ID: 961619264

View in Genome Browser
Species Human (GRCh38)
Location 3:128210674-128210696
Sequence GTAGGAATTGGCTGAATCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961619264_961619267 -10 Left 961619264 3:128210674-128210696 CCTCAGATTCAGCCAATTCCTAC 0: 1
1: 0
2: 0
3: 8
4: 168
Right 961619267 3:128210687-128210709 CAATTCCTACGGATTTCCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961619264 Original CRISPR GTAGGAATTGGCTGAATCTG AGG (reversed) Intronic
902961254 1:19964278-19964300 GTAGGAAGAGGCTCAAACTGTGG + Intergenic
906181416 1:43823049-43823071 GTGAGAAGTGGCTGGATCTGAGG - Intronic
910514387 1:88042866-88042888 GTAGGAACATCCTGAATCTGTGG - Intergenic
911332826 1:96544933-96544955 GTAAGAAGTGGCTAAATATGTGG + Intergenic
911528541 1:99015330-99015352 GTAGGAAATGGCAAAATATGAGG + Intergenic
914045409 1:144087439-144087461 TAAGGAACTGGCTGAATCTAGGG - Intergenic
914132701 1:144873246-144873268 TAAGGAACTGGCTGAATCTAGGG + Intergenic
918007711 1:180557509-180557531 TTAGGAATAGGGTGAATCAGGGG - Intergenic
919480363 1:198080368-198080390 GTGGGAGATGACTGAATCTGGGG + Intergenic
920919273 1:210284768-210284790 ATAGGAATTGGAGGATTCTGAGG - Intergenic
922637597 1:227190858-227190880 GTAGGAATGGGCAGAGTGTGTGG + Intronic
923261198 1:232269598-232269620 TTAGGAATTTGCAGAATCTTTGG - Intergenic
923711552 1:236391478-236391500 GTAGGAACTGGCACATTCTGAGG + Intronic
923762098 1:236856250-236856272 GTAGGAGTTGTCTGATTGTGTGG + Intronic
1066034012 10:31462333-31462355 GTAGAAATTGGTTGCAACTGTGG + Intronic
1068639206 10:59383154-59383176 GATGTAAGTGGCTGAATCTGTGG - Intergenic
1068741147 10:60472782-60472804 GTAGAAATTGACTGAATATCAGG + Intronic
1071075792 10:81750902-81750924 GTGGGAGTGGGCTGAGTCTGGGG - Intergenic
1072822381 10:98570689-98570711 GTAGAAAATGGCTGCTTCTGTGG - Intronic
1073435178 10:103511882-103511904 GCAAGAATGGGCTGATTCTGGGG + Intronic
1076278883 10:129228299-129228321 CAAGGAATTGGCTGGATCAGAGG - Intergenic
1077764184 11:5139801-5139823 GTAGAAATTGTATAAATCTGTGG - Intergenic
1077780605 11:5324895-5324917 GTTGGAAGGGGCAGAATCTGAGG - Intronic
1078175341 11:8965360-8965382 GTAGTTCTTGGCTGAATATGAGG + Intergenic
1079259211 11:18861819-18861841 GTAGGACTTGGCTGTATGTGAGG - Intergenic
1079261362 11:18885158-18885180 GTAGGACTTGGCTATATGTGAGG - Intergenic
1079645162 11:22853819-22853841 TTATGAATTTTCTGAATCTGTGG - Intronic
1079725928 11:23880599-23880621 GTTGGAAGTGGCTGAATCATGGG - Intergenic
1079975896 11:27091162-27091184 GGAGGGACTGGCTGAAGCTGCGG - Intronic
1080430786 11:32197133-32197155 GTAGGAAGTGGCTAGATATGAGG + Intergenic
