ID: 961619262

View in Genome Browser
Species Human (GRCh38)
Location 3:128210639-128210661
Sequence AAAAAATTCAGAGATGTAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1217
Summary {0: 1, 1: 0, 2: 5, 3: 98, 4: 1113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961619262_961619265 14 Left 961619262 3:128210639-128210661 CCAATTACATCTCTGAATTTTTT 0: 1
1: 0
2: 5
3: 98
4: 1113
Right 961619265 3:128210676-128210698 TCAGATTCAGCCAATTCCTACGG 0: 1
1: 0
2: 0
3: 5
4: 106
961619262_961619267 25 Left 961619262 3:128210639-128210661 CCAATTACATCTCTGAATTTTTT 0: 1
1: 0
2: 5
3: 98
4: 1113
Right 961619267 3:128210687-128210709 CAATTCCTACGGATTTCCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961619262 Original CRISPR AAAAAATTCAGAGATGTAAT TGG (reversed) Intronic
901151832 1:7108557-7108579 AAAAGGTTCAGAGAGGAAATAGG + Intronic
901389631 1:8936055-8936077 AAAAATAAAAGAGATGTAATAGG - Intergenic
901978660 1:13015936-13015958 AAAAAATTAAAACACGTAATGGG - Intronic
902003421 1:13213002-13213024 AAAAAATTAAAACACGTAATGGG + Intergenic
902022649 1:13358754-13358776 AAAAAATTAAAACACGTAATGGG + Intergenic
902168335 1:14590719-14590741 AAGAAATTAATAGATGTTATCGG - Intergenic
902911903 1:19604840-19604862 AAAATATGCAGATATTTAATAGG + Intronic
904196376 1:28788805-28788827 AAAAAAGTCACAAATGTTATTGG - Intergenic
904511161 1:31009252-31009274 AAAAAAATCAGAATTTTAATTGG - Intronic
905989703 1:42325423-42325445 AGAAAAATCAGAGATGTCCTTGG - Intronic
906223078 1:44098310-44098332 AATAAAATCAGAGATGAAAAGGG - Intergenic
906249292 1:44299171-44299193 AAAAAATTGAGGTATGAAATAGG - Intronic
906352457 1:45074573-45074595 AATAAAATCAGAGATGAAAAAGG - Intronic
906545103 1:46614960-46614982 AAAAAACTCACAGATGTGAAAGG + Exonic
907073305 1:51556943-51556965 AAACAACTAAAAGATGTAATGGG + Intergenic
907146007 1:52232095-52232117 GAGAAAATCAGAAATGTAATAGG - Intronic
907795564 1:57713134-57713156 AATAAATTCATAGAGGAAATTGG - Intronic
907897119 1:58702275-58702297 AAAAAAAAAAAAGATGTAATGGG + Intergenic
907994841 1:59619649-59619671 AACAAGTTCAGAGAGGTGATAGG + Intronic
908210070 1:61891151-61891173 AAAAAAATTATAGGTGTAATAGG + Intronic
908397248 1:63737602-63737624 AATAAAATCAGAGATGAAAATGG - Intergenic
908449773 1:64240951-64240973 AATAAATTTAAAGATCTAATTGG + Intronic
908630701 1:66103398-66103420 AAAAGATTAAGACATATAATAGG - Intronic
908936197 1:69379230-69379252 AAAAACTACAGAAATGTAATGGG - Intergenic
908951146 1:69564913-69564935 TAAACATTTATAGATGTAATAGG + Intergenic
909063334 1:70904219-70904241 ACAAAATAAAGAGATTTAATTGG - Intronic
909083852 1:71148052-71148074 AATAAAATCAGAGATGAAAATGG - Intergenic
909179273 1:72400557-72400579 AACAAATTCAGCGAAGTCATAGG - Intergenic
909182944 1:72448809-72448831 AAAAAAATCTGAGGTGTAATAGG - Intergenic
909195741 1:72620320-72620342 ATAAAATTGCGAGATGTAAATGG + Intergenic
909209373 1:72803895-72803917 AATAAAATCAGAGATGAAAAGGG - Intergenic
909343139 1:74554005-74554027 AGAAGCTTCAGAGAAGTAATGGG + Intergenic
909386597 1:75065000-75065022 AATAAAATCAGAGATGGAAAGGG - Intergenic
909387047 1:75069228-75069250 AAAAAAATAAAAGATGTAAATGG + Intergenic
909626976 1:77728439-77728461 AAACAATTCAGAAATGTCAAAGG - Exonic
910158076 1:84242989-84243011 AGAAAATTCAGAGATGGTAATGG + Intergenic
910488102 1:87738153-87738175 AAAAAATCAAGAGATGGAGTTGG + Intergenic
910620822 1:89252329-89252351 AACAAAATCAGAGATGAAAAAGG + Intergenic
910627185 1:89319447-89319469 AATAAAATCAGAGATGAAAAAGG - Intergenic
910733457 1:90424762-90424784 AATAAAGTCAGAGATGAAAAAGG + Intergenic
910737653 1:90478974-90478996 AAATAATTCAGTGATTTACTTGG - Intergenic
910819471 1:91330294-91330316 AATAAAATCAGAGATGAAAAAGG + Intronic
910883122 1:91940388-91940410 AAAAACTTTAGAGATGTAACTGG - Intergenic
910905299 1:92171227-92171249 AAAAAATTCTAAAATATAATAGG + Intronic
911166232 1:94726981-94727003 ATAAAATTTATAGATGTCATTGG - Intergenic
911251027 1:95576371-95576393 AAAAAATTAGTAGATGCAATTGG + Intergenic
911289033 1:96033022-96033044 AAAAAATTGAGAGATGGAGATGG - Intergenic
911433352 1:97822162-97822184 AAAAAATGCAGAGAAAAAATAGG - Intronic
911962568 1:104324959-104324981 AATAAATTAAAAGATGTGATTGG - Intergenic
911966534 1:104379125-104379147 AATAAAATCAGAGATGAAATAGG + Intergenic
911991412 1:104702335-104702357 AATAAAATCAGAGATGTAAAAGG + Intergenic
911993343 1:104731107-104731129 AATAAATTCAGTAATGTTATGGG - Intergenic
912898950 1:113626800-113626822 AATAAAATCAGAGATGAAACAGG - Intronic
913146716 1:115998638-115998660 AATAAAATCAGAGATGAAAAAGG - Intronic
913170397 1:116226881-116226903 AAGAAATTCAGAGATGGAGATGG + Intergenic
913324949 1:117619817-117619839 AACAAAATCAGATATGTAAAGGG - Intronic
914856909 1:151359222-151359244 AAAAAATTCAAACATATAAGAGG - Intergenic
914895936 1:151672836-151672858 AATAAAATCAGAGATGAAAAAGG - Intronic
915191086 1:154151087-154151109 AAAAAATTCACAGAAGTACTAGG - Intronic
915811214 1:158913569-158913591 AATAAAATCAGAGATGAAAAAGG + Intergenic
916082606 1:161244406-161244428 AAAAAATTCTGAGACATGATGGG + Intergenic
916105532 1:161427721-161427743 TAAAATTTCAGAGAGGTCATTGG + Intergenic
916341541 1:163741737-163741759 AATAAAATCAGAGATGAAAAAGG - Intergenic
916781950 1:168042808-168042830 AAAAAATTCAAAAATATAAAGGG - Intronic
916911443 1:169351715-169351737 AATAAAATCAGAGATGAAAAAGG + Intronic
916920004 1:169455603-169455625 AAAATATTCAGAGATATTAGTGG + Intronic
917079273 1:171239489-171239511 ATCAAATTCACACATGTAATTGG + Intergenic
917226096 1:172784689-172784711 AATAAAATCAGAGATGAAAAAGG - Intergenic
917317993 1:173748052-173748074 TATAAATTCAGAGATGAAATAGG + Intronic
917320748 1:173778816-173778838 AATAAAATCAGAGATGAAAAAGG - Intronic
917343100 1:174000802-174000824 AAAAAATTAAGTGTTATAATAGG - Intronic
917357047 1:174137101-174137123 AAAAAATATAGAGATATATTAGG - Intergenic
917364316 1:174212830-174212852 AATAAAATCAGAGATGAAAAAGG + Intronic
917758796 1:178132750-178132772 AAAAAATTCTGAATTGTAAAAGG - Intronic
917954994 1:180086137-180086159 ACACAATACAGAGATGGAATAGG + Intronic
918154794 1:181834199-181834221 AACAAAATCAGAGATGAAAAAGG + Intergenic
918665898 1:187150640-187150662 AATAAAATCAGAGATGAAAAAGG - Intergenic
918743984 1:188174915-188174937 AAAAAAGTCAAAAATCTAATTGG - Intergenic
918830889 1:189396523-189396545 AAAAAATACACAAATGTAATGGG + Intergenic
918928416 1:190818887-190818909 AATAAAATCAGAGATGAAAAAGG + Intergenic
919061789 1:192642836-192642858 AAAAAATCCCGAAATGTGATGGG - Intronic
919245269 1:194974821-194974843 AAAATATTCATAGATATAACTGG + Intergenic
919403791 1:197150875-197150897 AAAAACTTTACAGATGTGATAGG - Intergenic
919479747 1:198073484-198073506 GAAAAATTTAGAGATGTATCAGG + Intergenic
919595389 1:199555563-199555585 AACAAACTCAGAGATGAAAAAGG + Intergenic
920384371 1:205558309-205558331 AAAAAAATCAGAAATGAAAAGGG + Intergenic
920596385 1:207275590-207275612 AAAAAAATCAGAGATGAAAAAGG - Intergenic
921073254 1:211679366-211679388 AAAAATTTCAGAGAAGAAATTGG - Intergenic
921295813 1:213701762-213701784 AATAAATCCAGAGATGAAAAAGG - Intergenic
921952780 1:220948665-220948687 AATAAATTAAGAGATATACTAGG - Intergenic
922848174 1:228706797-228706819 AAATAATTCAGTAAAGTAATAGG - Intergenic
922965104 1:229683453-229683475 ATAAAAATCAGAGATGAAAGTGG - Intergenic
922986406 1:229869269-229869291 TTATAATTCAGTGATGTAATTGG + Intergenic
923170135 1:231408279-231408301 AAAGAATTCACAGATGTGCTGGG + Intronic
923333047 1:232943514-232943536 CAAAAAGTCAGAGAAGTATTAGG - Intergenic
923557853 1:235015080-235015102 AATGAGTTCAGAGAAGTAATAGG + Intergenic
923558034 1:235016838-235016860 ATAAAATTCAGGGAAGTATTAGG + Intergenic
923768892 1:236919798-236919820 ATAAAATTAAGAGATGAAAGGGG + Intergenic
923809480 1:237297081-237297103 GAAAAAATCAGGGATGTAAAAGG + Intronic
923886323 1:238161187-238161209 AATAAAATCAGAGATGAAAAAGG - Intergenic
924274251 1:242369233-242369255 AAAATATTGAGAACTGTAATGGG + Intronic
924430366 1:243991219-243991241 CAAAAATTCTTAAATGTAATGGG + Intergenic
924702429 1:246467489-246467511 AAGAAAATCAGAGATGGAAAAGG + Intronic
1062852696 10:757808-757830 AAAAAATACAGAAATGTAATTGG + Intergenic
1064903854 10:20323088-20323110 AAAAAATTAAGAGAGGTAGAAGG + Intergenic
1064932757 10:20645041-20645063 AAAACATTCAGTCATGTAAGTGG + Intergenic
1065070845 10:22022305-22022327 AAATATTTCAGGGATGTAAGAGG + Intergenic
1065272087 10:24044490-24044512 AAAAAAGTCAGAAATGTATCAGG - Intronic
1065341323 10:24709049-24709071 AAAAAAATCAGATATGAAAAAGG + Intronic
1065381191 10:25092211-25092233 AATAAAATCAGAGATGAAAATGG - Intergenic
1066125629 10:32339043-32339065 AAAGGATTTAAAGATGTAATTGG - Intronic
1066672247 10:37852789-37852811 AGAGAACTCAGAGATCTAATAGG + Intronic
1067317777 10:45184867-45184889 AAAAAATGCAGAAATTCAATAGG + Intergenic
1068313916 10:55317343-55317365 AAAAAATTAAGAACTCTAATAGG + Intronic
1068974388 10:62992835-62992857 AAAAAATCCAGAGATATCAGGGG - Intergenic
1069411601 10:68159779-68159801 AAAAAATACAGAAATGCAAAAGG - Intronic
1070578142 10:77696129-77696151 CAGAAATTCAGAGATGCAACTGG + Intergenic
1070896776 10:79990064-79990086 AATAAAATCAGAGATGAAAAAGG + Intergenic
1070995934 10:80781516-80781538 AAAAAATGCCTAGATGTAACGGG + Intergenic
1071701935 10:87948414-87948436 AAAAAATCCATATATGTAAGTGG + Intronic
1071879590 10:89881510-89881532 AATAAAATCAGAGATGAAAAAGG - Intergenic
1071899509 10:90104896-90104918 AATAAAATCAGAGATGAAAAAGG + Intergenic
1072030015 10:91510042-91510064 AAAAAATGAAGACATATAATGGG + Intronic
1072115721 10:92368677-92368699 AAAAAATTAAGAAATAAAATAGG - Intergenic
1072152449 10:92694441-92694463 TAAAAATTAAAAGATGGAATAGG + Intronic
1072282835 10:93884857-93884879 AACAAATTCAGTGAAGTTATAGG + Intergenic
1072367108 10:94723041-94723063 AAAACATTCAGAGATAAATTAGG + Intronic
1072369571 10:94751338-94751360 AATAAAATCAGAGATGAAAAAGG - Intronic
1072385368 10:94920480-94920502 AAATAAATCAGAGATGAAAAAGG - Intergenic
1073387465 10:103138246-103138268 AAAAAACTCAGAGATGTACTGGG - Intronic
1073411792 10:103348868-103348890 AAATTATTCAGAAATGTGATCGG + Intronic
1073529402 10:104217473-104217495 AGAAAATTCAGTGATGTACATGG - Intronic
1073790514 10:106935508-106935530 AAAAAATTCCTAGAAGAAATAGG + Intronic
1073822786 10:107284031-107284053 AAAACATTCAGAAGTGTAAAAGG + Intergenic
1073897185 10:108176084-108176106 AAAAACTTCAGAGATAGAAAAGG + Intergenic
1073964204 10:108969733-108969755 AAAAAATTCTGCAATGTACTTGG + Intergenic
1074189120 10:111120904-111120926 TAAAAATTCAAAGATTTACTAGG - Intergenic
1074340348 10:112622464-112622486 AAAAAAAGAAGAGGTGTAATGGG + Intronic
1074623357 10:115150194-115150216 AACAAAATCAGAAATGTAAAAGG - Intronic
1074626471 10:115193565-115193587 AATAAAATCAGAGATGAAAAAGG - Intronic
1074649544 10:115504858-115504880 CAAAAATACATAGATGTATTAGG + Intronic
1074657732 10:115613869-115613891 AAAACAATCAGAAATGAAATAGG - Intronic
1075154726 10:119965584-119965606 AAAACACTCAGACTTGTAATTGG - Intergenic
