:74456316-74456338 CATAGCAGGGCAGAGAAGGAGGG + Intergenic
992210056 5:74469926-74469948 CTTAGCAGAGGGGAGATGGATGG - Intergenic
994617915 5:102129335-102129357 CTCAACTGTGCAGAGATGGGAGG - Intergenic
995119651 5:108522190-108522212 TTGAGCAGTCCAGAGAAGTAGGG - Intergenic
995734288 5:115282346-115282368 CTGAGCAAAGCAAAGATAGATGG - Intronic
996371715 5:122760144-122760166 GTGAACAGTGCAGTGATGTATGG - Intergenic
996582460 5:125047070-125047092 CAGAGCAGTGCAGAGAAGGTGGG + Intergenic
996849648 5:127937920-127937942 CTGAGGAGAGAAAAGATGGAAGG + Intergenic
997421896 5:133776134-133776156 CAGAGCAGGGTAGAGATGGGTGG - Intergenic
997977543 5:138449241-138449263 CAGAGGAGAGAAGAGATGGAGGG + Intergenic
998007419 5:138666169-138666191 CTGAGCAGGGCAGGGAAGAATGG + Intronic
998208085 5:140173706-140173728 CTGAGGAGGGCAGGGATAGAGGG - Intergenic
999284590 5:150386673-150386695 CTGGCCAGTGAAGAGCTGGAGGG - Intronic
999493321 5:152072830-152072852 CTGGGCAGAGCAGAGAGAGATGG + Intergenic
1000509609 5:162165104-162165126 CTGTGCTGTGCAGAGGTGGTGGG - Intergenic
1000666195 5:164000435-164000457 CTGAGCAGTGCAGTCCTAGAGGG - Intergenic
1001149097 5:169211253-169211275 CTGAGTAATGCAGAGGAGGAGGG + Intronic
1001150063 5:169219572-169219594 CTGAGCTGTGCAGAGGTGGCAGG + Intronic
1001373037 5:171225717-171225739 CAGGGCGGTGCAGAGAGGGAAGG + Intronic
1002939940 6:1707340-1707362 CTGAGCAATACATAGATAGATGG - Intronic
1003126907 6:3362962-3362984 CTGAGCAGTCCAGAGTTTAAAGG - Intronic
1003223849 6:4187440-4187462 CTGAGCTGAGCAGAGAGGGCAGG - Intergenic
1003482604 6:6546868-6546890 CTGTGCAGTGCCCAGATGGCAGG - Intergenic
1003642478 6:7887494-7887516 CTGTGCAGCGCGGAGAGGGAGGG - Intronic
1007254458 6:40518983-40519005 CTGAGCAGTGGGGAGAGAGAGGG + Intronic
1007313611 6:40966324-40966346 CTAAGGAGTGAAGAGCTGGAAGG - Intergenic
1010029406 6:71257544-71257566 CTCAGCAGGGCAGAGAGGCAAGG + Intergenic
1012111731 6:95243781-95243803 CTGCTCACTGCAGAGATGGAGGG - Intergenic
1012116566 6:95306199-95306221 TTGAGCAGTGGAGAAATGAAGGG - Intergenic
1012600172 6:101086789-101086811 CAGAGCAGAGCAGAGAAGGCTGG + Intergenic
1016200040 6:141395266-141395288 CTGAGAACTGCAGAGATGATGGG + Intergenic
1016385430 6:143526213-143526235 CTGAGGAGTGAGGACATGGAAGG + Intergenic
1016984201 6:149882239-149882261 ATGAGGAGGGGAGAGATGGAGGG + Intergenic
1017878651 6:158544534-158544556 CTGAACAGTGCAGAAAGGGACGG + Intronic
1018250303 6:161862813-161862835 CTGACCACTTCAGAGATAGACGG - Intronic
1018753882 6:166831319-166831341 CTGAGCAGAAGAGAGATGGCAGG - Intronic
1018908902 6:168090692-168090714 CTCAGCAGTGGGGAGATGGAAGG - Intergenic
1018939890 6:168302038-168302060 CTGGGCAGTGAGGAGCTGGATGG - Intronic
1019695910 7:2446096-2446118 CTGGGCTGTGCAGAGACGGATGG - Intergenic
1019708366 7:2507176-2507198 CTGGGCAGTGCAGAGGGTGAGGG - Intergenic
1019943931 7:4311927-4311949 CTGAGGGATGCAGAGATGGCAGG + Intergenic
1020358835 7:7305379-7305401 CTGAGCACAGAAGAGATGCAGGG - Intergenic
1021927844 7:25550492-25550514 CTGAGCAGTGTTCTGATGGATGG - Intergenic
1022388584 7:29924397-29924419 CTGAGGAGTGGGGAGATGCAGGG - Intronic
1022932930 7:35140253-35140275 CTGATCAGTGTGGAGATGGGAGG + Intergenic
1024250346 7:47501491-47501513 CTGAGCAGAGCGGAGCTGGCTGG + Intronic
1024596633 7:50943422-50943444 CTGAGCAGGGCTGTGGTGGAGGG + Intergenic
1024692596 7:51819096-51819118 CTGACCAGTGCACACAGGGATGG + Intergenic