1080941883 11:36927585-36927607 TTAGTAATTGGCTCAATTTGAGG + Intergenic
1083707698 11:64527598-64527620 GTAGCAATTTGTTGAACCTGAGG + Intergenic
1086158121 11:83691162-83691184 TTAGGAAATGGCAGAATCAGAGG + Intronic
1087743333 11:101914736-101914758 GTGGCAATTGCCTGTATCTGAGG + Intronic
1088926571 11:114308724-114308746 GTAGTAATTGGCTGGGTCTCTGG + Intronic
1090352345 11:126115423-126115445 GTAGGGACTGGCTGAATTTCAGG - Intergenic
1092702502 12:11247863-11247885 GTAGGATTTCCCTGCATCTGTGG + Intergenic
1095945463 12:47751103-47751125 GGAGGAGTTGGCCGAAGCTGTGG - Exonic
1099139397 12:78952644-78952666 GTAGGAATAGAGTGATTCTGTGG - Intronic
1099739653 12:86617348-86617370 TTTGGAGTTGGTTGAATCTGTGG - Intronic
1099927663 12:89037812-89037834 GTAGAAATTTGCTGATTGTGAGG - Intergenic
1101289691 12:103355218-103355240 GTAAGTGTTGGCTAAATCTGTGG + Intronic
1103156745 12:118691904-118691926 CAAGGAATTAGCTGAATTTGAGG - Intergenic
1107478511 13:40764381-40764403 TCAGAAATTGGTTGAATCTGTGG + Intronic
1111576824 13:90165224-90165246 ATAGAATTTTGCTGAATCTGGGG - Intergenic
1114037668 14:18645335-18645357 GCTGGAATTTGTTGAATCTGAGG + Intergenic
1114120966 14:19669688-19669710 GCTGGAATTTGTTGAATCTGAGG - Intergenic
1115526106 14:34282319-34282341 GGAGGAACTGGCTGGAGCTGTGG - Intronic
1116053963 14:39839961-39839983 GCAGGAATGGCCTGACTCTGGGG - Intergenic
1116336134 14:43658971-43658993 GTAGGACTTGCATCAATCTGTGG + Intergenic
1116705832 14:48298040-48298062 GGAGGAGATGGCTGAATTTGAGG - Intergenic
1120469503 14:84904262-84904284 GTGGGAAGTGACTGAATCTTGGG + Intergenic
1121834815 14:97082436-97082458 TTAGGAATTGGCTCAGTCAGTGG + Intergenic
1202871023 14_GL000225v1_random:164084-164106 GTGGGATTTGACTAAATCTGGGG + Intergenic
1124144017 15:27104264-27104286 ATGGCAATTGGCTGAATCAGTGG + Intronic
1127235070 15:57040467-57040489 GTAAGAATTGGCTGAATAGTAGG + Intronic
1128549363 15:68588175-68588197 GAAGGAACTGCCTAAATCTGAGG - Intronic
1128602997 15:69013629-69013651 ATGAGAACTGGCTGAATCTGTGG + Intronic
1128647780 15:69389648-69389670 GTAGGCAATGGCTGAGCCTGGGG - Exonic
1129170725 15:73805924-73805946 GTAGGAGCTGGCTGCATCGGAGG - Intergenic
1132098095 15:99003106-99003128 GAAGGATTTGGTTGAATCAGAGG - Intronic
1133601857 16:7347457-7347479 GTGGGAAATGACTGAATTTGGGG - Intronic
1143254393 17:5544826-5544848 GTAAGAATAGGCTGAATTTCAGG + Intronic
1143453517 17:7051105-7051127 GTAGGACTTTGCTGAGTCTGAGG + Intergenic
1147619994 17:41859655-41859677 ATAAGAATTGCCTGAACCTGGGG + Intronic
1148706748 17:49640816-49640838 GCAGGAATGGGCTTATTCTGAGG - Intronic