1075195260 10:120351794-120351816 AACAAAATCAGAGATGAAAAAGG + Intergenic
1075754395 10:124799619-124799641 AATAAAGTCAGACAAGTAATAGG + Intergenic
1075887872 10:125917439-125917461 AACAAATTTATAGATTTAATTGG - Intronic
1076022297 10:127083992-127084014 AAAAAATTAATATTTGTAATGGG + Intronic
1077241600 11:1513355-1513377 AATGAATTCACAGATGAAATGGG - Intergenic
1077737105 11:4803155-4803177 AAAATATTCACTGATTTAATAGG + Intronic
1078306136 11:10188375-10188397 AAACAATACACAGATGTAGTGGG + Intronic
1078563432 11:12392973-12392995 ATAAAAGCCAGTGATGTAATGGG - Intronic
1078962207 11:16289872-16289894 AAAAAATACAGTGATGAAAATGG + Intronic
1078971492 11:16417527-16417549 AAAATAGACAGAGATGCAATAGG + Intronic
1079473456 11:20803404-20803426 AATAAAATCAGAGACGAAATAGG - Intronic
1079534018 11:21489070-21489092 AAAAAAATCAGAAATGAAAAAGG + Intronic
1079558214 11:21788147-21788169 AAGAAAATCAGAGATGAAAAAGG - Intergenic
1079565976 11:21883301-21883323 AAAAAAATCACAGATGAAAAAGG + Intergenic
1079935515 11:26610987-26611009 AATAAAATCAGAGATGAAAAAGG - Intronic
1080083983 11:28256553-28256575 AATAAAATCAGAGATGAAAAAGG - Intronic
1080097064 11:28420997-28421019 AAAAAAGTCAGAGATGAAATGGG + Intergenic
1080102819 11:28478962-28478984 AAACAATAGAGAGATGTATTTGG + Intergenic
1080488851 11:32740540-32740562 AATAAAATCAGAGATGAAAAAGG - Intronic
1080952735 11:37054750-37054772 GAAAAGTTCAAAGATGGAATAGG - Intergenic
1080989865 11:37519012-37519034 AATAAAATCAGAGATGAAAAAGG + Intergenic
1081012304 11:37829665-37829687 ACAAAATTCCGTGATGTAAATGG + Intergenic
1081177104 11:39941895-39941917 AAAAAAATCAGAAATGAAAGAGG - Intergenic
1081422466 11:42887035-42887057 AATAAAATCAGAGATGAAAAAGG + Intergenic
1082548251 11:54360898-54360920 ATAAACTTCACAGAAGTAATCGG + Intergenic
1082548566 11:54364991-54365013 ATAAAATTCCCAGAAGTAATCGG + Intergenic
1082550936 11:54396729-54396751 ATAAACTTCACAGAAGTAATCGG + Intergenic
1082553293 11:54528011-54528033 ATAAACTTCACAGAAGTAATCGG + Intergenic
1082732098 11:56811542-56811564 AAAAAATTCTAAAATGTATTTGG - Intergenic
1085439596 11:76546668-76546690 AAAAAATTCTGGAATGTAACTGG + Intronic
1085748861 11:79141282-79141304 AATAAAATCAGAGATGAAAAAGG + Intronic
1086069058 11:82779540-82779562 AATAAAATCAGAGATGAAAAAGG + Intergenic
1086287372 11:85265094-85265116 AAAATATTGAGGAATGTAATAGG - Intronic
1086601014 11:88633658-88633680 AAAAAATTTAGTCAGGTAATTGG - Intronic
1086775507 11:90826983-90827005 AAAAAATATAGAGATTAAATTGG + Intergenic
1086895740 11:92309950-92309972 AAAAAAAACAGAGATCTAACAGG - Intergenic
1087178286 11:95116342-95116364 AATAAAATCAGAGATGAAAAAGG - Intronic
1087200864 11:95343095-95343117 AAAAAATTGAAAGATGTCAGGGG - Intergenic
1087292658 11:96337297-96337319 AAAAAGTTGAGAGCTGTAAGTGG - Intronic
1087330097 11:96770458-96770480 ATGAAATTCAGAGAGGAAATAGG - Intergenic
1087402083 11:97680474-97680496 AATAAATACAGAGATGAAAAAGG - Intergenic
1087694145 11:101356484-101356506 AATAAAATCAGAGATGAAAAAGG + Intergenic
1087876273 11:103361748-103361770 AAAAAATTTAGAGTTATTATAGG + Intronic
1087879935 11:103404239-103404261 AAGAAATTCATAGAGGTTATGGG + Intronic
1088021102 11:105120530-105120552 AAAAAATTGTGGGAGGTAATAGG + Intergenic
1088061971 11:105664639-105664661 AAAAAAATAAGATTTGTAATTGG - Intronic
1088272984 11:108054362-108054384 AAAACATTCACAGAAGCAATGGG - Intronic
1088601469 11:111481173-111481195 ATAAATTTCAGAGATAAAATAGG + Intronic
1088985513 11:114903263-114903285 AATAAAATCAGAGATGAAAAAGG + Intergenic
1090132671 11:124160934-124160956 AAAAAATAAAGAAATGTAAGAGG - Intergenic
1090303211 11:125665827-125665849 AATAAAATCAGAGATGAAAAAGG - Intronic
1090631894 11:128656838-128656860 AACTAGTTCAGAGATGTGATGGG - Intergenic
1092533935 12:9368753-9368775 AACAAACTCAGAGATGAATTAGG - Intergenic
1092639587 12:10489941-10489963 AAAAAAATCAGAGATGAACAAGG - Intergenic
1092679610 12:10963699-10963721 AAAAAAGTCATATCTGTAATAGG - Intronic
1092685629 12:11042255-11042277 AATAAAATCAGAGATGAAAATGG + Intronic
1092980029 12:13785395-13785417 AAAAATGTCAGAGATGGAATTGG - Intronic
1093061034 12:14604301-14604323 AAAAAATTCAAAGATGAAAAAGG - Intergenic
1093120842 12:15269197-15269219 AAAAAATTGAGAATTGAAATGGG - Intronic
1093607864 12:21115378-21115400 AACAAAATCAGAGATGAAAAAGG - Intronic
1093654439 12:21678268-21678290 ATAAAATTCAGAGGTTTTATGGG - Intronic
1093827828 12:23716226-23716248 AATTAATTCAGAGATGAAGTCGG + Intronic
1093876613 12:24355955-24355977 AAAAAATAGAAAGATGCAATTGG + Intergenic
1093901120 12:24634488-24634510 AAAAAATTCACAGAAATACTTGG - Intergenic
1093987899 12:25558133-25558155 AATAAAGTCAGAGATGAAAAAGG - Intronic
1094258865 12:28468220-28468242 AATAAAATCAGAGATGAAAAAGG + Intronic
1094420082 12:30262003-30262025 AAAAAAATCAGAGATGAGAAAGG + Intergenic
1094632178 12:32186718-32186740 AAAAAATTCAGAAATGAATATGG - Intronic
1095094703 12:38140093-38140115 AAAAGAGACAGAGATGTAAAGGG - Intergenic
1095181430 12:39150859-39150881 AATAAAATCAGAGATGAAAAAGG - Intergenic
1095228534 12:39705107-39705129 AATAAAATCAGAGATGAAAAAGG + Intronic
1095360976 12:41338594-41338616 AATAAAATCAGAGATGAAAATGG + Intronic
1095433377 12:42158852-42158874 TAAAAATTTAAAAATGTAATAGG - Exonic
1095634057 12:44410457-44410479 ACAAAATTCAGATATGACATAGG + Intergenic
1096369753 12:51059111-51059133 AGAAAATTCAGAGATGGTAATGG - Intronic
1096512142 12:52136660-52136682 AAAAATTTCAGAGCTGGAAGGGG - Intergenic
1096909501 12:54968056-54968078 GAAAAATTCATAGAAGTAGTTGG + Intronic
1097120232 12:56725770-56725792 TAAAACTTGAGAGATGTGATGGG + Intronic
1097491227 12:60272116-60272138 CAAAAAGTAAGAGATGCAATTGG - Intergenic
1097588038 12:61538597-61538619 TAAAAATTCAGTGAGCTAATGGG - Intergenic
1097714398 12:62950964-62950986 AAAAAAATCAGAGATAAAAAGGG - Intergenic
1097898209 12:64847236-64847258 AACAAACTCAGAGATGAAAAAGG - Intronic
1097904769 12:64908455-64908477 AAGGAGTTCAGAGATGGAATAGG - Intergenic
1098047533 12:66416549-66416571 AATAAAGTCAGAGATGAAAAAGG + Intronic
1098489996 12:71064409-71064431 AAAACATTCAGAAGGGTAATAGG - Intronic
1098504253 12:71230912-71230934 AATAAAATCAGAGATGAAAAAGG + Intronic
1098550680 12:71758015-71758037 AAAAAATTTAAAAATGAAATGGG - Intronic
1098583401 12:72128729-72128751 AAAACATTCAGAGATTTAACAGG + Intronic
1098697948 12:73583265-73583287 AAAAAAATCAGGGATATACTGGG + Intergenic
1098730412 12:74029607-74029629 AAATAATTCAGTGATTTAAAGGG - Intergenic
1099024812 12:77452006-77452028 AAATAAATCAGAGATGAAAAAGG + Intergenic
1099043169 12:77681141-77681163 TCAAAATTAAAAGATGTAATAGG - Intergenic
1099321271 12:81152850-81152872 AAAAAATACAGAAATGAAATAGG + Intronic
1099381113 12:81953953-81953975 AACAAATTGAGAGATATATTTGG + Intergenic
1099495547 12:83341758-83341780 AATAAAATCAGAGATGAAAAAGG + Intergenic
1099632688 12:85170764-85170786 AAAAATTTCAGTGAAGTCATTGG + Intronic
1099743593 12:86672563-86672585 AACAAAATCAGAGATGAAAAAGG + Intronic
1100029913 12:90173961-90173983 AAAAAAATCAGAGAAAAAATGGG + Intergenic
1100072737 12:90740987-90741009 AAAAAAGGCAGAAATGTATTAGG - Intergenic
1100328456 12:93564225-93564247 CAAAAATTCAGAGACGTTAGGGG + Intergenic
1100766561 12:97872594-97872616 AAAAAATAAAGAGGTTTAATTGG + Intergenic
1100815939 12:98387181-98387203 AAAAAATCCAGATAAGTAACTGG - Intergenic
1100923635 12:99518561-99518583 AATAAATTCAGAGATGAAAAAGG - Intronic
1101025847 12:100605351-100605373 AATAAAATCAGAGATGAAAAAGG - Intronic
1101162277 12:101990691-101990713 AATAAAATCAGAGATGAAAAAGG - Intronic
1101198038 12:102405706-102405728 AAAATATTCAGGAATGAAATGGG + Intronic
1101226993 12:102698387-102698409 AATAAATTCAGAGATGAAAGAGG + Intergenic
1101352776 12:103947958-103947980 AAAAAATTCAGCCAAGTATTAGG - Intronic
1101389815 12:104290072-104290094 AAAAATTACAGAGATATAAATGG - Intronic
1101494210 12:105237958-105237980 AGAAAATGCAGAAAAGTAATGGG - Intronic
1101798123 12:107996079-107996101 AATAAAATCAGAGATGAAAAAGG - Intergenic
1102312836 12:111860426-111860448 AGAACATCCAGAGATTTAATGGG - Intronic
1103306357 12:119967691-119967713 GAGAAAGTCAGAGATGTACTGGG - Intergenic
1103756027 12:123207875-123207897 AAAAAATACAGAGGTGAAATAGG + Intronic
1104327279 12:127811296-127811318 AATAAAATCAGAGCTGTATTAGG - Intergenic
1104675919 12:130712258-130712280 AAAAAATTAAGAAATGTATAAGG - Intronic
1105056556 12:133105669-133105691 AAGAAAATCAGGGATGTATTAGG + Exonic
1105269048 13:18853695-18853717 ATTAAATTCAGAGACATAATAGG - Intergenic
1105613412 13:21989101-21989123 AAAAATTTCAAAGAGGTAAGTGG + Intergenic
1105720877 13:23112657-23112679 CAAAAATTCAGAGATTTGGTTGG + Intergenic
1105835288 13:24205428-24205450 AAAGAAATCAGAGATGCAAATGG + Intronic
1106444018 13:29807531-29807553 TAAAAATTCATAGAATTAATAGG - Intronic
1106528132 13:30561561-30561583 AAAAAAGTCAGTGAAGTAGTAGG + Intronic
1106644811 13:31621490-31621512 AATAAAATCAGAGATGAAAAAGG - Intergenic
1106963358 13:35028607-35028629 AAAAGATACAGAGATCTAAAAGG - Intronic
1107021092 13:35752322-35752344 AACAAAATCAGAGATTTAAAAGG - Intergenic
1107369919 13:39733973-39733995 AATAAAATCAGAGATGAAAAAGG - Intronic
1107582580 13:41806981-41807003 AATAAAATCAGAGATGAAAAAGG + Intronic
1107625339 13:42276198-42276220 TAAAAATTAAGAGATTTACTTGG - Intronic
1107807546 13:44168462-44168484 AACAAAATCAGAGATGAAAAAGG - Intergenic
1107893863 13:44938673-44938695 AATAAATAAAGAGAGGTAATCGG + Intergenic
1107998095 13:45881149-45881171 AATAAAATCAGAGATGAAAAAGG + Intergenic
1108045956 13:46385316-46385338 AAAACAATCAGAGATCTAATTGG + Intronic
1108366163 13:49716366-49716388 AAATAAGGCAGAGATTTAATAGG - Intronic
1108906006 13:55474401-55474423 AAAAAACTCAGTGATGCACTTGG + Intergenic
1108985786 13:56585496-56585518 ACAAAACAAAGAGATGTAATTGG + Intergenic
1108995471 13:56728660-56728682 ATACAATTCAGAGATATCATAGG + Intergenic
1109095701 13:58113080-58113102 AAGAAATTCAGGCATGTATTAGG + Intergenic
1109100414 13:58177339-58177361 AATAAAATCAGAGATGAAAAAGG - Intergenic
1109181096 13:59214966-59214988 ACAAAATTCAGAGAAGTTAAGGG + Intergenic
1109469579 13:62788089-62788111 AAAAACTTGAGAGATGCACTCGG + Intergenic
1109473650 13:62847354-62847376 AAAATAAGCAGGGATGTAATTGG - Intergenic
1109753444 13:66726271-66726293 GAAAGAGTCAGAGTTGTAATAGG + Intronic
1109773833 13:67013726-67013748 AAAAAAATCAAAGATTAAATAGG + Intronic
1110038177 13:70715779-70715801 AAAAAATTCAAAGATGTCCTTGG - Intergenic
1110098323 13:71560997-71561019 AAAAAAATCTAAAATGTAATTGG + Intronic
1110157682 13:72338265-72338287 ATAAAAATCAGAGATGAAAAAGG + Intergenic
1110518977 13:76451855-76451877 AATAAAATCAGAGATGAAAAAGG + Intergenic
1110781974 13:79477149-79477171 AAAAGATTCAGAGATAAAACTGG + Intergenic
1110974455 13:81811944-81811966 AATAAATTAAGAGATGAAAAAGG + Intergenic
1111108681 13:83678633-83678655 AAAAAAATGAAAGATGCAATAGG + Intergenic
1111432961 13:88167543-88167565 ACAAGATGCAGAGATGTGATGGG + Intergenic