1025305941 7:57855411-57855433 CTGATCAGTGTATATATGGAGGG - Intergenic
1025319416 7:58078259-58078281 CTGATCAGTGTATATATGGAGGG + Intergenic
1025477834 7:60948729-60948751 CTGATCAATGCATATATGGAAGG + Intergenic
1025554296 7:62285216-62285238 CTGATCAATGCATATATGGAAGG - Intergenic
1025560485 7:62368058-62368080 CTGATCAATGCATATATGGAAGG + Intergenic
1026211619 7:68311058-68311080 CTCTGCCCTGCAGAGATGGAGGG + Intergenic
1026566198 7:71491535-71491557 CTGTGCAGTGGAGAGAGGCAGGG + Intronic
1026888664 7:73969445-73969467 CTGAGCAGGGCTGGGAGGGAGGG + Intergenic
1027267910 7:76504211-76504233 CTGAGCTGTGGAGAAGTGGAGGG - Intronic
1027319721 7:77004073-77004095 CTGAGCTGTGGAGAAGTGGAGGG - Intergenic
1027787141 7:82594581-82594603 AAGAGCACTACAGAGATGGAAGG - Intergenic
1028309516 7:89313345-89313367 ATGAAATGTGCAGAGATGGAAGG + Intronic
1028742202 7:94288358-94288380 CTGACAATTACAGAGATGGATGG + Intergenic
1029253432 7:99252790-99252812 CTGAGCAGGGAAGAGAGGGGAGG - Intergenic
1029828848 7:103233020-103233042 CTGATCAGTGTGGAGATGGGAGG + Intergenic
1029941403 7:104484364-104484386 CTGAGAAGTGAAGGGAAGGAGGG - Intronic
1030074566 7:105725314-105725336 ATGGGGAGTGCAAAGATGGAGGG - Intronic
1030392885 7:108948874-108948896 CTAAGCAGACTAGAGATGGAGGG + Intergenic
1032653469 7:133903541-133903563 TTGAGCAGTGAAAAGATGGATGG + Intronic
1033214178 7:139482220-139482242 CTTGGCAGTGCAGGGATGGGGGG + Intronic
1033417969 7:141181020-141181042 ATGAGGAATGGAGAGATGGATGG - Intronic
1033510403 7:142055243-142055265 CTGAGGGGTGCAAGGATGGAAGG + Intronic
1033655401 7:143370283-143370305 TTGAGGAGTGCAGAGAAGTAAGG - Intergenic
1033715874 7:144001702-144001724 ATGAGCAGAAAAGAGATGGATGG - Intergenic
1035059665 7:156059639-156059661 CTGAGCAGGGCACTGAAGGATGG - Intergenic
1035457255 7:159016630-159016652 CTGAGGTCTGCAGCGATGGAAGG - Intergenic
1035457331 7:159017084-159017106 CTGAGGTCTGCAGTGATGGAAGG - Intergenic
1035457342 7:159017151-159017173 CTGAGGTCTGCAGTGATGGAAGG - Intergenic
1035457352 7:159017217-159017239 CTGAGGTCTGCAGCGATGGAAGG - Intergenic
1035660760 8:1346133-1346155 CAGAGCAGTGCAGACGTGTATGG - Intergenic
1036987001 8:13544482-13544504 GTGAGAGGTGCAGAGATGGGAGG + Intergenic
1037321494 8:17647729-17647751 CTGATCAGCGGAGAGATGAAAGG + Intronic
1037805808 8:22057415-22057437 CTGAGCAGGCCAGCAATGGAAGG + Intronic
1038034020 8:23671805-23671827 CTGATCAGGGCAGAGAAGGGAGG + Intergenic
1038070276 8:24005887-24005909 CTGGGCAGTGGAGAGAGTGATGG + Intergenic
1038934204 8:32230401-32230423 CTGAGAAGTGCAGGGGTGGCAGG - Intronic
1039031875 8:33317916-33317938 CAGAGCAGTGAATACATGGAAGG - Intergenic
1039431047 8:37525277-37525299 ATGGGTAGTGCAGAGAAGGATGG - Intergenic
1039547258 8:38419204-38419226 CTTAGAAGTGCAGAGATGCAGGG - Intronic
1043693016 8:83180825-83180847 CTGAGGAGGGCAGAGAGGAAGGG - Intergenic
1043782880 8:84358888-84358910 TGGAGAAGTGCAGAGTTGGAAGG + Intronic
1043883711 8:85574284-85574306 CTGGGCAGAGCACAGATGCAAGG - Intergenic
1044763060 8:95542748-95542770 CTAAGCAATGCAGACATGGCTGG + Intergenic
1045346025 8:101294502-101294524 CTCAGCTGTGCAGACAAGGATGG - Intergenic
1047067618 8:121303387-121303409 CTGAGAAGAGCAGAGATGAAGGG + Intergenic
1047958645 8:129994917-129994939 CTGAGTACTGCACAGATGCAGGG - Intronic
1049200645 8:141338707-141338729 CTGAGCAGAGCAGAGGTGAGAGG + Intergenic
