ID: 961620118

View in Genome Browser
Species Human (GRCh38)
Location 3:128217384-128217406
Sequence TACCCAACCCCATTTCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961620118_961620120 6 Left 961620118 3:128217384-128217406 CCAGGGTGAAATGGGGTTGGGTA 0: 1
1: 0
2: 1
3: 12
4: 126
Right 961620120 3:128217413-128217435 GTGTCCTGTTCATTCACCTTAGG 0: 1
1: 0
2: 1
3: 7
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961620118 Original CRISPR TACCCAACCCCATTTCACCC TGG (reversed) Intronic
901300415 1:8196321-8196343 TAGCCAACCCTATTTTGCCCAGG - Intergenic
901724440 1:11229772-11229794 TACCCCACCCCCATTCACTCAGG + Intronic
904620707 1:31773408-31773430 CAAACAACCCCATTTCTCCCTGG + Intergenic
905197517 1:36291916-36291938 TGCCCAACCCCATTTGCCCAGGG - Intronic
905243863 1:36598921-36598943 TACCCAGCCCCCTTCCACTCTGG - Intergenic
905356997 1:37391657-37391679 TGCCCAATCCCAGGTCACCCTGG + Intergenic
905452214 1:38064125-38064147 TCTCCAACCCCATCTCAGCCCGG - Intergenic
908419395 1:63945007-63945029 TACCAAAGCCCAGGTCACCCTGG - Intronic
908421209 1:63960079-63960101 CACACAAGCCCATTTCCCCCAGG + Intronic
908652797 1:66354319-66354341 TACCCTCCCCCATTTCAACTAGG - Intronic
909381411 1:75003137-75003159 TACTCAACCCAATTTCAGCTGGG - Intergenic
912976741 1:114337793-114337815 TACCCCACCCCATCCTACCCTGG + Intergenic
915361799 1:155290364-155290386 TCCCCATCTCCATTTCACACAGG - Exonic
917520478 1:175743976-175743998 TATCCCAACCCATTCCACCCTGG - Intergenic
920871666 1:209800001-209800023 TTCCCAACCCAATTTCAGCAAGG + Intronic
921681995 1:218044593-218044615 TCCCCACCCCCAACTCACCCTGG - Intergenic
1064572898 10:16714331-16714353 TGCCCAACCCCATTTCACACTGG - Intronic
1073607043 10:104906888-104906910 TACCTAACCCCAGCCCACCCCGG + Intronic
1076353400 10:129834085-129834107 TACCCAACGCCCTGTAACCCGGG - Intergenic
1076657091 10:132031921-132031943 TTGCCACCCCCATTTCCCCCTGG + Intergenic
1076659080 10:132043498-132043520 CATCCAACCCCGTTTCCCCCTGG - Intergenic
1076660897 10:132055524-132055546 TTCCCAATCCCATTTCATCATGG - Intergenic
1077644221 11:3909234-3909256 AACCCACCCTCATTTTACCCTGG - Intronic
1083334655 11:61915594-61915616 TCCCCAAACACAATTCACCCCGG + Intronic
1084270596 11:68027249-68027271 CAGCCAACCCCACTCCACCCAGG + Intronic
1085057076 11:73411323-73411345 TACCCCACCACACTGCACCCAGG + Intronic
1086849798 11:91796316-91796338 TCCCCATCCCCATCTCTCCCAGG + Intergenic
1088249881 11:107853212-107853234 TCCCTAACCCTATCTCACCCTGG + Intronic
1090630109 11:128638243-128638265 TACCCAACCACATTGCCCGCAGG + Intergenic
1093316588 12:17659035-17659057 TACCAAACCCCATTGCCCCCAGG - Intergenic
1094744531 12:33329574-33329596 TTCCCAACCCTAATTCCCCCTGG - Intergenic
1096712085 12:53464990-53465012 CCCCCAACCTCATTTCACCCAGG + Intronic
1100024119 12:90106797-90106819 TAACCCACTCCATTCCACCCAGG - Intergenic
1102036016 12:109770945-109770967 TGGCCAACCCCATCTCAGCCAGG + Intergenic
1103211660 12:119171526-119171548 TACCCAGCCCCCATTCACCATGG + Intergenic
1111132312 13:83993062-83993084 TACCCAACTCTATTTCACTTGGG + Intergenic
1112740945 13:102472312-102472334 GAACCCACCCCCTTTCACCCAGG + Intergenic
1113524230 13:110961581-110961603 TTCCCAGCCCCATTTCTCCAAGG + Intergenic
1113533935 13:111049553-111049575 CTCCCAGCCCCATGTCACCCCGG + Intergenic
1116167250 14:41349820-41349842 GAACCCACCCCTTTTCACCCAGG - Intergenic
1118107345 14:62675015-62675037 TACACAATCCCTTTTCACCCAGG + Intergenic
