ID: 961619267

View in Genome Browser
Species Human (GRCh38)
Location 3:128210687-128210709
Sequence CAATTCCTACGGATTTCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 58}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961619262_961619267 25 Left 961619262 3:128210639-128210661 CCAATTACATCTCTGAATTTTTT 0: 1
1: 0
2: 5
3: 98
4: 1113
Right 961619267 3:128210687-128210709 CAATTCCTACGGATTTCCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 58
961619264_961619267 -10 Left 961619264 3:128210674-128210696 CCTCAGATTCAGCCAATTCCTAC 0: 1
1: 0
2: 0
3: 8
4: 168
Right 961619267 3:128210687-128210709 CAATTCCTACGGATTTCCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 58
961619261_961619267 26 Left 961619261 3:128210638-128210660 CCCAATTACATCTCTGAATTTTT 0: 1
1: 0
2: 3
3: 57
4: 535
Right 961619267 3:128210687-128210709 CAATTCCTACGGATTTCCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961619267 Original CRISPR CAATTCCTACGGATTTCCCC TGG Intronic
902070721 1:13733706-13733728 GAATTCCTACGCAATACCCCAGG - Intronic
902156987 1:14495692-14495714 CATTTCCTCCTGATTTCCCGAGG - Intergenic
903172780 1:21564036-21564058 CAATGCCCACAGATTTCCCTGGG - Exonic
908414978 1:63904390-63904412 CTTTTCCTCAGGATTTCCCCAGG + Intronic
910243366 1:85112440-85112462 CTATTCCTAGGGATGTACCCAGG - Intronic
912162551 1:107003381-107003403 CAATTCCTCCCTATTTCCCCAGG - Intergenic
1069414774 10:68188643-68188665 CATTTCCTACAGAATTCTCCTGG + Intronic
1075499472 10:122959562-122959584 CAGTTCCCACAGATTTCCACTGG - Intronic
1080570571 11:33552974-33552996 CATTTCCCAGGGATTTTCCCTGG - Intronic
1091562899 12:1628499-1628521 CAATAACTACAGATTTCCCCAGG - Intronic
1093894357 12:24561003-24561025 CAAATCCCACAGATTTCCCTTGG + Intergenic
1100179619 12:92071352-92071374 AAATTGCTACTGGTTTCCCCAGG - Intronic
1100979805 12:100155186-100155208 CAGTTCCTGTGGAATTCCCCAGG + Intergenic
1105326776 13:19377514-19377536 AAATACCTACGTATTTCCCTAGG + Intergenic
1105914854 13:24904228-24904250 AAATTCCCACTGATTTCCTCAGG - Intronic
1112881466 13:104110753-104110775 TAATTCCTTCTGATTTCCTCTGG + Intergenic
1112899244 13:104339191-104339213 CCATTCCTTCGTATTTCCACAGG + Intergenic
1112964408 13:105169450-105169472 CCTTTCCTAGGGATTTCCTCTGG - Intergenic
1113514410 13:110881636-110881658 AAATTCATATGAATTTCCCCTGG - Intronic
1117549519 14:56819770-56819792 CAACTCCTACAGTTTTCCCTAGG - Intergenic
1118535593 14:66760113-66760135 CATTTACTACCCATTTCCCCCGG + Intronic
1126882895 15:53118094-53118116 CAATTCCTCCTGGTTTCCCTGGG + Intergenic
1127965836 15:63922420-63922442 CAATTCTCAAGCATTTCCCCAGG + Intronic
1128225142 15:65996220-65996242 CCTGCCCTACGGATTTCCCCAGG - Intronic
1128235824 15:66066408-66066430 AAATTCCTATAGATTCCCCCTGG - Intronic
1128316646 15:66663699-66663721 CAGTTCCTAGGTATTTACCCAGG - Intronic
1141330854 16:83109251-83109273 CAAGTCCTACAGATTCCACCTGG - Intronic
1141870510 16:86782298-86782320 CCATTCCTAAGCATATCCCCTGG - Intergenic
1145979672 17:29004311-29004333 GAATTCCTAGGGACATCCCCAGG + Intronic
1164774818 19:30844752-30844774 CATTTCCTACCCATGTCCCCTGG - Intergenic
931612965 2:64123781-64123803 CAATTCCTAGGTATATACCCAGG + Intronic
936531881 2:113282258-113282280 CAATTCATCCTGATTTGCCCGGG - Intergenic
940765170 2:157782471-157782493 AATTTCCTTCGGATTTCTCCAGG - Intronic
1172227899 20:33317372-33317394 GAATTCCTCTCGATTTCCCCAGG + Intergenic
1185117852 22:48948248-48948270 CAATGCCCATGGATGTCCCCTGG + Intergenic
949867274 3:8556635-8556657 CAATTGCAACGGCTTTGCCCGGG - Intronic
961619267 3:128210687-128210709 CAATTCCTACGGATTTCCCCTGG + Intronic
963610276 3:147458256-147458278 CAATTCCCTCTGATTTCCCAGGG + Intronic
964537208 3:157736454-157736476 CAATTCTTTGGAATTTCCCCTGG - Intergenic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
981134097 4:141190431-141190453 CAGTTCCTAGGGATGTCCTCAGG - Intronic
984633344 4:182083873-182083895 GATTTCCTACAGATCTCCCCAGG - Intergenic
985820046 5:2153495-2153517 CCAGCCCTACTGATTTCCCCGGG - Intergenic
986967112 5:13287421-13287443 CTCTTCCTCCAGATTTCCCCTGG - Intergenic
996878441 5:128265931-128265953 CATTTCAGACAGATTTCCCCCGG - Intronic
998585778 5:143425864-143425886 CAACTCCTAGGAATTTACCCAGG + Intronic
1002163084 5:177328320-177328342 CAGTTCCTCTGGGTTTCCCCAGG - Intergenic
1004101358 6:12615460-12615482 CAATTCCTAAGCCTTTCCCTGGG - Intergenic
1007083392 6:39125161-39125183 CAATTCCTATGGTTTTCTTCAGG - Intergenic
1010407282 6:75519666-75519688 CAATTCCCACAGATTTTCCCTGG + Intergenic
1026009281 7:66624384-66624406 CAGTGCCTACTGATGTCCCCAGG + Intergenic
1028219913 7:88185028-88185050 CTTTTTCTACGGTTTTCCCCAGG + Intronic
1034149767 7:148905701-148905723 CAATTTTTACGGTTTTCCCAGGG - Intergenic
1039409853 8:37343623-37343645 CAATTCCTACTCATTTTCACTGG - Intergenic
1039512678 8:38104563-38104585 CAATATCTACGTATTTCCCATGG + Intergenic
1049917436 9:331998-332020 CACTTCCTACGTATGTCTCCTGG + Intronic
1055091300 9:72366336-72366358 AGATTCCTACGCATCTCCCCTGG + Intergenic
1058079138 9:100683528-100683550 CCACTCCTAGGTATTTCCCCAGG + Intergenic
1187095595 X:16144472-16144494 CAATTCCTACAGACTTCCGTAGG + Intronic
1187731987 X:22264658-22264680 CAATTCCTCTGGATTCTCCCTGG - Intergenic
1189715234 X:43858223-43858245 CAAATCCTACTCATTTTCCCAGG + Intronic
1193525341 X:82581504-82581526 CAAATACTACGCATTTCCCATGG - Intergenic