1111714227 13:91859002-91859024 AATAAAATCAGAGATGAAAAAGG - Intronic
1111831323 13:93333696-93333718 AAAAAATAGAGAAATGTAACTGG - Intronic
1112548025 13:100390774-100390796 AACAATTTCAGTGTTGTAATGGG + Intronic
1112551717 13:100427683-100427705 AATAAACTCAGAGAGGTAAATGG + Intronic
1112658385 13:101477611-101477633 AATAAAATCAGAGATGAAAAAGG + Intronic
1112973680 13:105291075-105291097 CAAAAATGCTGAAATGTAATTGG + Intergenic
1114167945 14:20241089-20241111 AAAAGAATCTGAGATGAAATGGG - Intergenic
1114234092 14:20809735-20809757 AAAAAATTAAGAAATAAAATAGG - Intergenic
1115134506 14:30092469-30092491 AATAAAATCAGAGATGAAAAAGG + Intronic
1115297744 14:31848566-31848588 AAACATTTCAGACATATAATAGG - Intronic
1115666692 14:35557804-35557826 AAAAAATTTACAGATTTAAAAGG + Intronic
1115762423 14:36588710-36588732 AAAAAATACAAACATGTATTAGG - Intergenic
1115828955 14:37312938-37312960 AAAAAATTTAGAATTTTAATTGG + Intronic
1116080063 14:40160847-40160869 AATAAAATCAGAGATGAAAAAGG + Intergenic
1116140596 14:40988744-40988766 AAAATAATCAGAGATGAAAAAGG - Intergenic
1116217260 14:42032922-42032944 AAAAAAATCATAGCTGAAATTGG - Intergenic
1116418082 14:44702214-44702236 AACCAATTCAGAGATGCTATGGG + Intergenic
1116434568 14:44881982-44882004 AATAAAATCAGAGATGAAAATGG + Intergenic
1116521625 14:45855063-45855085 AATAAAATCAGAGATGAAAAAGG - Intergenic
1116766262 14:49074190-49074212 AATAAAATCAGAGATGAAAAGGG + Intergenic
1116775521 14:49176613-49176635 AATAAAATCAGAGATGAAAAAGG + Intergenic
1116809886 14:49529169-49529191 AATAAAATCAGAGATGAAAAAGG + Intergenic
1116857803 14:49968862-49968884 AAGAAATTCACAAATGCAATTGG - Intergenic
1116971604 14:51071834-51071856 AAAGAATTCTGAGCTGTATTTGG + Intronic
1117110644 14:52450223-52450245 AATAAAATCAGAGATGAAAAAGG + Intronic
1117122025 14:52578459-52578481 AAAAAATTCAGAGAATAAAAAGG - Intronic
1117567023 14:57003741-57003763 AAAATATTAAGAGAGTTAATTGG - Intergenic
1117634483 14:57727267-57727289 AATAAAATCAGAGATGAAAAAGG - Intronic
1117706384 14:58473917-58473939 AAAAAGTAAAGAGATTTAATTGG + Intronic
1117842736 14:59877310-59877332 AAATAAATCAGAGATGCAAAAGG - Intergenic
1118114104 14:62755225-62755247 AATAAAATCAGAGATGAAAAAGG + Intronic
1118125528 14:62899004-62899026 GAAAAATTCACAAAAGTAATTGG + Intronic
1118218400 14:63831243-63831265 ACAAAATTCAGATATGCAAGGGG - Intergenic
1118300379 14:64609957-64609979 GAAAGGTTCAGAGATGTGATTGG + Intergenic
1118548990 14:66928376-66928398 AATAAAATCAGAGATGAAAAAGG - Intronic
1118798101 14:69163138-69163160 AATAAATTCAGAAATGAAAAAGG + Intergenic
1118896259 14:69948318-69948340 AAAAAGTTCAGAGATAGCATGGG - Intronic
1119015012 14:71041549-71041571 AATAAAATCAGAGATGAAAAAGG - Intronic
1119151718 14:72366419-72366441 GAAAAATTAAGAGCTGTAAGGGG + Intronic
1119637639 14:76289750-76289772 AAAAAAGTCAGAGAGGAAATGGG + Intergenic
1120100609 14:80441015-80441037 AATAAAATCAGAGATGAAAAAGG + Intergenic
1120382524 14:83799015-83799037 AGAAAAATCAGAAATGTTATAGG + Intergenic
1120579921 14:86233823-86233845 AATAAAATCAGAGATGAAAAAGG + Intergenic
1120631368 14:86895659-86895681 ACTAAATTCACAGATGAAATAGG - Intergenic
1120697739 14:87663247-87663269 AATAAAATCAGAGATGAAAAAGG + Intergenic
1120879403 14:89403356-89403378 AAAAAATACAGAGATTAATTGGG - Intronic
1121059410 14:90891311-90891333 AAATATTTCTGAAATGTAATGGG - Intronic
1121130732 14:91444245-91444267 AATAAAATCAGAGATGAAAAAGG + Intergenic
1121294932 14:92812582-92812604 AGAAATTTCAGACATGTAGTAGG - Intronic
1121543328 14:94745019-94745041 AAATAATTTAAATATGTAATGGG + Intergenic
1121758243 14:96421184-96421206 AAATAACTCAGAGTTGTAATGGG + Intronic
1121907525 14:97760684-97760706 AAAAAATGCAGAAATGTAAATGG - Intronic
1121943886 14:98100228-98100250 ACATAATTCAGAGAAGGAATTGG + Intergenic
1122435908 14:101698110-101698132 AATAAAATCAGAGATGAAAAAGG + Intergenic
1123111749 14:105873075-105873097 AATAAAATCAGAGATGAAAAAGG - Intergenic
1123137255 14:106039433-106039455 AAAATATTTGGAGATGTCATTGG + Intergenic
1123152470 14:106196458-106196480 AAAAAATGTAGAGATGACATTGG + Intergenic
1123172634 14:106389150-106389172 AAAAAATGTAGAGATGACATTGG + Intergenic
1202870276 14_GL000225v1_random:156625-156647 AACAAATTTATAGATTTAATTGG + Intergenic
1123451574 15:20366985-20367007 AAAAAATTCAAACATTTAAAGGG + Intergenic
1124091184 15:26603054-26603076 AATAAAATCAGAGATGAAAAAGG + Intronic
1124108243 15:26761604-26761626 AATATATTCAAAGATGGAATGGG + Intronic
1124238493 15:28010477-28010499 TAAAAACTCTGAGAAGTAATAGG + Intronic
1125214545 15:37255748-37255770 AATAAAATCAGAGATGAAATAGG + Intergenic
1125276703 15:38000368-38000390 AAAAAATTCTGAGATGAAAAAGG - Intergenic
1125337909 15:38646057-38646079 AATAAATTCATAGATGAATTAGG + Intergenic
1126052818 15:44702337-44702359 AATAAAATCAGAGATGAAAAAGG - Intronic
1126453001 15:48830354-48830376 ACAAAATTTAAAAATGTAATTGG - Intronic
1126536041 15:49765862-49765884 AATAAAATCAGAAATGCAATAGG - Intergenic
1127132996 15:55887286-55887308 AATAAAATCAGAGATGAAAATGG + Intronic
1127331520 15:57944487-57944509 AGAATATTCAGAGAAGAAATGGG + Intergenic
1127406510 15:58654058-58654080 AATAAAATCAGAGATGAAAAAGG - Intronic
1127493513 15:59487546-59487568 AATAAAATCAGAGATGAAAAAGG + Intronic
1127572378 15:60256788-60256810 TAGAAATTCAGAGTTATAATGGG + Intergenic
1127700585 15:61496382-61496404 AAAAATTTAAGAGATGGATTAGG - Intergenic
1127928889 15:63577259-63577281 ATAATATTCAGAGATCAAATAGG + Intronic
1129282407 15:74496076-74496098 AAAAAATTTATAGATGTAGAAGG + Intergenic
1129562070 15:76580939-76580961 AATAAAATCAGAGATGAAAAAGG + Intronic
1129736617 15:77969639-77969661 AAAAAATTCAAAAATTTAATAGG - Intergenic
1129835071 15:78698457-78698479 AAAAAAATCAAAGATGAAAAAGG - Intronic
1130962259 15:88668995-88669017 AATAAAATCAGAGATGAAAAAGG + Intergenic
1131235867 15:90696588-90696610 AAAAAATTGACAGATTTATTAGG + Intergenic
1132279388 15:100600090-100600112 AACAAATTTAAAGATGTAAATGG + Intronic
1132743062 16:1425544-1425566 AAAAAATAAAAAGATGTATTGGG - Intergenic
1134514791 16:14878330-14878352 AAAAAATACAGAAATGTAGTTGG + Intronic
1134702468 16:16276988-16277010 AAAAAATACAGAAATGTAGTTGG + Intronic
1134781394 16:16899955-16899977 AATAAAATCAGAGATGGAAATGG - Intergenic
1134965075 16:18435127-18435149 AAAAAATACAGAAATGTAGTTGG - Intronic
1134969362 16:18517662-18517684 AAAAAATACAGAAATGTAGTTGG - Intronic
1135900168 16:26451136-26451158 AAAAAAAAAAAAGATGTAATAGG - Intergenic
1135947820 16:26880801-26880823 CAAACATTCAGAAATGGAATTGG + Intergenic
1137997810 16:53238109-53238131 TAAAAAATCAGACATCTAATGGG + Intronic
1138300531 16:55924564-55924586 AAAAAATTCTGAAATGTATATGG + Intronic
1138397232 16:56714556-56714578 TAAAAATTCAGAGGTGTGAAGGG - Intronic
1138411237 16:56842026-56842048 AAAAAATAAAAAGATGTACTAGG + Intronic
1138864981 16:60806885-60806907 AATAAAATCAGAGATGAAAAAGG + Intergenic
1138918812 16:61501787-61501809 TTAAAAATCATAGATGTAATGGG + Intergenic
1139027075 16:62831681-62831703 AATAAATTCAAAGATGAAAATGG + Intergenic
1139091669 16:63655679-63655701 AGAAAATTCAGTGACTTAATGGG + Intergenic
1140025639 16:71288331-71288353 AAAAAATACAGCGAGGTAAGAGG - Intronic
1140157786 16:72451447-72451469 AATAAAATCAGAGATGCAAAAGG - Intergenic
1140344020 16:74194786-74194808 AGAAAATTGAGAGATGTCAGAGG - Intergenic
1140998394 16:80283933-80283955 GAGACATTCAGAGTTGTAATGGG - Intergenic
1141010953 16:80398322-80398344 AACAAAATCAGAGATGAAAAAGG + Intergenic
1143206176 17:5140577-5140599 AAAAAATTAAGAAATGTAATGGG + Intronic
1144196426 17:12899448-12899470 AACACATTAAGAGATGTAATAGG + Intronic
1144276156 17:13670423-13670445 AAAAAAATCAGAAATGAAAAAGG + Intergenic
1144789401 17:17849072-17849094 AAAAAATTCAAACATGTTTTAGG + Intronic
1145799736 17:27675271-27675293 AAAATATTCAGAAATGAAATTGG + Intergenic
1145854165 17:28136174-28136196 AAAAAATTAAGTGATATGATAGG - Intronic
1146071791 17:29688818-29688840 AAAAAATTCTGAAATGTGAGGGG + Intronic
1146309214 17:31754224-31754246 TAAAAATTCAGAAAAGTAGTTGG + Intergenic
1146387633 17:32391383-32391405 AAAAAGTTCTAAGATGAAATGGG - Intergenic
1149156542 17:53637200-53637222 ACCAAATTAAGACATGTAATTGG + Intergenic
1149555006 17:57567298-57567320 AAAAGCTACAGAAATGTAATTGG - Intronic
1149831244 17:59873887-59873909 ATAAAATACTGAGATATAATTGG + Intronic
1149907403 17:60538763-60538785 AAAAAATACAAAAATGTACTGGG + Intergenic
1149951226 17:60988744-60988766 AATAAAATCAGAGATGAAAAAGG - Intronic
1150185253 17:63173844-63173866 AAAAAATTAAGTGATGTAACTGG + Intronic
1150854818 17:68741649-68741671 AAAAACTTCAAAGATTTGATAGG - Intergenic
1150864839 17:68838902-68838924 AATATATTCAGCAATGTAATGGG - Intergenic
1150933292 17:69608772-69608794 AATAAACTCAGAGGAGTAATAGG + Intergenic
1151019815 17:70602123-70602145 AAATAACTCAGAGATGGCATTGG + Intergenic
1151503466 17:74508865-74508887 AATAAAGTCAGAGATGAAAAAGG - Intergenic
1151913425 17:77100001-77100023 AAAAAATTCATAGAACTAAAAGG + Intronic
1153572994 18:6492142-6492164 CAAAATTTAAGAGATCTAATTGG + Intergenic
1153698989 18:7673683-7673705 AAAACATTCAAAGGTATAATAGG + Intronic
1154085590 18:11302561-11302583 AATAAAATCAGAGATGAAAAAGG - Intergenic
1154418980 18:14206294-14206316 ATTAAATTCAGAGACATAATAGG + Intergenic
1155112996 18:22735058-22735080 AAAACATTCAGTGATGCAGTAGG - Intergenic
1155129225 18:22913834-22913856 AAATAATTCAGAGTTCTAGTGGG - Intronic
1155275868 18:24186928-24186950 AAAAAATTCAGACAGGCAAAAGG + Intronic
1155411280 18:25547864-25547886 AATAAAATCAGAGATGAAAATGG + Intergenic
1155760607 18:29560658-29560680 AAAAAATACCAAGATTTAATAGG + Intergenic
1155981965 18:32189419-32189441 AAAGAATTAAGAGATGGATTGGG + Intronic
1156135789 18:34035767-34035789 AAAAAAATCAGAAATGAAAATGG + Intronic
1156147197 18:34197946-34197968 AAAATATTCTAAGAAGTAATGGG + Intronic
1156375425 18:36511138-36511160 AAAAACCTCAGTGATGTAAATGG - Intronic
1157006004 18:43585725-43585747 AAAAAATTCAAGGATGAAATTGG - Intergenic
1157089342 18:44617804-44617826 AATAAAATCAGAGATGAAAAAGG + Intergenic
1157243340 18:46032090-46032112 GAAAAATTCAGATAGGTAGTAGG - Intronic
1157691713 18:49687862-49687884 AAAAAATTCAGTAAAGTAACAGG + Intergenic
1157834968 18:50892606-50892628 AATAAGTTAAGATATGTAATAGG - Intronic
1158103046 18:53852506-53852528 AAAAAATTAAGAGTTCTAGTTGG - Intergenic
1158109344 18:53923182-53923204 AAAAACATCAGATATCTAATAGG + Intergenic
1158127426 18:54116784-54116806 AAACAAGTCTGAGATGTAACTGG + Intergenic
1158161477 18:54489593-54489615 AAAAAAATCACAGCTGGAATAGG - Intergenic
1158236215 18:55317849-55317871 ATAAAGTTCAGAGATGAAACTGG - Intronic
1158423502 18:57317323-57317345 AATAAAATCAGAAATGGAATAGG - Intergenic
1158431625 18:57393284-57393306 AATAAAATCAGAGATGAAAAAGG + Intergenic
1158729954 18:60011447-60011469 AAAAAAATAAGAGGTTTAATTGG + Intergenic
1158856600 18:61549063-61549085 AAAAATTTGAGAGATGTAGTAGG - Intronic
1159166423 18:64706822-64706844 AAAAGACTCAGAGATGAAGTAGG - Intergenic