1148730840 17:49835448-49835470 GTGGGAATTAGTTGAGTCTGGGG + Intergenic
1151545477 17:74790383-74790405 GCAGGAAATGCCAGAATCTGCGG - Intronic
1155647545 18:28097526-28097548 TTAGCAGTTGGTTGAATCTGTGG - Intronic
1156318360 18:35993663-35993685 GTAGGAATGGCCAGAGTCTGTGG + Intronic
1157395824 18:47340040-47340062 GTAGGAATGGGCTGGAGCAGTGG + Intergenic
1158720106 18:59917209-59917231 GTAGGAATTGTCTGGTGCTGTGG - Intergenic
1160553597 18:79711957-79711979 CCAGGAAGTGGCTGAAGCTGAGG - Intronic
1166910088 19:46148313-46148335 GTAGGCATTAGCTCAACCTGGGG - Intronic
1167614395 19:50524142-50524164 GTAAGAAATGGTAGAATCTGTGG + Intronic
1168545178 19:57244161-57244183 GTAGAAAATGACTGAATTTGTGG - Intronic
1202684967 1_KI270712v1_random:40847-40869 TAAGGAACTGGCTGAATCTAGGG - Intergenic
926174810 2:10581287-10581309 GTAGGAGTTTGCTGGATCAGCGG - Intronic
926316487 2:11714246-11714268 GGAGGAAGAGGCAGAATCTGGGG - Intronic
927939689 2:27095715-27095737 GTAGGAACAGCCTGAACCTGAGG - Intronic
928960458 2:36920724-36920746 TAAGGAACTGGCTGAATCTAGGG - Intronic
931937714 2:67216672-67216694 TTAGGATTTGGCTAAATCTCTGG + Intergenic
932506545 2:72238081-72238103 GTAGTAATTGCCAGAAGCTGGGG - Intronic
932896447 2:75645400-75645422 GTATGGATAGGCTGAATTTGAGG + Intergenic
933572333 2:84028175-84028197 GTAGAACCTGGCTTAATCTGTGG - Intergenic
934246750 2:90314013-90314035 TAAGGAACTGGCTGAATCTAGGG + Intergenic
938273305 2:129993728-129993750 GCTGGAATTTGTTGAATCTGAGG - Intergenic
938442915 2:131352373-131352395 GCTGGAATTTGTTGAATCTGAGG + Intronic
940023123 2:149177137-149177159 GGTGGAATTGGCAGCATCTGTGG + Intronic
940712232 2:157176356-157176378 GGAGGAATTGGCTGAAACAAAGG - Intergenic
942913105 2:181269927-181269949 CAAGGAATTGGCAGCATCTGGGG - Intergenic
943521176 2:188950722-188950744 CTAGCAAATGACTGAATCTGAGG + Intergenic
943927428 2:193803115-193803137 GTAAGAATAGTGTGAATCTGTGG - Intergenic
944134444 2:196383379-196383401 ATAGGTATTGGCTGAATCCATGG + Intronic
1169737341 20:8851148-8851170 GCAGCAATTAGCTGGATCTGAGG + Intronic
1170710459 20:18786274-18786296 GTAGGAAATGACTGAATCATGGG - Intergenic
1170819599 20:19745094-19745116 CTAGGAATTAGCTAACTCTGAGG + Intergenic
1173881417 20:46415524-46415546 GGAGGAAGTGGCGGAATGTGGGG + Intronic
1177723826 21:24942019-24942041 GTAGGATTTAGCTAACTCTGGGG + Intergenic
1178791081 21:35700866-35700888 GCTGGAGTTGACTGAATCTGAGG - Intronic
1179184526 21:39074728-39074750 GCAGGAATTTTCTAAATCTGAGG + Intergenic
1180461797 22:15572377-15572399 GCTGGAATTTGTTGAATCTGAGG + Intergenic
1182755825 22:32678117-32678139 TTAGGAACTGGCCCAATCTGGGG + Intronic