1049655694 8:143796004-143796026 CTGGGGAGTGCAGAGCTGGCCGG - Intronic
1050697136 9:8291869-8291891 CACAGCAGTGCTGAGGTGGAGGG - Intergenic
1051550143 9:18318591-18318613 CTGACCAGAGGAGAGAAGGATGG + Intergenic
1052351161 9:27459493-27459515 CTGAGAAGTGCTGGGTTGGAGGG + Intronic
1052648520 9:31270173-31270195 GGGAGCATTTCAGAGATGGAAGG + Intergenic
1052876934 9:33574531-33574553 CCGAGCAGAGCAGAGAGGGCTGG - Intergenic
1053153252 9:35756324-35756346 CTGAACAGTGAAGAGATGACAGG - Exonic
1053297270 9:36923800-36923822 CTCCTCAGTGCAGGGATGGAGGG + Intronic
1053499076 9:38569855-38569877 CCGAGCAGAGCAGAGAGGGCTGG + Intronic
1053518820 9:38756023-38756045 CTCAGCAGTGCTGACATGAAGGG - Intergenic
1053870514 9:42487052-42487074 CTGAGCAGTGGAGAGATGGAAGG + Intergenic
1054085771 9:60742075-60742097 CTGAGCAGTAGAGAGATGGAAGG - Intergenic
1054241032 9:62613312-62613334 CTGAGCAGTGGAGAGATGGAAGG - Intergenic
1055460996 9:76520123-76520145 CTGATGAGTGAAAAGATGGATGG + Intergenic
1056399070 9:86209485-86209507 CTGAGCTGTGAAGAGAGAGAAGG + Intergenic
1056682696 9:88732970-88732992 CTAAGCAGTGGTGAGATGGAAGG + Intergenic
1056794228 9:89646573-89646595 CTGTACACTGCAGAGATAGAAGG - Intergenic
1056835545 9:89952325-89952347 CTGAGCAGTGGTGGGATTGAGGG + Intergenic
1057162123 9:92896197-92896219 CTGAGCAGAGCAGAGAGGGCTGG + Intergenic
1057678511 9:97154336-97154358 CTGAGCAGAGCAGAGAGGGCTGG + Intergenic
1058905921 9:109482707-109482729 CAGAGCATTGCAGAGGTGGTAGG - Intronic
1059776054 9:117476215-117476237 CTTAGTAGTGAAAAGATGGAGGG - Intergenic
1060680777 9:125562014-125562036 ATGAACAGGGCAGACATGGATGG + Intronic
1061036915 9:128119078-128119100 CGGAGGGGTGCAGGGATGGAGGG + Intergenic
1061274986 9:129564849-129564871 CAGAGGAGTGCAGGGAGGGAAGG - Intergenic
1061432471 9:130539975-130539997 CAGAGCAGGGCAGAGAGGTAGGG - Intergenic
1062316890 9:135971763-135971785 GTGGGCAGTGCAGAGAAGGGTGG + Intergenic
1062652675 9:137586285-137586307 CTGAGGTGAGCAGAGAAGGAAGG + Intronic
1062652679 9:137586312-137586334 CTGAGGTGAGCAGAGAAGGAAGG + Intronic
1062652683 9:137586339-137586361 CTGAGGTGAGCAGAGAAGGAAGG + Intronic
1062652687 9:137586366-137586388 CTGAGGTGAGCAGAGAAGGAAGG + Intronic
1062652723 9:137586570-137586592 CTGAGGTGAGCAGAGAAGGAAGG + Intronic
1062736981 9:138142709-138142731 GGGAGCAGTGCAGTGACGGAGGG + Intergenic
1186168711 X:6854820-6854842 CAGAGGGGTGCAGAGGTGGAAGG + Intergenic
1187246743 X:17559699-17559721 CTGGGCAGTCCAGACATGCAAGG + Intronic
1188230812 X:27660693-27660715 CTGGGCAGTGCACAGATGTAGGG + Intronic
1188530296 X:31132936-31132958 CTCAGCAGTGAAAAGATGGCTGG + Intronic
1192440724 X:71171504-71171526 CGCAGCGGTGCAGAGAAGGAAGG - Intergenic
1194972331 X:100357893-100357915 ATGATCAGAGAAGAGATGGAAGG + Intronic
1196152963 X:112394063-112394085 CTGAGAATTGCAAAGATCGATGG + Intergenic
1197569243 X:128128662-128128684 CTCAGCAGAGCAGAGAGAGAAGG - Intergenic
1197872060 X:131070064-131070086 CTAGGCACTGCAGGGATGGAGGG + Intronic
1198257673 X:134938827-134938849 ATGAGCAGAGCAGAGAGGGTTGG - Intergenic
1198870157 X:141170211-141170233 CTGGGGAGCGCAGAGATGGGAGG + Intergenic
1198981551 X:142403157-142403179 ATGAGCAGTGCAGATAAGAAAGG - Intergenic
1199692336 X:150318109-150318131 TTGAGCATTGCTGAGATGGAGGG - Intergenic
1200399164 X:156008682-156008704 GGGAGCACTGCAGTGATGGAGGG + Intronic