1159318990 18:66821140-66821162 AATAAATTCACAGATGAAAAAGG - Intergenic
1159339340 18:67115092-67115114 AATAAAATCAGAGATGAAAAAGG - Intergenic
1159500705 18:69265513-69265535 AGAAATTTTAGAAATGTAATAGG + Intergenic
1159553755 18:69923570-69923592 AAAAAATTAAGAGGATTAATGGG + Intronic
1159665958 18:71160485-71160507 AAAAAATTAAGAGAAGAAAATGG - Intergenic
1160087205 18:75787431-75787453 AATAAATACAGAGATAGAATAGG + Intergenic
1160183119 18:76653256-76653278 AATAAAATCAGAGATGAAAAAGG - Intergenic
1160239114 18:77110445-77110467 AAAAAATTCACATATGTCATAGG - Intronic
1160572067 18:79824365-79824387 AAAAAATTCAGAAAAGTAGCAGG - Intergenic
1161868402 19:6851951-6851973 AAAAATTTCAGACAAGTTATTGG + Intronic
1162593697 19:11610824-11610846 AAAGAGTTCAGTGATCTAATTGG - Intronic
1163969713 19:20780455-20780477 TTAAAATTCAGAGAGGTTATGGG + Intronic
1164267144 19:23630096-23630118 AAAAAATTCAACAATTTAATAGG + Intronic
1164492020 19:28723674-28723696 GAAAAATTCACAGCTGTAATTGG + Intergenic
1164547156 19:29176979-29177001 AATAAAATCAGAGATGAAAAAGG + Intergenic
1164875590 19:31683922-31683944 AATAAATTCTGAAATGTAAGTGG - Intergenic
1166017146 19:39990850-39990872 AAGAAAATCAGAAATGAAATAGG + Intronic
1167237793 19:48325577-48325599 AAAAAAGTCAGAGCTGGAGTCGG - Exonic
1168570962 19:57469066-57469088 AAAAACTTCAGAGATATAGAGGG + Intronic
925047136 2:781062-781084 ATAAAATACAGAGATGAAATAGG - Intergenic
925074968 2:1008701-1008723 AAAAAATACAGTAATGTAAAAGG + Intronic
925497384 2:4467467-4467489 ATATAATTCAGATATATAATAGG - Intergenic
925698650 2:6610651-6610673 GATAAAATCAGAGATGTAAACGG - Intergenic
925765510 2:7230871-7230893 ACAAATTGCAAAGATGTAATTGG - Intergenic
926211895 2:10877600-10877622 AAAAAATTACGACATGTAAAGGG + Intergenic
926444348 2:12925371-12925393 AGAAAATTCAGCAATGTAAAGGG + Intergenic
926833682 2:16993569-16993591 AATAAAATCAGAGATGAAAAAGG - Intergenic
927341371 2:21987226-21987248 AAAAAACTCAGAGAAGAAAAGGG - Intergenic
927800116 2:26090952-26090974 AAAAAATTCTGATATCTCATTGG + Intronic
928384556 2:30854925-30854947 AATAAATTCAAAGATGAAAAAGG + Intergenic
928535864 2:32240642-32240664 AAAAAATTCATAAATGAAATAGG - Intronic
928713127 2:34029680-34029702 AAAAAATCCAGAGATGGTTTTGG + Intergenic
928790069 2:34939482-34939504 TAGAAATTCACAGATGAAATAGG - Intergenic
928847521 2:35695439-35695461 AACAAAGTCAGAGATGAAAAGGG - Intergenic
928863675 2:35892033-35892055 AATAAAATCAGAGATGAAAAAGG - Intergenic
929100365 2:38306035-38306057 AATAAAATCAGAGATGAAAAAGG + Intronic
929415712 2:41745011-41745033 AAAAAAAAAAGAGGTGTAATTGG - Intergenic
929528662 2:42731056-42731078 AATAAAATCAGAGATGAAAAAGG - Intronic
930179418 2:48337830-48337852 AAAAAATTAACAGATGTACAAGG + Intronic
930230402 2:48837505-48837527 AATAAAATCAGAGATGAAAAAGG - Intergenic
930309089 2:49714929-49714951 ACAAAATTCAGAGAATTAACAGG - Intergenic
930326830 2:49930521-49930543 AAAAATTTAATAGATGTTATTGG - Intronic
930778695 2:55201309-55201331 AATAAAATCAGAGATGAAAAAGG + Intronic
930920955 2:56753145-56753167 AAAATATTCACAGAGTTAATGGG - Intergenic
931145861 2:59517518-59517540 AAAAAATTTAGAGATTTCAAAGG - Intergenic
931401666 2:61937033-61937055 AAAATATTCAGATTGGTAATTGG + Intronic
931936700 2:67206076-67206098 AAATAATTCAGAGCTGGAAAAGG + Intergenic
932097224 2:68861949-68861971 CAGAAATTCAGAGATGTGATTGG - Intergenic
932184482 2:69681351-69681373 AAAAAAATCAGAAATGAAAAAGG - Intronic
932233823 2:70105340-70105362 AAAACATTCAGAGAAATAAAGGG - Intergenic
932626928 2:73304390-73304412 AAAAAAACCACAGATGTTATTGG - Intergenic
932889832 2:75583677-75583699 AATAAAATCAGAGATGAAAAAGG + Intergenic
932920771 2:75912396-75912418 AATAAAATCAGAGATGAAAAAGG - Intergenic
932937275 2:76119071-76119093 AAATAAATCAGAACTGTAATAGG - Intergenic
933068298 2:77826712-77826734 AATAAAATCAGAGATGAAAAAGG - Intergenic
933090972 2:78116100-78116122 AGAAAATTTAGAGATAAAATTGG + Intergenic
933297931 2:80511779-80511801 AAAAGATACAGATATGTAGTTGG - Intronic
933507134 2:83191789-83191811 AAAACATTCAGAGCTATTATAGG - Intergenic
934874072 2:97898053-97898075 AAAAAAATCAGTAATGAAATAGG - Intronic
935576188 2:104713321-104713343 AATAAAATCAGAGATGAAAAGGG - Intergenic
935860478 2:107323905-107323927 AAATAATTCAGAGTTGAAATTGG + Intergenic
936634937 2:114245076-114245098 AAAAGATACAGAAATGTATTGGG - Intergenic
936829994 2:116632350-116632372 AAAAAATAAAGAGGTTTAATTGG + Intergenic
936838255 2:116735297-116735319 AACAAAATCAGACATGAAATAGG + Intergenic
936965183 2:118120554-118120576 TAAAAATTGAGAGATGTAAGAGG - Intergenic
937532976 2:122852506-122852528 GAAAAAGTCACAGATTTAATTGG - Intergenic
937864995 2:126743711-126743733 AAAAAAAAGAAAGATGTAATTGG + Intergenic
938591100 2:132736943-132736965 ACCAGAATCAGAGATGTAATTGG - Intronic
939205502 2:139097224-139097246 CAAAAATTTAGAAATGAAATAGG + Intergenic
939273885 2:139974663-139974685 AAATAAATCAGAGATATAAAAGG + Intergenic
939329384 2:140737761-140737783 AAATTAAACAGAGATGTAATAGG - Intronic
939361789 2:141182208-141182230 AAAATATTTAGATATTTAATAGG + Intronic
939575579 2:143891140-143891162 AACAAATTTAGAGATCAAATTGG - Intergenic
939813222 2:146861192-146861214 AAAAAAATCAAAGAAATAATAGG + Intergenic
940152235 2:150615345-150615367 TAAAAAATTAGACATGTAATTGG + Intergenic
940252510 2:151694637-151694659 AAAAAATTCAGCAAAGGAATTGG + Intronic
940327575 2:152441840-152441862 AAAAAATTGAGAGAGGGACTTGG + Intronic
940400166 2:153240170-153240192 AATAAAATCAGAGATGAAAGAGG - Intergenic
940629988 2:156225976-156225998 AATAAAATCAAAGATGTAAAAGG + Intergenic
940785661 2:157978756-157978778 AATAAAATCAGAGATGAAAAAGG - Intronic
940948054 2:159641016-159641038 AATAAAATCAGAGATGAAAAAGG + Intergenic
941156191 2:161981063-161981085 AAAAAACCCAGACATTTAATAGG + Intronic
941351301 2:164440532-164440554 AAATAATGCAGCGCTGTAATTGG + Intergenic
941523560 2:166579760-166579782 AAATAAATCAGAGATGAAAAAGG - Intergenic
941672196 2:168306477-168306499 AATAAAATCAGAGATGAAAAGGG - Intergenic
941678969 2:168375325-168375347 AATAAAATCAGAGATGAAAAAGG + Intergenic
941706917 2:168668610-168668632 AAAAAATTAAGAAAAATAATTGG - Intronic
942275847 2:174323120-174323142 AAGAAACTCAGAGATGTTAAAGG - Intergenic
942351982 2:175062507-175062529 AAACAATCAAGAAATGTAATTGG - Intergenic
942541636 2:177021096-177021118 ATAGAGTTCAGGGATGTAATAGG - Intergenic
942733759 2:179086949-179086971 AATAAAATCAGAGATGAAAAAGG - Intergenic
942760981 2:179396857-179396879 AAAAAATACTGACATATAATAGG - Intergenic
942899604 2:181098584-181098606 AATAAAATCAGAAATGTAAAAGG + Intergenic
943014273 2:182492124-182492146 AAAAAATTCACAAATCTAAAGGG - Intronic
943132131 2:183867109-183867131 AAAAAATTCAGGGATGGGGTTGG - Intergenic
943142236 2:183997449-183997471 ACAAATTTCAGAGATTTAAAAGG - Intergenic
943154779 2:184160783-184160805 AATAAAATCAGAAATGTAAAAGG - Intergenic
943186986 2:184621851-184621873 AACAAATCCAGAGATTTGATTGG + Intronic
943207898 2:184924414-184924436 AATAAAATGAGAGATGTAAAAGG - Intronic
943429886 2:187785950-187785972 AATAAAATCAGAGATGAAAAAGG + Intergenic
943671261 2:190664331-190664353 AAAAGATATAAAGATGTAATAGG - Intronic
943845376 2:192638905-192638927 AATAAAATCAGAGATGAAAAAGG + Intergenic
943869841 2:192980049-192980071 AGAACATTCAGAGATGTCTTAGG - Intergenic
944004976 2:194893478-194893500 AATAAAATCAGAGATGAAAAAGG - Intergenic
944287224 2:197965410-197965432 AATAAAATCAGAGATGTTAAAGG - Intronic
944359616 2:198837776-198837798 CAATAATTCAGAGTTCTAATAGG - Intergenic
944550794 2:200842822-200842844 AATAAAATCAGAGATGAAAAAGG + Intergenic
944695581 2:202197554-202197576 AAAAAATTTAACGATGTGATAGG + Intronic
945575959 2:211529146-211529168 AAAAAAATTAGAGATGAAAAAGG + Intronic
945757961 2:213873615-213873637 AGAAAATTCACAGATGTAAATGG - Intronic
946662587 2:222017287-222017309 AAAAAAGTCACAAATCTAATAGG + Intergenic
946945489 2:224817725-224817747 AAAAAATTGAGAGAGAGAATTGG + Intronic
947039532 2:225900578-225900600 AATAAAATCAGAGATGAAAAAGG + Intergenic
947206997 2:227670111-227670133 AAACAATGCAGAGAACTAATGGG - Intergenic
947373600 2:229473354-229473376 AATATATTCAGAGATGGTATAGG + Intronic
947429663 2:230015307-230015329 AATAAAATCAGAGATGAAAGTGG + Intergenic
947666103 2:231906560-231906582 AAAGAATTCAGACTTTTAATAGG - Intergenic
947686749 2:232093735-232093757 AATAAAATCAGAGATGAAAAAGG - Intronic
1169258328 20:4116261-4116283 GAAACACTCAGAGATTTAATTGG - Intergenic
1169520559 20:6368332-6368354 AATAAAATCAGAGATGAAAAAGG + Intergenic
1169989013 20:11478811-11478833 AATAAAATCAGAGATGAAAAAGG + Intergenic
1170096145 20:12648016-12648038 AAAGAACTCAAAGCTGTAATAGG - Intergenic
1170236366 20:14109538-14109560 AATAAAATCAGAGATGAAAAAGG + Intronic
1170279668 20:14631798-14631820 AACAAATTTAAAGATATAATTGG - Intronic
1170522597 20:17202919-17202941 ACAAAATTCTAGGATGTAATTGG + Intergenic
1172026117 20:31949948-31949970 AAGAAAGCCAGAGATGGAATTGG - Intronic
1172291434 20:33780031-33780053 ATAAAACTGAGTGATGTAATAGG + Intronic
1172419308 20:34801483-34801505 AATAAAATCAGAGATGAAAAAGG + Intronic
1172797724 20:37553904-37553926 AATAAAATCAGAGATGAAAAGGG + Intergenic
1173427627 20:42956569-42956591 AAAAAAGAGAGAGATTTAATTGG - Intronic
1173695089 20:45003696-45003718 AAAAAATTTAGAGACGTTTTAGG - Intronic
1173715555 20:45200482-45200504 AATAAAATCAGAGATGAAAAAGG - Intergenic
1173902277 20:46599767-46599789 AAAAAATGCAGACATGGAAAGGG - Intronic
1174101881 20:48133151-48133173 AAAAAATTCAGAAATTTATATGG - Intergenic
1174632984 20:51974503-51974525 AAAAAAATTAAAAATGTAATGGG + Intergenic
1174664374 20:52243924-52243946 ATAAAATGCAGACATGTATTAGG - Intergenic
1175559823 20:59912974-59912996 AAAAAAGAAAGAGATTTAATTGG - Intronic
1175750425 20:61493366-61493388 AAAAAACTCAGAGAACTAAAAGG - Intronic
1176016235 20:62934701-62934723 AAGAAGTTGAGAGATGTGATGGG - Intronic
1176854328 21:13952993-13953015 ATTAAATTCAGAGACATAATAGG - Intergenic
1177360821 21:20066932-20066954 AAAAAACTCTGAGAGGTGATGGG - Intergenic
1177621393 21:23599638-23599660 AATAGATTCAGAGAGGTAATTGG - Intergenic
1177635217 21:23778919-23778941 AATAAATTCATACATGTAAAGGG - Intergenic
1177714298 21:24819073-24819095 AGAAAAGTCAGCCATGTAATAGG + Intergenic
1177886803 21:26757104-26757126 AAAAATGTCTGAGATGTAAGGGG - Intergenic
1178014692 21:28330367-28330389 AAAAAAGTTAGACATGGAATAGG - Intergenic
1178246535 21:30958228-30958250 AAAAAATCCAGATTTTTAATTGG + Intergenic
1178558278 21:33613736-33613758 AAAAAATTCAGAAATGGGATGGG + Intronic
1179115971 21:38492973-38492995 AAAATATTCAGAGTTGTTATGGG + Intronic
1179155403 21:38846480-38846502 AATAAATTCAGAGATTTATTTGG - Intergenic
1180325185 22:11366561-11366583 AAAAACTACACAGAAGTAATCGG + Intergenic
1180915723 22:19485106-19485128 AAAAAATTCAGAGAACAAAAAGG - Intronic
1182002733 22:26934303-26934325 AACACATTCAGAGAAGTGATGGG + Intergenic
1182160377 22:28115580-28115602 AAAAGATTAAGAAATGTAGTAGG + Intronic
