ID: 961623257

View in Genome Browser
Species Human (GRCh38)
Location 3:128241008-128241030
Sequence TGTCCTGGAACACCCGCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961623249_961623257 -3 Left 961623249 3:128240988-128241010 CCTCTGAAACCTGCCCGTTTTGT 0: 1
1: 0
2: 0
3: 17
4: 195
Right 961623257 3:128241008-128241030 TGTCCTGGAACACCCGCAGGGGG 0: 1
1: 0
2: 0
3: 14
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961623257 Original CRISPR TGTCCTGGAACACCCGCAGG GGG Intronic
903058560 1:20653762-20653784 TGTCTGGGAATACCTGCAGGAGG + Exonic
904347093 1:29879603-29879625 TGGCCTGCAACACCAGCAGCCGG - Intergenic
905259141 1:36705379-36705401 TGTCCTGGAGCCCCCAGAGGAGG + Intergenic
916208958 1:162343054-162343076 TGCCCTGGAACCCCTGCATGTGG + Intronic
921278872 1:213545855-213545877 TGTCCGGGAACACACACAAGAGG - Intergenic
923577880 1:235176867-235176889 TCTCCTGGAAGAGCAGCAGGAGG + Intronic
924791692 1:247256482-247256504 TGGCCTGGAGCACACTCAGGAGG - Intergenic
1064031702 10:11887045-11887067 TGTCCCGAAAGCCCCGCAGGAGG + Intergenic
1070734166 10:78852135-78852157 TGCCCTGGACCAACAGCAGGAGG + Intergenic
1072067328 10:91883880-91883902 AGTCCTGGATCACACACAGGCGG - Intergenic
1072324170 10:94280261-94280283 TCTCCTGCACCACCGGCAGGGGG + Intronic
1074528633 10:114281518-114281540 GTTCATGGAACACCAGCAGGTGG + Intronic
1075512173 10:123081429-123081451 TGGCCAGCCACACCCGCAGGTGG - Intergenic
1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG + Exonic
1083200914 11:61120559-61120581 GGTCCTGGAACAGCAGCAGCTGG + Intronic
1083541641 11:63515637-63515659 TGGCCTGGATCTCCCGCTGGGGG + Exonic
1084936514 11:72589927-72589949 TGTCCTCCGACACCAGCAGGAGG + Exonic
1091659904 12:2375616-2375638 CGGCCTGGAAAACCCACAGGTGG - Intronic
1093768945 12:22997862-22997884 TGCTCTGGAACACCAGCAGCAGG - Intergenic
1093991304 12:25592430-25592452 TGCCCTGGAACACCCCCACTAGG + Intronic
1096071642 12:48778654-48778676 TGTCCTGGGTCACTCACAGGAGG - Intronic
1100348655 12:93756872-93756894 TCTCCTGGCACACCTACAGGTGG + Intronic
1101800050 12:108013830-108013852 AGTCCTGGAAGACCTGAAGGAGG - Intergenic
1104927582 12:132321717-132321739 TGACCTGGGACACACACAGGTGG - Intronic
1114082158 14:19210747-19210769 TGCCCTGTACCACCCCCAGGAGG + Intergenic
1114703747 14:24705401-24705423 TCTCTTGGAACACTTGCAGGGGG + Intergenic
1120553372 14:85899416-85899438 TGTTCTCAAACACCCTCAGGGGG + Intergenic
1121762405 14:96456895-96456917 TGTCCTGGGACACCAGAAGGTGG + Intronic
1122799716 14:104223455-104223477 TGTCCTGGAACTGCGCCAGGGGG + Intergenic
1202872735 14_GL000225v1_random:178445-178467 GGTTCTGGAACACCGGAAGGAGG + Intergenic
1124594770 15:31083426-31083448 TGTCCTGGCACAGCTGCAGGTGG + Intronic
1124666296 15:31595769-31595791 GGTCCTGGCACACCTGAAGGAGG - Intronic
1126315534 15:47365364-47365386 TGCCCAGGGACTCCCGCAGGTGG + Intronic
1132950093 16:2556848-2556870 TGTCCTGGCACAGACGCAGGGGG + Intronic
