ID: 961623015

View in Genome Browser
Species Human (GRCh38)
Location 3:128239539-128239561
Sequence GAAGCCCACCTCAAGTTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961623015_961623018 9 Left 961623015 3:128239539-128239561 CCTCAGAACTTGAGGTGGGCTTC 0: 1
1: 0
2: 0
3: 11
4: 127
Right 961623018 3:128239571-128239593 ACCCCGTTCCTCCTGCCCACAGG 0: 1
1: 0
2: 1
3: 22
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961623015 Original CRISPR GAAGCCCACCTCAAGTTCTG AGG (reversed) Intronic
901455988 1:9363120-9363142 GAAGCCCACGTCTGTTTCTGTGG + Intronic
902712163 1:18247855-18247877 GAATCCCACTTCAAATCCTGTGG - Intronic
903056360 1:20638896-20638918 CAAGCCCACCTCCAGCTCAGAGG + Intronic
906748088 1:48235541-48235563 GAACCCAGCCTCTAGTTCTGTGG + Intronic
907046889 1:51305021-51305043 GCAGCCCAGCCCCAGTTCTGGGG + Intronic
909434991 1:75630792-75630814 GAAGCTCACCTGAGGTTCAGAGG + Intergenic
910480138 1:87649799-87649821 GAAGCACACCTCACTTTCTGAGG + Intergenic
914383637 1:147145705-147145727 GGAACCCATATCAAGTTCTGAGG + Intergenic
915542112 1:156574057-156574079 GATGCCCCCCTGAAGATCTGAGG + Intergenic
916919903 1:169453911-169453933 GAAGCCCACCACAAGTAAGGTGG - Intronic
917734837 1:177910965-177910987 GAAGCCCACAGCAAATTCTGTGG - Intergenic
919776967 1:201200473-201200495 CAAGCCCACCTCCAGGTGTGAGG - Intronic
922914281 1:229243084-229243106 GCTGCCCACCTCTAGTCCTGGGG + Intergenic
924694376 1:246383132-246383154 GAGGGCTACCTCAAGTTCTTGGG - Intronic
1065205209 10:23350758-23350780 AAAGCCAACCTCACATTCTGTGG - Intergenic
1066460789 10:35610536-35610558 GAAGCCCAGCCCAAGACCTGCGG - Intergenic
1070230022 10:74555838-74555860 TAGGACCAACTCAAGTTCTGAGG - Intronic
1070280842 10:75047145-75047167 GAGGCCCACCACAAGTTTTCAGG + Intronic
1072575020 10:96691398-96691420 GAAAAACAGCTCAAGTTCTGAGG - Intronic
1073134149 10:101210655-101210677 GAAACTCACATCAAGTTCTGGGG - Intergenic
1075863076 10:125694692-125694714 GCAGACCACCTCTAGTTCTCTGG - Intergenic
1078183680 11:9033121-9033143 GAAGTCAATCTCAAGCTCTGTGG - Intronic
1080193248 11:29576700-29576722 GTTGCCCTGCTCAAGTTCTGTGG - Intergenic
1083172452 11:60931009-60931031 AAAGCCCAGCTGCAGTTCTGCGG + Intronic
1083938962 11:65884927-65884949 GAAGCCAACTTCAAGGTCTGTGG - Exonic
1083947480 11:65932319-65932341 GAAGCCCACCTCAAGCGCTCTGG + Intergenic
1084170990 11:67401067-67401089 GAGGCACCCCTCAAGATCTGCGG - Exonic
1084171470 11:67403115-67403137 CAGGCCCACTTCCAGTTCTGAGG - Intronic
1086072598 11:82815549-82815571 GAACTCCTCCTAAAGTTCTGAGG - Intergenic
1087412721 11:97812072-97812094 GAAGCACACCGAAAGTTTTGGGG + Intergenic
1092732332 12:11546574-11546596 GAAGCCCTGCTAAAGTTCAGGGG - Intergenic
1095722116 12:45412259-45412281 GAAGGCCTCATCAAGTTCTCAGG - Intronic
1095728933 12:45483778-45483800 TAGGCCCACCTCCAGTACTGGGG + Intergenic
1096677073 12:53231829-53231851 GAAGCCCCCCTCAAGCCCGGCGG + Intronic
1101525655 12:105526788-105526810 CTAGCCCACCTCAAGTTGGGAGG + Intergenic
1102419760 12:112794275-112794297 TAAGTCCCCTTCAAGTTCTGGGG + Intronic
1103354908 12:120312522-120312544 GAACCCCACCTGGAGTGCTGAGG + Exonic
1104039728 12:125121974-125121996 GAGGCCAACCTCAGGCTCTGAGG + Intronic
1104874842 12:132026672-132026694 GAAGCCCTCCTCAGCTTCAGAGG + Intronic