1182201594 22:28576831-28576853 AATAAAATCAGAGATGAAAAAGG - Intronic
1182916111 22:34033032-34033054 AATAAAATCAGAGATGAAAGTGG - Intergenic
949196589 3:1316915-1316937 AAAAAATTCTGGGATGAAGTGGG + Intronic
949285967 3:2404773-2404795 AAAAAATACTGAGATGTTATAGG - Intronic
949312535 3:2715942-2715964 ATAAAATTAAAACATGTAATGGG - Intronic
950695177 3:14694537-14694559 AATAAAATCAGAGATGAAACAGG - Intronic
950800285 3:15545556-15545578 AAATAAATCAGAGATGAAAAAGG - Intergenic
950951020 3:16998822-16998844 AAATAATTCAAATATGTAATGGG - Intronic
951213008 3:19996227-19996249 AAAAAAATCAGAAATGAAAAAGG + Intronic
951323337 3:21273294-21273316 AAAAAATCCTGAGATGAACTAGG + Intergenic
951766260 3:26203099-26203121 AAAAATTTTAGAGCTGGAATTGG + Intergenic
951923986 3:27887178-27887200 AATAAATTCAGAGAGGTAACAGG - Intergenic
951973093 3:28470897-28470919 AATAAAATCAGAGATGAAAAAGG + Intronic
952104999 3:30059324-30059346 AAATAAGTCAGAGATATAATGGG - Intergenic
952315163 3:32226086-32226108 ACAAAATAAAGAGATTTAATGGG + Intergenic
952517014 3:34114944-34114966 AATAAAATCAGAGATGAAAAAGG - Intergenic
952698334 3:36297039-36297061 AAACAATTCAGAGAAGTGAAAGG - Intergenic
953217511 3:40934296-40934318 AATAAAATCAGAGATGAAAAAGG + Intergenic
953542299 3:43832345-43832367 AAAATATTCAAAGTTATAATAGG + Intergenic
953792533 3:45959164-45959186 AAAAAATACAGAGATGTGGATGG - Intronic
954501168 3:51017229-51017251 AATAAAATCAGAGATGAAAAAGG - Intronic
954782104 3:53069518-53069540 ATAAAATTCAGAGAGGTGAGGGG + Intronic
955501378 3:59587066-59587088 AAAAAGTTCAGACATTTTATTGG - Intergenic
955714744 3:61817274-61817296 AAAAATTTCAGTGATTTAAAAGG - Intronic
956363719 3:68476420-68476442 TAAAAATGCAGAGATGACATTGG + Intronic
956407758 3:68946636-68946658 AAAAAACTCATAGATGGAACAGG + Intergenic
956476415 3:69625428-69625450 AATAAAATCAGAGATGAAAAAGG + Intergenic
956489394 3:69754611-69754633 AAAAAAAAGAGAGATGTAATTGG - Intronic
956557490 3:70539562-70539584 AAAGAATTCAGAGAGGTCTTTGG + Intergenic
956625266 3:71260323-71260345 GAGAAATGCAGAGATGAAATGGG + Intronic
956679359 3:71763973-71763995 AGAAAATTCACAGTTGTAACGGG + Intergenic
956977738 3:74601383-74601405 AAAGAACTCAGATATGTATTTGG - Intergenic
957175071 3:76797711-76797733 ATAAAAATCAGAGATGAAAAGGG + Intronic
957289799 3:78264946-78264968 AAAAAATTCAGAAATGGAAAAGG - Intergenic
957409879 3:79825927-79825949 TTAAAGTTCAGAGATGTAAATGG + Intergenic
957476867 3:80736872-80736894 AAAATATACAAAGATGTATTTGG + Intergenic
957576238 3:82012225-82012247 AACAAATTCACAGTTGTTATAGG + Intergenic
957588910 3:82170389-82170411 GAAAATTTCAGAGATGTGTTTGG + Intergenic
957752495 3:84440058-84440080 AAAAACCTCAGAGATTTAATTGG - Intergenic
957789625 3:84922523-84922545 AATAAAATCAGAAATGAAATAGG + Intergenic
957963008 3:87283397-87283419 TTAATATTCAGAAATGTAATAGG + Intergenic
958067946 3:88569285-88569307 AACAAAATCAGAGATGAAAAAGG + Intergenic
958113803 3:89188004-89188026 AAAAAATTCAGGATTTTAATGGG + Intronic
958533836 3:95369766-95369788 AAAAAATTCACAGTTGTGCTAGG - Intergenic
958831567 3:99096960-99096982 AAATATTTCTGAGATGTATTAGG + Intergenic
958837798 3:99166688-99166710 AATAAAATCAGAGATGAAAGAGG + Intergenic
959180414 3:102971972-102971994 TAAAAATGTAGACATGTAATAGG + Intergenic
959282805 3:104367209-104367231 AAAAAATTCTGACATTTAAAAGG + Intergenic
959285619 3:104405121-104405143 AAGAAAATCAGAGATGAAAGAGG + Intergenic
959324761 3:104922517-104922539 AAAAAAGAAAGAGATGTAATTGG - Intergenic
959408523 3:105991593-105991615 AATAAAATCAGAGATGAAAAAGG - Intergenic
959717478 3:109448901-109448923 AATAAAATCAGAGATGAAAGAGG + Intergenic
959806365 3:110558950-110558972 AATAAAATCAGAGATGAAAAAGG - Intergenic
959827049 3:110810414-110810436 AAAAGAATCAGAGATGGAGTAGG + Intergenic
960168083 3:114426609-114426631 AAAAAGTTCAGAGATGGAGAGGG - Intronic
960192261 3:114721048-114721070 AGAAAATTGAGATATGTATTTGG + Intronic
960214396 3:115013324-115013346 AGTAAAATCAGAGATGTAAAAGG + Intronic
960491077 3:118317155-118317177 AATAAAATCAGAGATGAAAAAGG + Intergenic
960529803 3:118750750-118750772 AAATAACTTAGAGGTGTAATGGG + Intergenic
960643453 3:119851866-119851888 AAAAAATACACAAATGTAATGGG - Intronic
960692097 3:120357344-120357366 AGAAAATTCAGAGATATGAAAGG + Intergenic
960870252 3:122241321-122241343 AATAAAATCAGAGATGAAAAAGG + Intronic
961352509 3:126312965-126312987 ATAGAATTCAGGGATGTTATGGG + Intergenic
961392806 3:126565550-126565572 ATAAAATTCTGAGATGGTATGGG - Intergenic
961619262 3:128210639-128210661 AAAAAATTCAGAGATGTAATTGG - Intronic
961952700 3:130766721-130766743 AATAAAATCAGAGATGAAAAAGG + Intergenic
962193888 3:133340228-133340250 AATAAAATCAGAGATGAAAAAGG + Intronic
962418181 3:135202656-135202678 AAACAATGCAGAGAAGTAAAAGG + Intronic
962496170 3:135941502-135941524 AATAAAATCAGAAATGTAAAAGG - Intergenic
962638538 3:137357996-137358018 AAAAAAGTCAGAGATGAAAAAGG - Intergenic
962660222 3:137594703-137594725 AAAAAATTCAGCGAGAAAATAGG - Intergenic
962671237 3:137710742-137710764 AAAGAACACAGAGATGTGATAGG - Intergenic
962768088 3:138584957-138584979 AATAAAATCAGAGATGAAAAAGG + Intronic
963178466 3:142327448-142327470 AATAAAATCAGAGATGAAAAAGG - Intronic
963330830 3:143913620-143913642 AATAAAATCAGAGATGAAAAAGG + Intergenic
963359533 3:144252965-144252987 GAGAAATTCAGAGAGGTAGTCGG - Intergenic
963473971 3:145780142-145780164 AAAATATTCAGGGAGGAAATGGG - Intergenic
963802560 3:149691450-149691472 AATAAAATCAGAGATGAAAAAGG + Intronic
963893198 3:150658696-150658718 AAAAAAGGCAGAGGTTTAATAGG - Intergenic
963912674 3:150828246-150828268 GAAAAAGTCACAGATGTAAATGG - Intergenic
963996374 3:151714688-151714710 AATAAAATCAGAGATGAAAAAGG + Intergenic
964162189 3:153658928-153658950 AAAAAAGTCATAGAGGTTATGGG + Intergenic
964519708 3:157551737-157551759 AAAAAATTAAGAAATTTAATAGG - Intronic
964551196 3:157886723-157886745 AAAAACTTCAGAGTTGTGTTTGG - Intergenic
964582234 3:158252934-158252956 AATAAAATCAGAGATGAAAAAGG - Intronic
964628795 3:158786149-158786171 AAATAATTCAACAATGTAATTGG + Intronic
964894244 3:161575829-161575851 AAAATATTCTGATATGTATTTGG - Intergenic
964909857 3:161767079-161767101 AAAAAATTGAGACAAGTAAAAGG - Intergenic
965099864 3:164282166-164282188 AATAAAATCAGAGATGAAAAAGG + Intergenic
965526718 3:169727979-169728001 AATAAAATTAGAGATGTAAAAGG - Intergenic
965535223 3:169816490-169816512 AATAAAATCAGAGATGAAAAAGG - Intergenic
965561872 3:170069735-170069757 AAAATATTTACAGATGAAATAGG - Intronic
965780121 3:172276928-172276950 AAAAAAATTAAAGATGTTATTGG + Intronic
965847066 3:172975645-172975667 AAAATTATCAGAGAAGTAATAGG + Intronic
965955708 3:174366714-174366736 AAAAAATTTAAAGAAATAATTGG + Intergenic
966032893 3:175372402-175372424 AAAATATTTAGAGAAGTATTTGG - Intronic
966147309 3:176826537-176826559 AAAACTTTCAGAGAGGTAAGAGG - Intergenic
966348863 3:179008550-179008572 AATAAAATCAGAGATGAAAAAGG + Intergenic
966408878 3:179628206-179628228 AAAAAATTCTAAGATGTATATGG - Intergenic
966463927 3:180208127-180208149 AAAAAAATCAGAGGTGAAAAAGG + Intergenic
967069267 3:185948231-185948253 AAAAAAATCAGACATATTATTGG - Intergenic
967535803 3:190601417-190601439 AAAACATACAGAGAAATAATTGG - Intronic
968004574 3:195232233-195232255 AATAAAATCAGAGATGAAAAAGG - Intronic
968018509 3:195361810-195361832 AAAAAAATCAGAGATGAAAAAGG + Intronic
968779744 4:2571416-2571438 AAAAAATTTAGATTTGTACTAGG + Intronic
970253194 4:14138401-14138423 AAACAATTCATAGATTTGATGGG + Intergenic
970338348 4:15077821-15077843 AAAAAAATCAGAAATGAAAGAGG + Intergenic
970501803 4:16685355-16685377 AAAAACTTGAGAGATGTAAAAGG - Intronic
970712551 4:18880302-18880324 AAGAAATTGAGACATGTTATTGG - Intergenic
971007831 4:22395047-22395069 AAATAAATCAGAGATGTACATGG + Intronic
971095222 4:23393129-23393151 AAAGATTTCAGAGAATTAATGGG - Intergenic
972209617 4:36821905-36821927 ATAAAATTCAGTGATGTTTTAGG - Intergenic
972709046 4:41575383-41575405 AAAAAATTCAAACTTGTAATGGG - Intronic
972936621 4:44143976-44143998 AAAAAAATCAGAGAAGTGTTGGG - Intergenic
973002703 4:44971218-44971240 AAAAACTTCAGGGGTATAATTGG + Intergenic
973070513 4:45852345-45852367 AAAAAAATCAGAGATGGTCTGGG - Intergenic
973245644 4:48008610-48008632 ATAAAATAGACAGATGTAATGGG - Intronic
973762368 4:54130352-54130374 AATAAAATCAGAGATGAAAAAGG - Intronic
973853093 4:54981304-54981326 AATAAAATCAGAGATGAAAAAGG + Intergenic
974401293 4:61411003-61411025 CACAAATTCAGAGATAAAATTGG + Intronic
974557518 4:63470941-63470963 AAAAACTTCCAAGATGTAAACGG + Intergenic
974694823 4:65352771-65352793 AAAAAATGCAGAGAAGTAGAAGG - Intronic
975285818 4:72618433-72618455 AATAAAATCAGAGATGAAAAAGG + Intergenic
975369206 4:73564906-73564928 AATAAAATCAGAGATGAAAAAGG - Intergenic
975392117 4:73832655-73832677 AAAAAGTTTAGAGATGACATAGG - Intergenic
975431870 4:74302710-74302732 CACAAATTCAGAAATCTAATAGG + Exonic
976028714 4:80724559-80724581 AAAAAAGTCAGTGACGAAATAGG - Intronic
976603177 4:86958057-86958079 AAAAAGTTCAGAGATAGACTAGG - Intronic
976728208 4:88236417-88236439 AATAAAATCAGAGATGAAAAAGG - Intergenic
976840314 4:89425179-89425201 AATAGATTCAAAGCTGTAATTGG - Intergenic
976943471 4:90735658-90735680 AATAAAATCAGAGATGAAAAAGG - Intronic
977185854 4:93934996-93935018 AATAAAATCAGAGATGAAAAAGG + Intergenic
977199043 4:94093639-94093661 AATAAAATCAGAGATGAAAAAGG - Intergenic
977381046 4:96274000-96274022 AAAAAAATCAGAGATGAAAAAGG + Intergenic
977404033 4:96573559-96573581 AAAAAATTAACTGATGAAATAGG + Intergenic
978117432 4:105037887-105037909 AATAAAATCAGAGATGAAAAAGG + Intergenic
978417786 4:108496008-108496030 AATAAAATCAGAGATGAAAAAGG + Intergenic
978718641 4:111877157-111877179 AAAAGAGAGAGAGATGTAATGGG - Intergenic
978888956 4:113799326-113799348 AATAAATTCAGAAATGTTTTGGG + Intergenic
979280635 4:118863507-118863529 AATAAAATCAGAGATGAAAAAGG - Intronic
979422084 4:120516852-120516874 AAAAGATTTAGAGATTTAATTGG - Intergenic
979757222 4:124356412-124356434 AATAAAATCAGAGATGAAAAAGG + Intergenic
979912935 4:126393055-126393077 AATAAAATCAGAGATGAAAAAGG - Intergenic
979947181 4:126847082-126847104 AAAAAATTATCCGATGTAATAGG - Intergenic
980331104 4:131412192-131412214 AAAAAATTAAGAGATGTGAAGGG + Intergenic
980657831 4:135812567-135812589 AATAAAATCAGAGATGAAAAAGG + Intergenic
980719214 4:136671720-136671742 AAAATCTTCAGTAATGTAATAGG + Intergenic
980789422 4:137600809-137600831 AAAAAATTGAGAGATTAAGTGGG - Intergenic
981140529 4:141262997-141263019 AATAAAATCAGAGATGAAAAAGG + Intergenic
981406768 4:144380174-144380196 AAAGAAATCAGAGATGCAAAGGG - Intergenic
981465944 4:145071975-145071997 AACAAATTCAGAAATGTGAAAGG + Intronic
981517903 4:145630350-145630372 AATAAATGCAGAGATGAAAAAGG - Intronic
981837251 4:149068671-149068693 AATAAAATCAGAGATGAAAAAGG + Intergenic
982617660 4:157660983-157661005 AAAAAATATATAGATGTAAATGG - Intergenic