1132964253 16:2643322-2643344 TGTCCTGGCACAGACGCAGGGGG - Intergenic
1134000553 16:10779575-10779597 GGTCCGGGAACACACGCAGCTGG - Intronic
1136639139 16:31547102-31547124 TGACCTGGAAGACACTCAGGAGG - Intergenic
1136639841 16:31554335-31554357 TGGCCTGGAAGACACTCAGGAGG - Intergenic
1137003572 16:35251927-35251949 TGGCCTGGAACAGTGGCAGGTGG - Intergenic
1137032152 16:35533244-35533266 TGGCCTGGAACAGTGGCAGGTGG - Intergenic
1138538659 16:57674579-57674601 GCTCCTGGATCACCTGCAGGTGG - Intronic
1142276593 16:89122116-89122138 TGGCCTGGGCCACCCGCAGTGGG + Intronic
1142496622 17:309596-309618 TATCCTGGACCCCCAGCAGGAGG - Intronic
1142496662 17:309709-309731 TATCCTGGACCCCCAGCAGGAGG - Intronic
1146957274 17:36942885-36942907 TGGCCTGGAGCACCCGCTGCCGG + Exonic
1148105841 17:45118391-45118413 TGTCCTGGAACACACACGTGTGG + Exonic
1148794847 17:50192011-50192033 TCTCCAGGAACACCCTGAGGGGG + Exonic
1150245019 17:63668246-63668268 TTTCCTGTAACTCCCTCAGGAGG - Intronic
1153321597 18:3779044-3779066 TTTTCTTGACCACCCGCAGGTGG + Intronic
1153928765 18:9859447-9859469 CATCCTGGAAGACCTGCAGGGGG + Exonic
1154230122 18:12548984-12549006 TGTCCTGGGACACTGCCAGGAGG - Intronic
1156738712 18:40297470-40297492 TGTCCTAGAACAACCTCAAGAGG - Intergenic
1160943537 19:1630896-1630918 TTTCCTGTGTCACCCGCAGGAGG + Intronic
1162016144 19:7847630-7847652 TGTCCTCTAAGACCCCCAGGAGG + Intronic
1162930562 19:13955573-13955595 ACTCCTGGAACCCCCCCAGGAGG + Intronic
1165040207 19:33063676-33063698 GGCCCTGGGATACCCGCAGGCGG - Intronic
1167207687 19:48113609-48113631 TGTCCTGATACTCCCGCAGGGGG - Intergenic
1167674277 19:50874830-50874852 TGTCCTGGTGCACCCCCAGTGGG + Exonic
1168705823 19:58469812-58469834 TGTCCAGGACCACCTACAGGAGG + Exonic
926581394 2:14634807-14634829 GCTCCTGGAGCACTCGCAGGCGG - Exonic
929741938 2:44611573-44611595 TGTTCTGGAACACCCACAAAAGG + Intronic
938494424 2:131785853-131785875 TGCCCTGTACCACCCCCAGGAGG - Intergenic
943206376 2:184902415-184902437 TGTCCTGGGCCACCAGAAGGTGG + Intronic
1172930269 20:38581444-38581466 TGTCCTGAAACAACTGCAGAAGG + Intronic
1173882118 20:46423391-46423413 TGTCTTGGAACATCCTCAGGAGG + Intronic
1174094659 20:48078741-48078763 GGTCCTGGAGCCCCAGCAGGTGG - Intergenic
1176711681 21:10155359-10155381 TGTCCTGTACCACCCCCAGGAGG - Intergenic
1179888650 21:44325243-44325265 TGTCCTGGGCCACCTGCAGCAGG + Exonic
1180231236 21:46427974-46427996 TGTCCTGTTACAGCTGCAGGTGG - Intronic
1180498616 22:15911923-15911945 TGCCCTGTACCACCCCCAGGAGG - Intergenic
1180601518 22:17021964-17021986 TGGCCTGGAACATGCTCAGGAGG + Intergenic
1180957331 22:19746864-19746886 TGTCCTTCAGCCCCCGCAGGTGG + Intergenic
1184270060 22:43375351-43375373 TGTCCTAGAACACTAGCAGCCGG - Intergenic
1185274419 22:49944188-49944210 TGGCCTGGGTGACCCGCAGGTGG - Intergenic
951569078 3:24043382-24043404 TTGCCTGGAGCACCTGCAGGCGG + Intergenic
954414514 3:50386591-50386613 TGGCCTGGGAGAGCCGCAGGAGG - Intronic
954879396 3:53823432-53823454 TGCCCCGGGACACCCGCAGCGGG + Exonic