1118804553 14:69224191-69224213 TACCCATCCCCATGTTGCCCAGG + Intronic
1119667993 14:76498617-76498639 TCCCCCACCCCACTGCACCCGGG - Intronic
1120321150 14:82962614-82962636 GACCCAACCATATTTCATCCAGG - Intergenic
1125479511 15:40070435-40070457 CACCCAACCCCACTTCCCCGGGG + Intergenic
1126122662 15:45267605-45267627 AACCCAACTCGAGTTCACCCAGG - Intronic
1127622186 15:60744891-60744913 TTCCCCACCTCATTTCACCCGGG + Intronic
1132722042 16:1321253-1321275 AACCCAGCCCCATCTCACCACGG + Intronic
1132745377 16:1434126-1434148 TAGCCAAGCCCCTTCCACCCCGG + Intergenic
1133058927 16:3161697-3161719 TTTCCAACCACATTTCCCCCGGG - Intergenic
1134566494 16:15256505-15256527 TAGCAAAAGCCATTTCACCCAGG + Intergenic
1134736002 16:16500194-16500216 TAGCAAAAGCCATTTCACCCAGG - Intergenic
1134931522 16:18211965-18211987 TAGCAAAAGCCATTTCACCCAGG + Intergenic
1135386556 16:22046351-22046373 AACCTAACCCTATTTCCCCCAGG - Intronic
1136672323 16:31869823-31869845 TACCAAGCCACATTGCACCCTGG - Intergenic
1141754508 16:85982451-85982473 CCCCCAACCACAATTCACCCCGG - Intergenic
1143621675 17:8084493-8084515 CACCCAACCCCATTCCTGCCTGG + Intronic
1144628285 17:16856675-16856697 TCCCCACCCCCGTATCACCCGGG - Intergenic
1145909695 17:28535194-28535216 TTCCCACCCCCAGCTCACCCTGG - Exonic
1147242494 17:39099584-39099606 GACCCACTCCCATTCCACCCAGG - Intronic
1148769826 17:50060349-50060371 TACCCCACCCCAGTGCCCCCAGG + Intronic
1148863750 17:50618122-50618144 TCCCCTACCCCAACTCACCCAGG - Exonic
1149088669 17:52751416-52751438 GACCCCACCCCCTTCCACCCAGG - Intergenic
1155194059 18:23456172-23456194 TACCCCACCCCCTTCCGCCCTGG + Intronic
1160632575 18:80257098-80257120 CACCAACCACCATTTCACCCTGG - Intergenic
1165335403 19:35166323-35166345 CACCCAACCCCAGTTCTCACTGG - Exonic
1166332363 19:42086449-42086471 CACCCACCCCCATTCCAACCTGG + Intronic
1166794080 19:45415774-45415796 AGCCCAACCCCACTTCTCCCTGG + Intronic
925352093 2:3208672-3208694 AACTCAACCCCAATTCCCCCAGG + Intronic
926131543 2:10305868-10305890 CACCTAGCACCATTTCACCCTGG + Intronic
927087934 2:19689599-19689621 AACCCAACCCCCTTTCACAAGGG - Intergenic
929979384 2:46664491-46664513 TCCCCAGCCCCACCTCACCCTGG + Intergenic
931919771 2:67001910-67001932 TAGCAAACCACATTTTACCCTGG + Intergenic
932702227 2:73999892-73999914 CTCCCATCCCCATCTCACCCTGG - Intronic
933781782 2:85807590-85807612 TCCCCAGCCCCCTTGCACCCAGG - Intergenic
934290038 2:91684614-91684636 TGCCCAACGCCATTCCCCCCGGG - Intergenic
940389381 2:153114021-153114043 TGCCCAACCCCATTTTAGCTAGG + Intergenic
946684296 2:222251852-222251874 TACCCATCACAATTTCACCATGG + Intronic
946706326 2:222461962-222461984 TCCCCTAACCCATTTCACACAGG - Intronic
947117795 2:226790991-226791013 TACCCAAACCCTTGTCACACCGG + Intronic
948794902 2:240397519-240397541 TACCAAACCCCAGGTGACCCGGG + Intergenic
1168827807 20:825636-825658 TTCCCAAACACATTTAACCCTGG - Intergenic
1169295636 20:4395190-4395212 TCCCCATCCTCAGTTCACCCAGG + Intergenic
1170702416 20:18715184-18715206 TCCCCCACTCCATTTCCCCCAGG + Intronic
1171394137 20:24820180-24820202 TCCCCATCCCCTTCTCACCCTGG + Intergenic
1172340266 20:34152084-34152106 CACTCAACCCCACTTGACCCAGG - Intergenic
1172614204 20:36272893-36272915 TAGGCCACCCCCTTTCACCCAGG + Intergenic
1174278810 20:49423329-49423351 TCCCCACACCCCTTTCACCCAGG - Intronic
1174670470 20:52302872-52302894 CACCCAACCACATTCCAGCCAGG - Intergenic
1176240800 20:64074993-64075015 TGCCCCACCCCATCTCCCCCAGG - Intronic
1176241219 20:64076804-64076826 TGCCCCACCCCATCTCCCCCAGG + Intronic