983022570 4:162697004-162697026 AACAAACTCAGAAATGTAAAAGG - Intergenic
983165654 4:164473992-164474014 AATAAAATCAGAGATGAAACAGG - Intergenic
983207695 4:164928330-164928352 ATACTCTTCAGAGATGTAATGGG - Intergenic
983436584 4:167723287-167723309 AACAAATACAGACATGTACTTGG + Intergenic
983536936 4:168867925-168867947 AAAAAATTCTGAGATAAAACTGG + Intronic
983595006 4:169456497-169456519 AACAAAATCAGAGATGAAAAAGG + Intronic
983688488 4:170438747-170438769 ACCAAATTCAGAAATGTAGTGGG + Intergenic
983983680 4:174031244-174031266 AAAAGATTAAGATATGTAAAAGG + Intergenic
984068452 4:175080679-175080701 AATAAAATCAGAGATGAAAAAGG - Intergenic
985523533 5:390448-390470 AGAAAATTCAGACATGAAAACGG + Intronic
985581758 5:700573-700595 AAAATATTTATAGATGTAAGGGG - Intergenic
986206996 5:5634277-5634299 AAAGAATTAAAAGTTGTAATAGG + Intergenic
986387255 5:7246944-7246966 AAACAATTGAGAGAAGGAATTGG + Intergenic
986528395 5:8706239-8706261 AAAAAACTCAGCGCTATAATGGG - Intergenic
986657293 5:10027400-10027422 AAATAAATCAGAGATGAAAAAGG - Intergenic
986825972 5:11523460-11523482 ATAAAATACAAAGATGTCATTGG - Intronic
986891620 5:12315687-12315709 GAAAAATGCAGACAAGTAATTGG + Intergenic
986905457 5:12489991-12490013 AATAAAATCAGAGAAGTAAAAGG + Intergenic
986947874 5:13046985-13047007 AAAAAATAAAGAGGTTTAATTGG + Intergenic
986981203 5:13449923-13449945 GAAAAAGTGAGAGAGGTAATAGG - Intergenic
987221602 5:15796060-15796082 AATAAATCTTGAGATGTAATAGG + Intronic
987433987 5:17871067-17871089 AACAAATAAAGAGATTTAATCGG + Intergenic
987478109 5:18417579-18417601 AAGAATTTCAGATATGTATTTGG - Intergenic
987893084 5:23908487-23908509 TCAAAATTCAGAGATATAAATGG - Intergenic
988179255 5:27767856-27767878 AAAAAATATAGATATTTAATGGG - Intergenic
988608001 5:32697840-32697862 AATAAAATCAGAGATGAAAAAGG - Intronic
989009944 5:36858541-36858563 ATAAAATACAATGATGTAATTGG + Intergenic
989023321 5:37037039-37037061 AAAAACTTCAGATTTGTGATTGG - Intronic
989330129 5:40248076-40248098 AATAAAATCAGAGATGAAAAAGG + Intergenic
989472359 5:41835119-41835141 AATAAAATCAGAGATGAAAAAGG + Intronic
990527298 5:56640578-56640600 AAGAAATTCAAAGCAGTAATAGG + Intergenic
990578009 5:57142203-57142225 AATAAAATCAGAGATGAAAAAGG - Intergenic
990593337 5:57288181-57288203 AATAAAGTCAGAGATGAAAAAGG + Intergenic
990784723 5:59406694-59406716 AATAAAATCAGAGATGAAAAGGG - Intronic
991107172 5:62857487-62857509 AATAAAATCAGAGATGAAAAAGG - Intergenic
991237990 5:64421263-64421285 AAACAAATCAGAGATGAAAAAGG + Intergenic
991915449 5:71600268-71600290 AAAAAATTCAGTCATTTAATAGG + Intronic
991942791 5:71869376-71869398 AGAAAACTCAGCGATGTTATGGG - Intergenic
992386718 5:76291667-76291689 AAAAAATGCTGAGTTGTCATTGG - Intronic
992531495 5:77655890-77655912 AATAAAATCAGAGATGAAAAAGG - Intergenic
993267304 5:85742396-85742418 AATAAAATCAGAGATGAAAATGG - Intergenic
993397389 5:87407146-87407168 ATAAAATTCAGAGTAGGAATAGG - Intronic
993414054 5:87603727-87603749 AAAACATTAAGAGATGTAAAAGG - Intergenic
993873265 5:93276734-93276756 AAAAAATTCTGAAATCTTATTGG + Intergenic
994311160 5:98272367-98272389 AATAAAATCAGAGATGAAAAAGG + Intergenic
994660284 5:102645383-102645405 AATAAAATCAGAGATGAAATGGG + Intergenic
994764836 5:103902950-103902972 AAAAAAACCAGAGGTTTAATTGG + Intergenic
994800960 5:104374646-104374668 AAAAAATACATAAATGTAACAGG + Intergenic
994852067 5:105068446-105068468 ATAAAACTTAGAGCTGTAATAGG + Intergenic
994913390 5:105942891-105942913 AGAAATTTAAGAGATTTAATTGG + Intergenic
995280383 5:110329074-110329096 AAAGTCTTCAAAGATGTAATTGG + Intronic
995292664 5:110476064-110476086 AAAGAATTCAGTGTTGAAATGGG - Intronic
995304478 5:110629248-110629270 ATAATATTCAAAAATGTAATAGG + Intronic
995363220 5:111323078-111323100 AAAATATTTACAGATGTAAGAGG + Intronic
995372047 5:111429277-111429299 AATAAAATCAGAGGTGTAAAAGG + Intronic
995770959 5:115669171-115669193 AATAAAATCAGAGATGAAAAAGG + Intergenic
995935924 5:117513699-117513721 TAAAAATTCACAGATTTAAAGGG + Intergenic
996116121 5:119621102-119621124 AAATAAATCAGAGATGAAAAAGG - Intronic
996206412 5:120743160-120743182 AAAATATTCAGAGAAGAAAAAGG - Intergenic
996241523 5:121208849-121208871 ACACCATTCAGAAATGTAATGGG - Intergenic
996259630 5:121450053-121450075 ATAAAACTCAGAGATGGAAAAGG + Intergenic
996462531 5:123762756-123762778 AATAAAATCAGAGATGCAAAAGG - Intergenic
996580276 5:125024697-125024719 AAAAAATTTAGAAAGGTTATTGG + Intergenic
996659576 5:125985332-125985354 AAGAAAATCAGAGATGAAAAAGG - Intergenic
996822240 5:127642920-127642942 AAACATTTCGGAAATGTAATGGG + Intergenic
996945255 5:129058925-129058947 AAAAAAATCAGAGAAGAAAAAGG + Intergenic
997043409 5:130284393-130284415 AAAAACTTCATTTATGTAATTGG - Intergenic
997060235 5:130492414-130492436 AATAAAATCAGAGATGAAAAGGG + Intergenic
997188598 5:131907450-131907472 AATAAAATCAGAGATGAAAAGGG + Intronic
997279730 5:132632803-132632825 ACAAAATCCAGACATGGAATGGG - Intronic
998189955 5:140015139-140015161 AAAAAATGGAGGGAGGTAATGGG - Intronic
998383090 5:141739889-141739911 AAAAAATTGTGAGGTGTAAGAGG + Intergenic
998703429 5:144731643-144731665 AAAGAATTCTGTGATGTGATTGG + Intergenic
998783035 5:145679450-145679472 ATAAAATAGAGTGATGTAATTGG - Intronic
999526069 5:152407151-152407173 AATAATTACAGACATGTAATAGG + Intronic
999636187 5:153625092-153625114 AAAAAAAATAGAGATGTACTAGG - Intronic
1000195645 5:158955021-158955043 AAAAATTACAGAGAAGTAATTGG + Intronic
1000540697 5:162536315-162536337 AATAAATTTATAGATGTATTTGG + Intergenic
1000581862 5:163044705-163044727 AATAAAATCAGAGATGAAAAGGG + Intergenic
1000596934 5:163226036-163226058 AAATAATTCAAAGATTTAAAAGG + Intergenic
1000913127 5:167046238-167046260 AACACTCTCAGAGATGTAATGGG + Intergenic
1001177920 5:169489702-169489724 AATAAAATCAGAGATGAAAATGG + Intergenic
1002843613 6:926589-926611 GAAAAATTCAAAGATGACATAGG - Intergenic
1002977747 6:2100717-2100739 AAAAAACTCAAACATGTGATAGG + Intronic
1003510613 6:6776865-6776887 AAAATATTGAGAGGTTTAATAGG - Intergenic
1003740611 6:8934294-8934316 AAAAAATTAAGAAAAGTTATTGG - Intergenic
1003803776 6:9702161-9702183 AAAAAATTTAGAGATGGGGTAGG + Intronic
1004326909 6:14683482-14683504 AAAACATGAAGAGATGTGATGGG - Intergenic
1004668369 6:17771012-17771034 AAGAAATTAAGACATGTATTGGG - Intronic
1005147406 6:22707236-22707258 AAAACATTCAGAGATCTTAAAGG - Intergenic
1005156790 6:22816297-22816319 AATAAAATCAGAGATGAAAAAGG - Intergenic
1005776096 6:29131941-29131963 GGAAAATTGAGAGATGTATTGGG + Intergenic
1006462315 6:34168399-34168421 AATAAAATCAGAGATGGAAAAGG - Intergenic
1006817159 6:36859442-36859464 AAAAAAGTCACAGATGAAGTGGG + Intronic
1007062914 6:38958420-38958442 AAAAAAAACAGAGATGAAAAAGG + Intronic
1007923429 6:45630994-45631016 AAAATATTTAGAAATGTAACGGG - Intronic
1008018098 6:46544094-46544116 AAAAAAATCAGAAATGAAAAAGG + Intergenic
1008108735 6:47469293-47469315 AATAAATTCAGAGATGAAAAAGG + Intergenic
1008227538 6:48938956-48938978 AAAAAAATCAGAGATTAAAAAGG + Intergenic
1008229473 6:48966813-48966835 AAAATACTCAGAGATATAAAAGG + Intergenic
1008413268 6:51208120-51208142 AAAATATTCAGAAATGTCGTTGG + Intergenic
1008678103 6:53843194-53843216 AAATAAATCAGGTATGTAATAGG - Intronic
1009038946 6:58154386-58154408 AATAAAATCAGAGATGTAAAAGG - Intergenic
1009214839 6:60909222-60909244 AATAAAATCAGAGATGTAAAAGG - Intergenic
1009301875 6:62033957-62033979 AATAAAATCAGAGATGAAAAAGG + Intronic
1009594766 6:65720782-65720804 AACATATTCATATATGTAATTGG + Intergenic
1009630979 6:66200310-66200332 AAAAAATACTGAGATGCAAGAGG - Intergenic
1009746897 6:67827445-67827467 GAAAAATGAAAAGATGTAATTGG - Intergenic
1009785360 6:68330777-68330799 AAACAATTAAGAGAAGTCATTGG - Intergenic
1009978184 6:70696125-70696147 AATAAAATCAGAGATGAAAAAGG - Intronic
1009995886 6:70894669-70894691 AAAAACTTCAGAGAAGTCACAGG + Intronic
1010026560 6:71224947-71224969 AAAAAATGAAAAGATGTATTAGG - Intergenic
1010061855 6:71632068-71632090 AATAAATTCAGAGATGAAGAAGG - Intergenic
1010182261 6:73100778-73100800 AATAAAATCAGAGATGAAAAAGG + Intronic
1010301637 6:74267129-74267151 AAAAATGTCCAAGATGTAATTGG + Intergenic
1010349280 6:74852896-74852918 AAGAAAGTCAGGGATGGAATCGG - Intergenic
1010408237 6:75530454-75530476 TAAAAAATCAGAGAAATAATGGG + Intergenic
1010548334 6:77187073-77187095 AATAAAATCAGAGATGAAAAAGG + Intergenic
1010631673 6:78206190-78206212 ACAAAATTCAAAGAAGTTATGGG - Intergenic
1010698174 6:79004458-79004480 AAAAAATTCAGAGTGGTGATTGG - Intronic
1010772789 6:79851243-79851265 AATAAAATCAGAGATGAAAAAGG + Intergenic
1010775820 6:79884182-79884204 AATAAAATCAGAGATGAAAAAGG + Intergenic
1011001357 6:82591626-82591648 AAAAAATTCAGGGATCTGCTAGG + Intergenic
1011033501 6:82948170-82948192 AATAAAATCAGAGATGAAAAAGG + Intronic
1011265855 6:85518258-85518280 AAAAAATCCAGTGAGGTAAGTGG + Intronic
1011385954 6:86798005-86798027 AATAAAATCAGAGATGAAAAAGG - Intergenic
1011520787 6:88203089-88203111 AATAAAATCAGAGATGAAAAAGG + Intergenic
1011722492 6:90172360-90172382 GAAATATTTAGAGATGTAAAGGG + Intronic
1011918135 6:92535814-92535836 AATGAATTTAAAGATGTAATGGG + Intergenic
1012059565 6:94462028-94462050 AATAAATTCAGAGATGAAAAAGG - Intergenic
1012166838 6:95965195-95965217 ACAAAATTAAGACATGTTATAGG - Intergenic
1012217831 6:96610174-96610196 AGAAAATTCAGAGAAGTATGAGG + Intronic
1012288116 6:97418197-97418219 AATAAAATCAGAGATGAAAAAGG - Intergenic
1012620365 6:101337303-101337325 AAAAAAATCAGAAATGAAAAGGG - Intergenic
1012770635 6:103429203-103429225 AAAAAATTAACAGATGTTAGTGG + Intergenic
1012892587 6:104913439-104913461 AATAAAATCAGAGATGAAAAAGG + Intergenic
1013142471 6:107351076-107351098 AAAAAATTGATAAAAGTAATGGG + Intronic
1013329327 6:109083113-109083135 TAAAAATTAAGAGATGACATTGG - Intronic
1013887363 6:114986102-114986124 TATACATTCAGAAATGTAATAGG + Intergenic
1014040953 6:116824385-116824407 AACAAAATCAGAGATGAAAAAGG + Intronic
1014124936 6:117766231-117766253 AATAAAATCAGAGATGAAAAAGG + Intergenic
1014164996 6:118214029-118214051 AAAAACTACAGAAAAGTAATTGG - Intronic
1014235050 6:118944659-118944681 AACAAAATCAGAGATGAAAAAGG + Intergenic
1014385000 6:120789203-120789225 ACAAAATTCTGACTTGTAATTGG + Intergenic
1014469734 6:121799600-121799622 ACAAAACCCAGAGATGTTATGGG + Intergenic
1014864834 6:126516123-126516145 AATAAAATCAGAGATGAAAAAGG - Intergenic
1014946492 6:127504779-127504801 AAAAACATCAGAGAAGTCATAGG + Intronic
1015486846 6:133781390-133781412 AATAAAATCAGAAATGTAAAGGG - Intergenic
1015560320 6:134508208-134508230 AAAAAATTCATTGATCTATTTGG + Intergenic
1015590192 6:134815690-134815712 AAAAATTTCAGGGAAGTGATTGG + Intergenic
1015647473 6:135409707-135409729 AGAAAAATCATAGATATAATGGG - Intronic
1015686091 6:135863027-135863049 AAAAAATTCAAAGATCTTAATGG - Intronic
1015722276 6:136255290-136255312 AAAAGATTCAGAGCTTGAATTGG - Intergenic
1015741302 6:136457085-136457107 AAAAAAATCAGAGATGAAACAGG + Intronic
1015809186 6:137144310-137144332 AAAATATTCAGAAATGTATTGGG - Exonic