1109575284 13:64248807-64248829 GAAGTCCACATCAACATCTGTGG - Intergenic
1116774860 14:49167549-49167571 CAGGCCCGCCTCAAGTGCTGGGG + Intergenic
1117431134 14:55662828-55662850 CAAGTTCACCTCAAGTTTTGTGG - Intronic
1118279104 14:64412512-64412534 AAAGCTCACCTCAGATTCTGTGG - Exonic
1118386075 14:65256500-65256522 AGAGCCCAGCTCAAGATCTGAGG - Intergenic
1122395451 14:101425547-101425569 GAGGCTAACCTCAGGTTCTGGGG + Intergenic
1122887223 14:104715481-104715503 GAAGCCCACCACCAGGGCTGCGG - Intronic
1123082893 14:105704319-105704341 GCAGCCCACCTCATCTACTGTGG + Intergenic
1129029858 15:72610221-72610243 GAGGCAGACATCAAGTTCTGGGG + Intergenic
1129699726 15:77760683-77760705 GGAGCCAGCCTCCAGTTCTGAGG + Intronic
1132682671 16:1149595-1149617 GAAGCCCACCCCACCTTCTTGGG + Intergenic
1135185219 16:20309834-20309856 GAAACCCACCACAATTTCTCAGG - Intronic
1136747330 16:32602417-32602439 GAAGCCCAACTCAGATTCAGGGG + Intergenic
1138562661 16:57811116-57811138 GAAGCCAACCCCAGGTACTGAGG - Intronic
1203049465 16_KI270728v1_random:861623-861645 GAAGCCCAACTCAGATTCAGGGG + Intergenic
1144336709 17:14277993-14278015 GAAGGCCACTTGAAGTTCAGTGG + Intergenic
1145233425 17:21191568-21191590 AAAGACCACCTCCAGTACTGAGG + Exonic
1147986447 17:44309860-44309882 GAAGCCCACCTGATGCCCTGAGG + Intronic
1149401217 17:56297740-56297762 GAAGCACACCTAAGGTTGTGAGG - Intronic
1152116707 17:78392397-78392419 GAAGCCCCCCTCAGTTACTGGGG - Intronic
1153437545 18:5083880-5083902 GAGGCCCAGCTTAAGTTTTGTGG - Intergenic
1157332700 18:46715033-46715055 GAAGCCCACATCAGGTTCATGGG + Intronic
1164799325 19:31063014-31063036 GAAGCCAGCTTCCAGTTCTGTGG - Intergenic
1165121796 19:33564495-33564517 AGGGCCAACCTCAAGTTCTGTGG - Intergenic
1167408775 19:49332669-49332691 TAAGGTCACCACAAGTTCTGGGG + Intergenic
1168102775 19:54149745-54149767 GGAGCCCACCTTGATTTCTGGGG - Exonic
925037959 2:706337-706359 GAGGCCCACCTGAAGGTCTGTGG + Intergenic
925171843 2:1754867-1754889 GGAGCCCACCCCAGGTTCTGTGG + Intergenic
927480870 2:23452931-23452953 GAAGCGCAGCTCAAGTGCTGGGG - Intronic
927828876 2:26330822-26330844 GAAGCTCACCACCAGTTCGGTGG + Intronic
928128142 2:28630160-28630182 GAATCGCTCCTCAAGTTCCGGGG - Intronic
929192580 2:39153259-39153281 GAGGCACACATCAAGTTCTGTGG - Intergenic
932760728 2:74437481-74437503 GAAGGCCTGTTCAAGTTCTGGGG - Intronic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
938369433 2:130760168-130760190 GGAGCCCAGCCCAGGTTCTGTGG + Intronic
940498996 2:154470873-154470895 CAAGCCCAGCTCCAGTTCTAGGG + Intergenic
940987797 2:160065738-160065760 GAGGCCCATCTCAAATTTTGGGG - Intergenic
944223922 2:197330486-197330508 GATGCCCAGCTCAAGTGCAGTGG - Intergenic
945779996 2:214157217-214157239 GAAACCCAACTCATGTGCTGCGG - Intronic
946397085 2:219448618-219448640 GAAGCGCAGCTCGAGGTCTGAGG - Exonic
948168515 2:235881644-235881666 GAATCCCAGCTCAAGGTGTGGGG + Intronic
1169824543 20:9752883-9752905 GAAGCACGCCAAAAGTTCTGAGG + Intronic
1171142767 20:22757415-22757437 GAAGACCACCTCAAGATTTCAGG + Intergenic
1171257384 20:23700460-23700482 GAAGGACACCTCAGATTCTGGGG + Intergenic
1171264803 20:23762620-23762642 GAAGGACACCTCAGATTCTGGGG + Intergenic
1171274541 20:23844949-23844971 GAAGGACACCTCAGATTCTGGGG + Intergenic
1172115410 20:32570645-32570667 GAGGCCCGTCTCAAGGTCTGGGG + Intronic