1183325476 22:37189081-37189103 GTGGGAATTTCCTGAAACTGAGG + Intronic
949833806 3:8246187-8246209 GTGGGAGTTGGGTGACTCTGTGG - Intergenic
950775531 3:15346639-15346661 GTAGGAAGGGGCTGGATCAGGGG + Intergenic
951430232 3:22597779-22597801 GTAGAAATTGGCACAAACTGAGG - Intergenic
952532891 3:34280017-34280039 GTAGAGGTTGGCTGAAACTGGGG + Intergenic
955240038 3:57170036-57170058 GGAGGAATCAGCTGAGTCTGGGG - Intronic
961593277 3:127996562-127996584 GTAGGAATTGGCAAAACCTCTGG + Intergenic
961619264 3:128210674-128210696 GTAGGAATTGGCTGAATCTGAGG - Intronic
962102476 3:132357012-132357034 GTAGGAATTGCCTGAGGTTGGGG - Intronic
962810890 3:138958866-138958888 TTAGGAAATAGCTGAATTTGTGG + Intergenic
962935326 3:140075322-140075344 GCAGGATTTGGCTGAAGCAGTGG - Intronic
965782707 3:172304568-172304590 GTAGTAATGAGCTAAATCTGTGG - Intronic
968034950 3:195540391-195540413 TTTGGTATTGGCTGAATTTGTGG + Intronic
968523182 4:1043689-1043711 GTTGGAATTGGCAGGAGCTGTGG - Intergenic
969117265 4:4878465-4878487 ACAGGAACTGGCTGAGTCTGGGG + Intergenic
971131331 4:23814184-23814206 GTAGCACTGGTCTGAATCTGTGG + Exonic
972370698 4:38420555-38420577 GTGGGAAATGGCTGAATCATGGG - Intergenic
972551388 4:40138004-40138026 CTAGGAATTAGCTAAACCTGAGG + Intronic
974477674 4:62405011-62405033 GTAGGAGATGGCTGAATCATGGG + Intergenic
975728195 4:77312956-77312978 GTAGGAAGTGGCTTAGACTGAGG + Intronic
975736091 4:77382627-77382649 GTAGGAAGTGGCTTAGACTGAGG + Intronic
978239962 4:106503479-106503501 AGAGAAATTGGCTGATTCTGGGG + Intergenic
980337685 4:131497011-131497033 GTAGGGATTGGCTGAAGCTATGG - Intergenic
986533966 5:8767273-8767295 GGAGTAATTGGCAGAATCTGCGG + Intergenic
986822536 5:11483137-11483159 GAAGGAATTGGCTGAATTCTGGG + Intronic
987381482 5:17289711-17289733 GCAGAACTTGGCTGAATCTGGGG + Intergenic
989240515 5:39197743-39197765 GTAGGAGATGGCAAAATCTGGGG + Intronic
990625504 5:57605765-57605787 GGAGGAATTGGCAGAAGATGGGG + Intergenic
992104723 5:73440529-73440551 GTGGGTACAGGCTGAATCTGAGG - Intergenic
994777491 5:104052624-104052646 CTAGGGAATGGCTAAATCTGGGG - Intergenic
996960759 5:129246400-129246422 GTAGGAAATGGCTAAAAATGGGG - Intergenic
997016350 5:129939245-129939267 GTAGGAGGTGACTGAATCGGGGG - Intronic
999360147 5:150977449-150977471 GTAGGATTTGGCTTATCCTGTGG + Intergenic
1002195677 5:177499778-177499800 GGTGGAATTTGCAGAATCTGGGG - Intergenic
1006268248 6:32943516-32943538 GTTGGAATGGGCAGAATATGGGG + Intronic
1008554860 6:52664631-52664653 GTGGGAGTTGGCTGGACCTGTGG + Intergenic
1009609853 6:65927414-65927436 GTAGGAAGTGACTGAATCATGGG - Intergenic