1015876145 6:137824776-137824798 AAATAAATCAGGGAAGTAATAGG + Intergenic
1015930296 6:138352789-138352811 AAGAAATCAAGTGATGTAATGGG - Intergenic
1016061181 6:139632337-139632359 AATAAAATCAGAGATGAAAAAGG - Intergenic
1016228204 6:141768427-141768449 AATATATTCAGAGATGAAAGAGG - Intergenic
1016230089 6:141792807-141792829 AATAAAATCAGAGATGGAAAAGG + Intergenic
1016533739 6:145088301-145088323 AAAATATTCCAACATGTAATGGG - Intergenic
1016671921 6:146719421-146719443 AAAAAATTCAGGGAAATAAAAGG - Intronic
1016721102 6:147299149-147299171 AATAAATTCAGAGATGAAAAAGG + Intronic
1016725264 6:147357888-147357910 AAAAAAGTCAAAGAAGTATTTGG + Intronic
1016880971 6:148911717-148911739 AAAAAAATCAGACATGAAACCGG + Intronic
1017531574 6:155297639-155297661 AAAAAGTTCACAAATGTAAAAGG + Intronic
1017752197 6:157498280-157498302 AAAAAATTCAGAGAAGTGAGAGG + Intronic
1017782478 6:157726845-157726867 AAAAAATTCAGAACTGTCACAGG + Intronic
1017998105 6:159551942-159551964 AATAAAATCAGAGATGAAAAAGG - Intergenic
1018009232 6:159654773-159654795 AAAGAATTCTGAGATTTACTTGG + Intergenic
1018315006 6:162548035-162548057 AAAAAACTCAGAGAGGAAGTAGG - Intronic
1018444574 6:163843559-163843581 AAGAAAATCAGAGATTAAATTGG + Intergenic
1019565040 7:1674908-1674930 TTAAAATTCAGAGATTGAATTGG - Intergenic
1019894087 7:3969615-3969637 AATGTATTCAGAGATTTAATAGG + Intronic
1020574505 7:9909106-9909128 AAAAAAATCAGAGATGAAAAAGG - Intergenic
1020732591 7:11901710-11901732 AATAAAATCAGAGATATAAAAGG + Intergenic
1020852447 7:13373616-13373638 AATAAAATCAGAAATGAAATAGG - Intergenic
1020946642 7:14617682-14617704 AAGTAATTCAGAGAAGTAACAGG - Intronic
1020995180 7:15254763-15254785 AACAAAATCAGAGATGAAAAAGG + Intronic
1021124026 7:16829940-16829962 AAATAAATCAGAGATGAAAATGG + Intronic
1021192082 7:17632370-17632392 AATTAATTCAGAGTTTTAATAGG + Intergenic
1021328961 7:19311026-19311048 AAAAAAATCAGTTATTTAATTGG + Intergenic
1021958466 7:25850388-25850410 AAAAATTTCAGAGAGATAAATGG - Intergenic
1023195303 7:37631288-37631310 AATAAAATCAGAGATGAAAAAGG - Intergenic
1023208638 7:37778563-37778585 AATAAAATCAGAGATGAAAAAGG - Intronic
1023432247 7:40106311-40106333 AAAAAATTAGAAGAAGTAATTGG + Intergenic
1023486154 7:40689350-40689372 AAAAAATTCAGACATAAAAAAGG - Intronic
1023545634 7:41315412-41315434 AAAAAATTTAGAGATGTCCCCGG - Intergenic
1024120942 7:46239309-46239331 AAAAAATTCCTAGAACTAATAGG + Intergenic
1024368778 7:48555666-48555688 AATAAAATCAGAGATGAAAAAGG - Intronic
1024418504 7:49135690-49135712 AAGAAGTTCAGAGAAGTAACTGG - Intergenic
1024878882 7:54061867-54061889 AAAAAATATAGAAATATAATAGG + Intergenic
1025617379 7:63133347-63133369 AATAAAATCAGAGATGAAAAAGG + Intergenic
1026016538 7:66675714-66675736 AATAAATTCAGCAATGTAATAGG + Intronic
1026122042 7:67546268-67546290 AAAAAATTTAAAAATGTAACTGG - Intergenic
1026352950 7:69533548-69533570 AAAAAATCCAGACATGTTCTGGG - Intergenic
1026420314 7:70229972-70229994 AAAAAGTTTGGAGATTTAATGGG - Intronic
1027430523 7:78107844-78107866 AATAAAATCAGAGATGAAAAAGG - Intronic
1027472120 7:78586373-78586395 AATAAATTCTTAGATGTTATGGG - Intronic
1027796351 7:82698573-82698595 AAAAAAGTTAGAAATATAATGGG - Intergenic
1028119133 7:87037367-87037389 AAAAAATTGAGAGAAGGAAAAGG - Intronic
1028161298 7:87488452-87488474 AACAAAATCAGAGATGAAAAGGG + Intergenic
1028266244 7:88729643-88729665 AATAAAATCAGAGATGAAAAAGG - Intergenic
1028697330 7:93730316-93730338 AAAAGATAAAGAGATGTAATTGG + Intronic
1028910069 7:96197898-96197920 AAAAAATGGAGAGATGCTATAGG + Intronic
1029016506 7:97320286-97320308 AAAAACTTAAGAGAGGTAAGAGG + Intergenic
1029354592 7:100042378-100042400 AAAACAGTCAGAGATGTGTTTGG - Intergenic
1030484219 7:110146080-110146102 ATAGACTTCAGAGATGTCATGGG + Intergenic
1030503971 7:110396477-110396499 AAAAAGTTCAGAAATGTCATTGG + Intergenic
1030763457 7:113379709-113379731 AAGAAATTCAGAGCTGGAAGCGG + Intergenic
1030885354 7:114929861-114929883 TAAAAATTCTGGGATGGAATGGG + Intronic
1030980512 7:116180770-116180792 AAAAAATTAAATCATGTAATAGG + Intergenic
1031065445 7:117100009-117100031 AAATATTTCAGAAATATAATGGG - Intronic
1031306571 7:120134715-120134737 AATAAACTCAGAGATGAAAAAGG + Intergenic
1031311668 7:120206942-120206964 AAAAAATTCAAAAAATTAATTGG - Intergenic
1031545432 7:123046425-123046447 AATAAAATCAGAGATGAAAAGGG - Intergenic
1032014454 7:128368881-128368903 AATAAAATCAGAGATGAAAAAGG + Intergenic
1032679370 7:134166535-134166557 CAAAAATTCAGAAAAGTAATTGG - Intronic
1033051254 7:138006370-138006392 AACAATGTCAGAGATGAAATGGG - Intronic
1033488840 7:141820775-141820797 AATAAAATCAGAGATGTAAAGGG - Intergenic
1033492462 7:141856895-141856917 AAAAAATTTAAAAATGTAACTGG + Intergenic
1033500216 7:141940720-141940742 AATAAAATCAGAGATGAAATAGG + Intronic
1033764982 7:144478839-144478861 AAAAATTAGAGAGATGAAATGGG - Intronic
1034006057 7:147473491-147473513 AAAAAATTCAGGAAGGTAATTGG - Intronic
1034246926 7:149652008-149652030 AATAAACTCAGAGATGAAAAAGG + Intergenic
1034752167 7:153579749-153579771 AATAAAATCAGAGATGAAAAAGG + Intergenic
1035308545 7:157950439-157950461 AAAATGTTCAGATATGTAATGGG + Intronic
1035308554 7:157950519-157950541 AAAATGTTCAGATATGTAATGGG + Intronic
1035347276 7:158210608-158210630 AATAAAATCAGAGATGAAAAAGG + Intronic
1035753707 8:2014101-2014123 AATAAAATCAGAGATGAAAAAGG - Intergenic
1035985564 8:4427678-4427700 GAAAAATACATAAATGTAATAGG - Intronic
1036071915 8:5450096-5450118 AATAAATTCACACATGTATTAGG - Intergenic
1036191269 8:6672171-6672193 TAAACATTCAGATAAGTAATAGG + Intergenic
1036295733 8:7535455-7535477 GAAAAATTGAGACATGTAAGAGG - Intergenic
1036326834 8:7785565-7785587 GAAAAATTGAGACATGTAAGAGG + Intergenic
1036376293 8:8203167-8203189 AAAAAATTGAAACAGGTAATGGG + Intergenic
1036853238 8:12219971-12219993 AAAAAATTGAAACAGGTAATGGG - Intergenic
1036874614 8:12462493-12462515 AAAAAATTGAAACAGGTAATGGG - Intergenic
1036963836 8:13274893-13274915 AAAAAATTCAAAACTATAATTGG - Intronic
1037275783 8:17176900-17176922 AATAAATTCAAAAATGTATTAGG + Intronic
1037488189 8:19369682-19369704 AATAAAATCAGAGATGAAAAAGG - Intronic
1037798471 8:22016846-22016868 AAAAAATCAAGAAATGTACTGGG + Intergenic
1038174891 8:25171815-25171837 AATAAATTCAGAGAGGAAAACGG + Intergenic
1038389504 8:27181925-27181947 AAAAAAATCATATATTTAATTGG + Intergenic
1038956470 8:32473843-32473865 AAAAAATTTAAAAATGTAGTTGG - Intronic
1039181623 8:34873316-34873338 ACAAAATAAAGAGATTTAATTGG + Intergenic
1039239117 8:35535390-35535412 AAACAGCTCAGATATGTAATAGG + Intronic
1039420873 8:37438201-37438223 AATAAAATCAGAGATGAAAAAGG - Intergenic
1039429839 8:37517142-37517164 TAGTCATTCAGAGATGTAATTGG + Intergenic
1039524276 8:38199822-38199844 AAAAAATTCTGAGAAGAAATCGG - Intronic
1039663771 8:39496707-39496729 AATAAAATCAGAGATGAAAAAGG + Intergenic
1040088637 8:43371757-43371779 AAAAAATCCATGGATGAAATTGG - Intergenic
1040280308 8:46037960-46037982 AAAAAAGACAAAGATGTAAAGGG + Intergenic
1040515662 8:48132124-48132146 AAACAACTCTGAGATGAAATGGG - Intergenic
1040628246 8:49176781-49176803 AATAAAATCAGAGATGAAAATGG + Intergenic
1040665386 8:49625279-49625301 AACAAATTTAAAGATATAATTGG - Intergenic
1040685045 8:49861615-49861637 AAAAAATTTAAAAATGAAATGGG - Intergenic
1040702641 8:50086140-50086162 GAAAAATTCAGAGAGACAATTGG + Intronic
1040918278 8:52586631-52586653 AAAAAATTCATTAATGTAACTGG - Intergenic
1041360526 8:57048671-57048693 AATAAAATCAGAGATGAAAAAGG - Intergenic
1041658508 8:60377570-60377592 AAAAACATCACAGAAGTAATTGG - Intergenic
1041864557 8:62555624-62555646 AAAAAAGACAGAGATATACTAGG + Intronic
1042079755 8:65038581-65038603 ACAAAATTCAGGAATGTATTTGG + Intergenic
1042081851 8:65062467-65062489 AAAGTACTCAAAGATGTAATGGG + Intergenic
1042254838 8:66791990-66792012 AGAACATACAGACATGTAATTGG - Intronic
1042275514 8:67000937-67000959 TAAAAATTCACAGAAGTAAAAGG - Intronic
1042315654 8:67423522-67423544 GAAAAATTCAGTGAAATAATTGG - Intronic
1042975851 8:74468587-74468609 AACAAATTAAAAGATATAATGGG - Intronic
1043133764 8:76494878-76494900 AAGAAAATCAGAGATGAAAAAGG - Intergenic
1043268970 8:78304713-78304735 AAGAAAGGCAGAGATGTCATTGG - Intergenic
1043375544 8:79645161-79645183 AAAAAAGAAAGAAATGTAATGGG + Intronic
1043381669 8:79709041-79709063 TAAAAATCCAGAGATAGAATAGG + Intergenic
1043403323 8:79905275-79905297 AAAAAATTTAAAAATGTGATGGG + Intergenic
1043649514 8:82573565-82573587 AAAATATTAAGAGATCTACTTGG + Intergenic
1044026617 8:87180670-87180692 AAAAAATTCTAAGTTTTAATTGG - Intronic
1044239303 8:89870046-89870068 ATAAAATTCAAAGATGTAAAAGG - Intergenic
1044503433 8:92989914-92989936 AAAAAAATCAGAGAATTAAAAGG + Intronic
1044516810 8:93148448-93148470 GAAAGATTCAGAGATGTAGCTGG - Intronic
1044612125 8:94102249-94102271 CAAATATTCAGAGATTTATTTGG + Intergenic
1045056742 8:98374917-98374939 AAAAATTTAAGGTATGTAATAGG - Intergenic
1045171388 8:99673461-99673483 AATAAAATCAGAGATGGAAAAGG - Intronic
1045252010 8:100490218-100490240 AAAATATTTAGAAATGTGATTGG - Intergenic
1045311871 8:101010019-101010041 AAAAACTTCAGAGAAGTATTGGG + Intergenic
1045660799 8:104435806-104435828 AAAGAATCCAGAGCTGTACTGGG + Intronic
1045773907 8:105778941-105778963 CCAAAATTCAGATATTTAATAGG - Intronic
1046026159 8:108726817-108726839 AAAAAATTCAAAAATATGATAGG + Intronic
1046179989 8:110632876-110632898 AAAGAATTTAGATATTTAATTGG + Intergenic
1046334546 8:112767882-112767904 TAAGAATTCAGAGATATAAAAGG - Intronic
1046335750 8:112784556-112784578 AATAAAATCAGAGATGGAAAAGG + Intronic
1046706546 8:117459564-117459586 AAAAAATAAAGAGATGTGAGAGG - Intergenic
1046734427 8:117761894-117761916 AAGATATTTAGAGATCTAATAGG + Intergenic
1047083946 8:121495697-121495719 AAAAAATCATGAGATGTATTTGG - Intergenic
1047166652 8:122446719-122446741 TAAATATACAGAGATGTAGTTGG + Intergenic
1047933921 8:129757192-129757214 AATAAAATCAGAGATGAAAAAGG + Intronic
1048072101 8:131031766-131031788 AAAAAAATCAGAAATTTATTTGG - Intronic
1048218452 8:132518394-132518416 AAATAACTCAAAGATATAATGGG + Intergenic
1048429461 8:134356237-134356259 ACAAAATAAAGAGATTTAATTGG + Intergenic
1048623849 8:136163367-136163389 ACAAAATTTAGACATGTTATAGG + Intergenic
1048658844 8:136573580-136573602 GAAAAATACAGAGATTGAATGGG - Intergenic
1048756552 8:137745613-137745635 AACAAAATCAGAGATGAAAAAGG - Intergenic
1049690327 8:143955758-143955780 AAAAAATTAAAAGATGAACTGGG - Intronic
1049932086 9:467452-467474 ACAAAATTTAGAGTTGTCATTGG + Intergenic
1050121310 9:2310872-2310894 AATAAAATCAGAGATGAAAAAGG - Intergenic
1050316306 9:4405012-4405034 AATAAAATCAGAGATGAAAAAGG + Intergenic
1050578334 9:7023488-7023510 AATAAAATCAGAGATGAAAAAGG - Intronic
1050618205 9:7425582-7425604 AATAAAATCAGAGATGAAAATGG - Intergenic
1050628319 9:7532182-7532204 TAGAAATTGAGAGATGGAATAGG - Intergenic
1050986263 9:12087155-12087177 AAAAACTTCAAAAATGTCATAGG + Intergenic
