ID: 961623249

View in Genome Browser
Species Human (GRCh38)
Location 3:128240988-128241010
Sequence ACAAAACGGGCAGGTTTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 195}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961623249_961623256 -4 Left 961623249 3:128240988-128241010 CCTCTGAAACCTGCCCGTTTTGT 0: 1
1: 0
2: 0
3: 17
4: 195
Right 961623256 3:128241007-128241029 TTGTCCTGGAACACCCGCAGGGG 0: 1
1: 0
2: 0
3: 8
4: 76
961623249_961623261 25 Left 961623249 3:128240988-128241010 CCTCTGAAACCTGCCCGTTTTGT 0: 1
1: 0
2: 0
3: 17
4: 195
Right 961623261 3:128241036-128241058 ACAGAGCAATTGTTTTATTCTGG 0: 1
1: 0
2: 3
3: 16
4: 245
961623249_961623255 -5 Left 961623249 3:128240988-128241010 CCTCTGAAACCTGCCCGTTTTGT 0: 1
1: 0
2: 0
3: 17
4: 195
Right 961623255 3:128241006-128241028 TTTGTCCTGGAACACCCGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 68
961623249_961623254 -6 Left 961623249 3:128240988-128241010 CCTCTGAAACCTGCCCGTTTTGT 0: 1
1: 0
2: 0
3: 17
4: 195
Right 961623254 3:128241005-128241027 TTTTGTCCTGGAACACCCGCAGG 0: 1
1: 0
2: 0
3: 7
4: 59
961623249_961623257 -3 Left 961623249 3:128240988-128241010 CCTCTGAAACCTGCCCGTTTTGT 0: 1
1: 0
2: 0
3: 17
4: 195
Right 961623257 3:128241008-128241030 TGTCCTGGAACACCCGCAGGGGG 0: 1
1: 0
2: 0
3: 14
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961623249 Original CRISPR ACAAAACGGGCAGGTTTCAG AGG (reversed) Intronic