1011019889 6:82801097-82801119 GGAGGAATTTGCTGCAGCTGTGG + Intergenic
1011787059 6:90858724-90858746 TTAGGAGGTGGCTGTATCTGTGG - Intergenic
1014654990 6:124091556-124091578 GTACACATTGGCTGAATGTGTGG + Intronic
1017282897 6:152642436-152642458 GTAGGATTTGGGTGAATCCGAGG - Intergenic
1017630034 6:156388196-156388218 CTAGGAAGTGGCTGAACCAGAGG + Intergenic
1017678933 6:156843976-156843998 GTAGGAGTTTGCTGGGTCTGGGG + Intronic
1018985987 6:168637658-168637680 TTAGGAATTAGATGAATCAGTGG - Intronic
1020615797 7:10459108-10459130 GGAGGGACTGGCTGAAACTGTGG - Intergenic
1021541892 7:21769063-21769085 GTAGAAATTGTGTGAATTTGAGG + Intronic
1029570597 7:101366063-101366085 GGAGGATGTGGATGAATCTGTGG + Intronic
1030528145 7:110678222-110678244 GTATGAATTGGCATACTCTGTGG - Intronic
1032359613 7:131243184-131243206 GTCTGAATTGGCGGAGTCTGGGG + Intronic
1035188076 7:157141170-157141192 GTAGGAACTGGCAGCAGCTGGGG + Intronic
1035993351 8:4516681-4516703 GTAGGGGTTGGAGGAATCTGGGG - Intronic
1036212590 8:6854330-6854352 CTAAGAATTGGCTGACTCTGAGG + Intergenic
1037768267 8:21784859-21784881 GTAGGAATCTGCTGAAGCCGGGG - Intronic
1039310761 8:36315690-36315712 GCAGAAAATGGCTGAACCTGAGG + Intergenic
1041522887 8:58774109-58774131 GTAGGAATTGATTGAAAGTGGGG - Intergenic
1047053518 8:121139128-121139150 GGAGGAATTGGCTGAAACAAAGG - Intergenic
1048518682 8:135134291-135134313 GTAGGACTTGGCTAACTCAGTGG + Intergenic
1055029846 9:71762630-71762652 GCAGGGCTTGGCTGAGTCTGAGG - Intronic
1056082081 9:83106101-83106123 GGAGGAATAGGCTGGATCTAGGG - Intergenic
1057732320 9:97621075-97621097 GGAGGGACTGGCTGAAGCTGTGG + Intronic
1058718318 9:107741412-107741434 GCAAGAATTGGCTGAAGCTGAGG + Intergenic
1187667682 X:21631541-21631563 GTAGGAATTGGTAAAATCAGTGG - Intronic
1190289640 X:48983715-48983737 GTAGGAATTGGCTCAGTCCATGG - Intronic
1190389319 X:49916378-49916400 GTAGGAATTCGATAAATCTTGGG - Intergenic
1192021862 X:67402517-67402539 GTAGGTATTGGCTGTAGCTAGGG + Intergenic
1193540695 X:82768101-82768123 GGAGGGACTGGCTGAAGCTGTGG - Intergenic
1194549759 X:95282424-95282446 GAAGGACTTGTCTGGATCTGGGG - Intergenic
1195877693 X:109559321-109559343 GTGAGAAGTGTCTGAATCTGTGG - Intergenic
1196717350 X:118824178-118824200 GTAGGATTTGCCTGGATTTGGGG + Intronic
1197722337 X:129753781-129753803 TTAGGAATTGGGTGGAGCTGTGG - Intronic
1198030104 X:132746591-132746613 GTGGGGATTGGCTGATTATGAGG - Intronic
1198265496 X:135004706-135004728 GTCGGAGTTGGGTGCATCTGTGG - Intergenic
1199325966 X:146498793-146498815 GAAGGAATTGGGGGAAGCTGTGG - Intergenic
1199652016 X:149954748-149954770 GTAGGAAGTGGGTGAGGCTGTGG - Intergenic