1051600213 9:18865003-18865025 AAAATATTCAAAGTTATAATAGG - Intronic
1051653668 9:19355864-19355886 AAAAAATACAGAGATATACCAGG - Intronic
1051743588 9:20274623-20274645 AAGAAACTCAGAGATGTGAAGGG + Intergenic
1051795063 9:20858455-20858477 AATAAAATCAGAGATGAAAAAGG - Intronic
1051905162 9:22086562-22086584 AAAAGCTTCAGAGAAGTCATGGG - Intergenic
1052003229 9:23314043-23314065 AAAAAATGCAGAGATGGATAAGG + Intergenic
1052835511 9:33247144-33247166 AAAAAATTCTGTGCTGCAATTGG - Intronic
1053309335 9:37006433-37006455 AAAAAATTTAAAAATCTAATGGG - Intronic
1053485288 9:38449033-38449055 AATAAAGTCAGAGATGAAAAAGG - Intergenic
1054854489 9:69883735-69883757 AATAAAATCAGAGATGAAAAAGG - Intronic
1055609942 9:78011887-78011909 AAAAAATTCAATGATAAAATAGG + Intronic
1055706540 9:79011266-79011288 AGAAAATTCAGAGAAGTAATGGG + Intergenic
1055905283 9:81286494-81286516 AATAAAATCAGAGATGAAAAAGG - Intergenic
1055911398 9:81356476-81356498 AAAAAAATCGGAGATGAAAAAGG + Intergenic
1056184075 9:84115115-84115137 AATAAAATCAGAGATGAAAAAGG - Intergenic
1056964968 9:91157838-91157860 AAAAAATAAAGAAATATAATGGG + Intergenic
1057927318 9:99164930-99164952 AAAAAAATCAGAGAGGTGGTGGG - Intergenic
1058004362 9:99900045-99900067 AATAAAATCAGAGATGAAAAAGG + Intergenic
1058191278 9:101919112-101919134 AAATCATTCAGTGATGTAAATGG + Intergenic
1058209969 9:102154992-102155014 AAAAAATTCTGAAATGTATATGG - Intergenic
1058321072 9:103631751-103631773 AACAATTTCAGAAATGGAATTGG - Intergenic
1058398565 9:104586192-104586214 AAAAAATTCATAGTAGTATTTGG + Intergenic
1058821553 9:108735254-108735276 AATAAAATCAGAGATGAAAAAGG + Intergenic
1059162215 9:112045747-112045769 AGAAAATGGAGAGATGTAAGAGG - Intronic
1059848403 9:118307672-118307694 AAAAAATAAAGAGAAGTTATCGG + Intergenic
1060461416 9:123858415-123858437 AAAAAATACTCAGATTTAATTGG + Intronic
1060486209 9:124048517-124048539 AAAGAATGCATAGTTGTAATGGG - Intergenic
1060505632 9:124196413-124196435 AATAAATTCAGCGAAGTCATAGG + Intergenic
1203341389 Un_KI270420v1:117-139 ATAAACTTCACAGAAGTAATCGG - Intergenic
1203373042 Un_KI270442v1:330695-330717 AAAAAGTACACAGAAGTAATCGG + Intergenic
1185641424 X:1591304-1591326 ACAAAATTCTAAAATGTAATAGG - Intergenic
1185956092 X:4491457-4491479 CAAAAATTTATAGATGTACTAGG + Intergenic
1186602084 X:11049085-11049107 AATAAAATCAGAGATGAAAAAGG - Intergenic
1186691933 X:11986707-11986729 AAATAAATCAGAGATGAAAAAGG + Intergenic
1187120103 X:16397204-16397226 ATGGAATTCAGAGATGTATTGGG - Intergenic
1187214112 X:17258623-17258645 AAATAAATCAGAGATGAAAAAGG + Intergenic
1187579193 X:20590819-20590841 AACAAAATCAGAGGTGTAAAAGG - Intergenic
1187633260 X:21198141-21198163 AAAAAAATCAGAAATGAAAGAGG + Intergenic
1187723307 X:22174573-22174595 AGAAAATTCAGATATGTTCTTGG - Intronic
1187837034 X:23442490-23442512 AATAAAATCAGAGATGAAAAAGG + Intergenic
1187846541 X:23543988-23544010 AATAAAATCAGAGATGAAAAAGG + Intergenic
1188336948 X:28947883-28947905 TAAAAATTCAAGGATGTGATAGG + Intronic
1188404686 X:29792771-29792793 AAAAAATTAAGAGATTTAGCTGG + Intronic
1188665192 X:32810850-32810872 AATAAAATCAGAGAGTTAATAGG - Intronic
1188716122 X:33461450-33461472 AATAAAATCAGAGATGAAAAAGG - Intergenic
1188724921 X:33571111-33571133 AAATAAATCAGAGATGAAACGGG - Intergenic
1188734797 X:33699802-33699824 AAGAACTTCAGAGATATAGTAGG + Intergenic
1189031002 X:37450439-37450461 AAAAATTACAGAGAAATAATTGG - Intronic
1189291960 X:39892952-39892974 AAAAAAATCAGTGATCTGATAGG - Intergenic
1189370800 X:40427591-40427613 AAAAAAATCAGAGAAGTTATGGG - Intergenic
1189690174 X:43608927-43608949 AATAAAATCAGAGATGAAAAAGG - Intergenic
1189858212 X:45245452-45245474 AACAAATTCAGTAATGTCATAGG - Intergenic
1189868503 X:45356944-45356966 AATAAAATCAGAGATGAAAAAGG - Intergenic
1190038174 X:47046169-47046191 AATAAAATCAGAGATGAAAAAGG + Intronic
1190182430 X:48204458-48204480 AAAGAATTCATAAAAGTAATCGG - Intronic
1190183030 X:48209718-48209740 AAAGAATTCATAAAAGTAATCGG - Intronic
1190195903 X:48318251-48318273 AAAGAATTCATAAAAGTAATCGG - Intergenic
1190367903 X:49714445-49714467 AATAAAATCAGAGATGAAAAGGG - Intergenic
1190662601 X:52668613-52668635 AAAGAATTCATAAAAGTAATCGG - Intronic
1190893576 X:54593472-54593494 AATAAAATCAGAGATGAAAAAGG - Intergenic
1191050923 X:56191100-56191122 AATAAAATCAGAGATGAAAAAGG + Intergenic
1191703969 X:64073534-64073556 AATAAAATCAGAGATGAAAAAGG + Intergenic
1192138008 X:68623036-68623058 AATAAAATCAGAGATGAAAAAGG - Intergenic
1192821436 X:74649693-74649715 AATAAAATCAGAGATGAAAAAGG - Intergenic
1192825811 X:74694796-74694818 AATAAAATCAGAGATGAAAAAGG - Intergenic
1192838838 X:74832450-74832472 AATAAAATCAGAGATGAAAATGG - Intronic
1192986424 X:76404561-76404583 CAAAAAATAAGTGATGTAATGGG + Intergenic
1193153685 X:78150400-78150422 AATAAAGTCACAGATGAAATAGG - Intergenic
1193365954 X:80633599-80633621 AAGAAAATCAGAGATGAAAAAGG - Intergenic
1193439138 X:81516629-81516651 AAAAAAAAAAGAGATTTAATTGG - Intergenic
1193558033 X:82981020-82981042 AAAAAATCAAGACATGAAATGGG + Intergenic
1193561717 X:83025949-83025971 AATAAAATCAGAGATGAAAAAGG + Intergenic
1193592348 X:83405774-83405796 AATAAAATCAGAGATGAAAAAGG + Intergenic
1193726226 X:85042246-85042268 AATAAAATCAGAGATGAAAAAGG + Intronic
1193765524 X:85524422-85524444 AATAAAGTCAGAGATGAAAAAGG - Intergenic
1193835963 X:86344046-86344068 AAATAACTCAAAGGTGTAATTGG + Intronic
1193865979 X:86729907-86729929 AAAAAAAAATGAGATGTAATTGG - Intronic
1193894111 X:87089949-87089971 AATAAAATCAGAGATGAAAGTGG + Intergenic
1193934911 X:87606496-87606518 AATAAAATCAGAGATGAAAAGGG + Intronic
1194006066 X:88493811-88493833 AAAAAAATCAGAAATGAAATAGG - Intergenic
1194107949 X:89794346-89794368 AAAAAATGAAGAAATGTATTTGG - Intergenic
1194136835 X:90155060-90155082 AATAAAATCAGATATGTAAAAGG + Intergenic
1194165966 X:90516626-90516648 AAAAAAATCAGAAATGAAAGAGG + Intergenic
1194177469 X:90667853-90667875 AAAAAATAAAGAGGTTTAATTGG - Intergenic
1194268801 X:91784115-91784137 AAAATATTCAAAGATGTTCTAGG - Intronic
1194290679 X:92068009-92068031 AATAAAATCAGAGATGAAAAAGG - Intronic
1194322464 X:92466777-92466799 AAAAAAATAAGTAATGTAATGGG - Intronic
1194322830 X:92473308-92473330 AATAAAACCAGAGATGTAAAAGG - Intronic
1194431759 X:93816564-93816586 AATAAAATCAGAGATGAAAAAGG + Intergenic
1194783510 X:98054124-98054146 AATAAAATCAGAGATGAAAAAGG - Intergenic
1194831879 X:98632934-98632956 AATAAAATCAGAGATGAAAAAGG + Intergenic
1194953720 X:100155372-100155394 AATAAATTCAGAAATGAAAAAGG - Intergenic
1195075202 X:101320406-101320428 AATAAAATCAGAGATGAAAAGGG - Intergenic
1195116116 X:101699747-101699769 AATAAAGTCAGAGATGAAAAAGG + Intergenic
1195122650 X:101771484-101771506 AATAAAATCAGAGATGAAAAAGG - Intergenic
1195165146 X:102212542-102212564 AATAAAATCAGAGATGGAAGAGG - Intergenic
1195193712 X:102474549-102474571 AATAAAATCAGAGATGGAAGAGG + Intergenic
1195312629 X:103647223-103647245 AATAAAATCAGAGATGAAAAAGG + Intergenic
1195330854 X:103798480-103798502 CAAAGATTCATAGATGTAAATGG + Intergenic
1195378134 X:104247548-104247570 AAAAATTTTAAAAATGTAATTGG - Intergenic
1195556332 X:106229106-106229128 AACAAATTCAGTGATGTTGTAGG - Intergenic
1195650851 X:107282533-107282555 AATAAAATCAGAGATGAAAAAGG + Intergenic
1195807345 X:108790001-108790023 AATAAAATCAGAGATGAAAAGGG - Intergenic
1196044008 X:111237604-111237626 AAGAAATTCAGATATGCAAAAGG + Intergenic
1196214197 X:113031340-113031362 AATAAAATCAGAGATGGAAAAGG - Intergenic
1196385400 X:115143272-115143294 AATAAAATCAGAGATGAAAAAGG + Intronic
1196461094 X:115932030-115932052 AATAAAATCAGAGATGAAAAGGG - Intergenic
1196532286 X:116802656-116802678 AATAAAATCAGAGATGAAAAAGG - Intergenic
1196564951 X:117194160-117194182 AATAAAATCAGAGATGAAAAGGG + Intergenic
1196592220 X:117499103-117499125 AATAAAATCAGAGATGAAAAAGG + Intergenic
1196614063 X:117747415-117747437 AATAAAATCAGAGATGAAAAAGG + Intergenic
1196647341 X:118132116-118132138 AAAAAATTAAAAGAACTAATGGG - Intergenic
1196739313 X:119010607-119010629 AACAAATACTGAGATGTATTAGG + Intronic
1197045326 X:121989914-121989936 AATAAAATCAGAGATTTAAAAGG - Intergenic
1197104364 X:122696296-122696318 AAAAAATAAAGAGATTTAATTGG - Intergenic
1197367844 X:125587656-125587678 AAAAAATACAGAGATGTGGGAGG - Intergenic
1197412279 X:126133335-126133357 AAAGAATTCAGAGATTTACGTGG + Intergenic
1197438275 X:126459522-126459544 AAAAAAATCAGAGTTGGAAAAGG + Intergenic
1197440296 X:126479955-126479977 AATAAAATCAGAGATGAAACAGG + Intergenic
1197597464 X:128483051-128483073 AAAACTTTCAGAGATACAATCGG + Intergenic
1197623250 X:128775475-128775497 AATAAAATCAGAGATGAAAAAGG - Intergenic
1197810730 X:130440680-130440702 AATAAAATCAGAGATGAAAGAGG - Intergenic
1197876259 X:131111064-131111086 AATAAAATCAGAGATGAAAAAGG - Intergenic
1198294028 X:135267406-135267428 AATAAAATCAGAGATGAAAAGGG + Intronic
1198295774 X:135284869-135284891 AAAAAATTCAAGGATGTACTAGG - Intronic
1198639136 X:138736946-138736968 AAAACATTTAGAGAAGTAAATGG + Intronic
1198776961 X:140190023-140190045 ATAACATTCAAAGATGTAATTGG + Intergenic
1198862157 X:141082925-141082947 AAAAAAATCAGATATGTAGTAGG + Intergenic
1198900533 X:141504447-141504469 AAAAAAATCAGATATGTAGTAGG - Intergenic
1198925008 X:141780463-141780485 AAAAATATCAGATATATAATTGG + Intergenic
1199155273 X:144539412-144539434 AAGAAATCCAGAAATGTAAAGGG - Intergenic
1199177972 X:144814524-144814546 AACAAAATCAGAGGTGTAAAAGG + Intergenic
1199333989 X:146597078-146597100 AATAAATTCAGAGATGGAAAAGG - Intergenic
1199636251 X:149814964-149814986 AAAAAAATCAGAGATGACACAGG + Intergenic
1199796781 X:151206103-151206125 AATAAAATCAGAGATGAAAATGG + Intergenic
1199909072 X:152265776-152265798 AATAAAATCAGAGATGAAAAAGG + Intronic
1199921351 X:152407368-152407390 AATAAAATCAGAGATGAAAAAGG + Intronic
1200459899 Y:3442131-3442153 AAAAAATGAAGAAATGTATTTGG - Intergenic
1200482577 Y:3725000-3725022 AATAAAATCAGAGATGTAAAAGG + Intergenic
1200512237 Y:4094397-4094419 AAAAAAATCAGAAATGAAAGAGG + Intergenic
1200524142 Y:4249999-4250021 AAAAAATAAAGAGGTTTAATTGG - Intergenic
1200586012 Y:5005127-5005149 AAAATATTCAAAGATGTTCTAGG - Intronic
1200608189 Y:5292599-5292621 AATAAAATCAGAGATGAAAAAGG - Intronic
1200630619 Y:5580255-5580277 AAAAAAATAAGTAATGTAATGGG - Intronic
1200888197 Y:8293505-8293527 AAATAATTCAGAGAAGTGAAAGG - Intergenic
1201766515 Y:17577970-17577992 AAAAGAGACAGAGATGTAAAGGG + Intergenic
1201835037 Y:18328019-18328041 AAAAGAGACAGAGATGTAAAGGG - Intergenic
1201964997 Y:19722957-19722979 AAAAAATTCTAAAATGTATTTGG + Intronic
1202276131 Y:23121966-23121988 AATAAAATCAGAAATGAAATAGG + Intergenic
1202289897 Y:23298725-23298747 AATAAAATCAGAAATGAAATAGG - Intergenic
1202429124 Y:24755688-24755710 AATAAAATCAGAAATGAAATAGG + Intergenic
1202441667 Y:24914401-24914423 AATAAAATCAGAAATGAAATAGG - Intergenic
1202626835 Y:56868463-56868485 AACAAATTTATAGATTTAATTGG + Intergenic