1181343660 22:22201629-22201651 GCAGCCCACCCCTAGGTCTGTGG + Intergenic
1183218025 22:36493787-36493809 GAACCTCACCTCCTGTTCTGTGG + Exonic
950630480 3:14278713-14278735 CAAGCCCACTTAAACTTCTGGGG - Intergenic
953385443 3:42503279-42503301 GAACCCCTTCTCAAGTCCTGGGG - Intronic
959924569 3:111907180-111907202 GACTCCAACCGCAAGTTCTGGGG + Intronic
961623015 3:128239539-128239561 GAAGCCCACCTCAAGTTCTGAGG - Intronic
966574775 3:181488040-181488062 TCTGCCCACCTCAGGTTCTGTGG + Intergenic
969450753 4:7271678-7271700 GAATCCCACCCCAGGTACTGAGG - Intronic
970431059 4:15989586-15989608 AAAGGCCAGCTCAACTTCTGGGG + Intronic
974704133 4:65489433-65489455 AAAGCCCACCTGAAGTACTAAGG + Intronic
985508216 5:296940-296962 GAATCTCATCTCAAGTTCTCTGG + Intronic
985739822 5:1608731-1608753 GAATCTCATCTCAAGTTCTCTGG - Intergenic
992221710 5:74580064-74580086 GAAGACCACCTCAAGATCGAGGG - Intergenic
995840239 5:116436953-116436975 GATGCCCACATCAAGGCCTGGGG - Intergenic
995926240 5:117378571-117378593 GATGCCTAGCTCAAGTTCTCTGG + Intergenic
996517089 5:124382859-124382881 GAAGACAACCATAAGTTCTGGGG + Intergenic
998565798 5:143214832-143214854 GACGCCCACATGCAGTTCTGGGG - Intronic
1001179434 5:169505438-169505460 GAAGCCCACCTAAAGGTATAAGG - Intergenic
1001599097 5:172917345-172917367 GACTCCCACCTCAACATCTGTGG - Intronic
1001987483 5:176086965-176086987 GAAGCCCAACTCAGATTCAGGGG + Intronic
1002229387 5:177751177-177751199 GAAGCCCAACTCAGATTCAGGGG - Intronic
1002265958 5:178032596-178032618 GAAGCCCAACTCAGATTCAGGGG + Intronic
1003582997 6:7359451-7359473 GAGGCCCATCACAACTTCTGTGG - Intronic
1005044069 6:21625241-21625263 GAAGACTACCTCAATTTCTAAGG - Intergenic
1007832858 6:44652168-44652190 GAAGGCGCCCTGAAGTTCTGGGG - Intergenic
1013470371 6:110458692-110458714 GATGCCCACCTCAACTGGTGAGG - Intronic
1017534024 6:155327447-155327469 GAAGGTCACCTCCAGTTCTGAGG + Intergenic
1020194160 7:6024353-6024375 GGAGCACACATCAATTTCTGCGG + Exonic
1026437128 7:70408777-70408799 GAAGCCCACAGCAAGGTGTGTGG - Intronic
1031344877 7:120652579-120652601 GAAGCCCACCTCTCCTTGTGTGG + Intronic
1032237130 7:130134883-130134905 GAAGCCTACCTCAGGCCCTGCGG - Exonic
1032494222 7:132348813-132348835 GGAGCCCACCTCAGGTCCTAGGG + Intronic
1034215322 7:149401217-149401239 TAACCCCACCTCCAGTGCTGTGG - Intergenic
1034432655 7:151048888-151048910 GAAGCCCACCTCAGGCCCAGAGG + Exonic
1037773844 8:21819704-21819726 GAAGACCACCAGAAGTTCTGTGG - Intergenic
1039482609 8:37885843-37885865 GAAGCCAACTCCATGTTCTGAGG - Intronic
1042796182 8:72665596-72665618 CAGGCCCACCTTAGGTTCTGAGG - Intronic
1047238106 8:123060344-123060366 GAAGGCCAGATCAACTTCTGGGG + Intronic
1049689215 8:143951413-143951435 GCAGCCCTCCTCATGTGCTGTGG - Intronic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1060410118 9:123394716-123394738 GAAGCCCACATCCTGTGCTGGGG - Intronic
1060699585 9:125739185-125739207 GATGCCAGCCACAAGTTCTGAGG + Intergenic
1061445492 9:130634993-130635015 CACGCCCACCTCAAGTCCTTTGG - Intronic
1194949918 X:100112554-100112576 GAAGCCCACCACCAATTCTTGGG - Intergenic
1195233492 X:102875071-102875093 GAAACCCATCTCAAGTGCAGAGG - Intergenic
1195404893 X:104502031-104502053 TGAGCCCACCTCAGTTTCTGAGG - Intergenic
1200299910 X:154962970-154962992 CAATCCCACCTCCAGATCTGAGG + Intronic