1177933370 21:27313765-27313787 TACCCAACCCCAGAGCACCCAGG - Intergenic
955912763 3:63874724-63874746 TACCCATCTCCAGTTCAGCCTGG - Intronic
961620118 3:128217384-128217406 TACCCAACCCCATTTCACCCTGG - Intronic
962710685 3:138083282-138083304 CACCCAGCCACATTTCACCCAGG - Intronic
963063760 3:141246098-141246120 TTTCCAAACCCATTACACCCAGG - Intronic
968286652 3:197512987-197513009 TCCCCAACTCCATTCCACCCTGG + Intronic
969830665 4:9793950-9793972 TACCCAAGCCCTTTTCTTCCTGG - Intronic
972879820 4:43409601-43409623 AACCCAACACCAATGCACCCAGG + Intergenic
974250199 4:59375649-59375671 TACCCCAAGCTATTTCACCCTGG + Intergenic
976230498 4:82837797-82837819 TACCCAATCCCACTTCTCACTGG + Intronic
977877727 4:102168711-102168733 TACCTAATCACATTTCACCCTGG - Intergenic
979038982 4:115762850-115762872 TACCCAACTCCATTCCCCTCTGG + Intergenic
986290385 5:6394973-6394995 AACCCACCCCCAGTTCACCCGGG + Intergenic
990976428 5:61565406-61565428 TACACAACCCCCTTTCACTTAGG - Intergenic
995797941 5:115961813-115961835 CCCACAACCCCATTTCACCCGGG + Intergenic
996161021 5:120165407-120165429 TACCCAACCTATTTTCACACTGG + Intergenic
996621413 5:125508254-125508276 TACCCAAATGCATTTCACCATGG + Intergenic
997304279 5:132826522-132826544 TCCCCAACCCTGTTCCACCCAGG + Exonic
998732932 5:145101665-145101687 TAACTAACTGCATTTCACCCAGG + Intergenic
1007759299 6:44123627-44123649 TTCTCAACCCCATTTCACAAAGG + Intronic
1008899093 6:56590861-56590883 TAACCTGCCACATTTCACCCGGG + Intronic
1009548351 6:65052187-65052209 TACCCAACCCCATTTAGTTCTGG + Intronic
1011110846 6:83835345-83835367 TACCCAAGCTCTTTCCACCCTGG - Intergenic
1016776490 6:147910254-147910276 TACCCACCCCCAGGCCACCCAGG + Intergenic
1018216013 6:161528552-161528574 TACACAACCCCATTTCCACTTGG - Intronic
1018494274 6:164332700-164332722 TTCCAAACCCCACTTCACACTGG + Intergenic
1021561437 7:21972207-21972229 GACCCCACCCCTTTCCACCCAGG + Intergenic
1022426019 7:30269563-30269585 TTCCCAGCCCCATGGCACCCAGG + Intergenic
1025105858 7:56171663-56171685 GACCCAACCCCCTTCCAGCCTGG + Intergenic
1026172473 7:67966184-67966206 TGCCTTCCCCCATTTCACCCAGG + Intergenic
1032512274 7:132481461-132481483 TACCCAACCCCTTTTCTCCTGGG + Intronic
1035891700 8:3351551-3351573 CACCCAACTACATTTCAGCCTGG + Intronic
1042943290 8:74129245-74129267 TGACCAACCCCATTGCACTCTGG - Intergenic
1044750794 8:95413550-95413572 TTCCCAACTCCATTGCTCCCTGG + Intergenic
1047420590 8:124704889-124704911 CATCCAACCCCACTTCTCCCCGG + Intronic
1049443439 8:142619450-142619472 AACCCTGCCCCATTCCACCCTGG - Intergenic
1049772380 8:144389455-144389477 TCCCCTACCCCATCTCACCTGGG + Intronic
1051779606 9:20674930-20674952 AACTCTACCCCATCTCACCCTGG - Intronic
1052785290 9:32822611-32822633 TACCCATCCCCCTATCACCAGGG + Intergenic
1052857340 9:33415496-33415518 TACCCAAACCCATCTCACTGAGG - Intergenic
1056785941 9:89592565-89592587 AACCCTGCCCCACTTCACCCTGG - Intergenic
1057592845 9:96388741-96388763 TACTCAAGTCCATTTCACACAGG - Intronic
1057714885 9:97484863-97484885 TACCCAACCCCTTTACTCCAAGG - Intronic
1057855803 9:98599840-98599862 TACCCACCCCCATCTCTCCCTGG - Intronic
1058504973 9:105657616-105657638 TACACAACCCCCATCCACCCAGG + Intergenic
1061016387 9:127983156-127983178 TACCCAACCCCAGCTAAACCTGG - Intergenic
1186461779 X:9753943-9753965 CACCCCACCCCGTTTCCCCCAGG + Intronic
1188695539 X:33185873-33185895 TTCCCAAACTCATTTCACCATGG - Intronic
1193432328 X:81423720-81423742 TACATAACCCCATTTCATCAGGG + Intergenic