959925202 3:111913300-111913322 TCTCCTGGAACACAGGGAGGAGG - Exonic
960579832 3:119267461-119267483 TGACCTGGGACAATCGCAGGTGG + Intergenic
961216156 3:125162275-125162297 TGTCCTCCAACACCAGCACGGGG - Intronic
961623257 3:128241008-128241030 TGTCCTGGAACACCCGCAGGGGG + Intronic
966820387 3:183919740-183919762 TGTCCAGGAACACAGGCAGCGGG + Intergenic
969631809 4:8343352-8343374 TTTCCTGGAGCAGCCTCAGGGGG + Intergenic
972177675 4:36427839-36427861 TGTCCTGGAAAACACCCAGATGG + Intergenic
972307360 4:37844464-37844486 TGTTCAGGAACAGCCTCAGGAGG - Exonic
982099867 4:151957449-151957471 TGGCCTGGGCCACCAGCAGGAGG - Intergenic
990517695 5:56545689-56545711 TGTCCTGGTACAGCTGCAGAGGG - Intronic
999613886 5:153401104-153401126 TGTTCTGGATCACCAGAAGGTGG + Intergenic
999982944 5:156975414-156975436 TGTCATGGACCACTTGCAGGTGG + Intergenic
1001506606 5:172284447-172284469 AGTCGTGGAAGACTCGCAGGCGG + Intergenic
1002319709 5:178367777-178367799 TGTCCTGGGGCACCAGCAGGTGG + Intronic
1002781179 6:367971-367993 TGGGCTGGAACACCCGCGTGTGG - Intergenic
1009507516 6:64503635-64503657 TGTCCTGAAACAGCAGCATGGGG + Intronic
1012579199 6:100844486-100844508 GGTTCTGAAACACCCGCAGCAGG + Intronic
1018344696 6:162888355-162888377 TTTCCTGGAGCTCCAGCAGGAGG - Intronic
1019775601 7:2910284-2910306 TCTCCTGGATCAGCGGCAGGTGG - Intronic
1024654219 7:51435331-51435353 TGTCCAGGAAGACCAGCAGTTGG - Intergenic
1025641563 7:63377616-63377638 TGGCCTGGAACACACTCAGGGGG - Intergenic
1029233331 7:99090199-99090221 TGCCCCGGATCACCCGCTGGAGG - Intronic
1029381352 7:100217278-100217300 TGTCCTGGACGGCCAGCAGGGGG - Intronic
1029400782 7:100344588-100344610 TGTCCTGGACGGCCAGCAGGGGG - Intronic
1036213590 8:6862155-6862177 TGTCCAGGTAGACACGCAGGTGG + Intergenic
1038004138 8:23415928-23415950 TGTCCTGGGGCTCCTGCAGGAGG - Intronic
1038670017 8:29575350-29575372 TAGCCTGAAACACCAGCAGGAGG - Intergenic
1038991505 8:32873450-32873472 TTTCCTGTAACACAAGCAGGAGG - Intergenic
1040582177 8:48707145-48707167 TGCCCTGGAATAGCTGCAGGTGG + Intergenic
1048890097 8:138939216-138939238 TGTCCTTTAACACACGCACGTGG - Intergenic
1049010803 8:139885894-139885916 CGTCCTGGAGCACCTGCAGCTGG - Exonic
1049745362 8:144260969-144260991 TTTCCAGAAACACCTGCAGGAGG + Exonic
1053360388 9:37482488-37482510 TATCCTGAAACACCAGCAGATGG + Intergenic
1053648672 9:40141050-40141072 TGTCCTGTACCACCCCCAGGAGG - Intergenic
1053757074 9:41322792-41322814 TGTCCTGTACCACCCCCAGGAGG + Intergenic
1054329654 9:63738991-63739013 TGTCCTGTACCACCCCCAGGAGG - Intergenic
1054535911 9:66235120-66235142 TGTCCTGTACCACCCCCAGGAGG + Intergenic
1057281232 9:93713057-93713079 TTGCCAGGAACACCCGCAAGGGG - Intergenic
1057972662 9:99572484-99572506 TGCACAGGAACACCCACAGGAGG - Intergenic
1060004299 9:119986098-119986120 AGTCCTGTAAGACCCCCAGGTGG + Intergenic
1060231644 9:121829880-121829902 TGTCCTTGACCATCCCCAGGTGG + Intronic
1060799118 9:126532498-126532520 TGGCCTGGAACAGAGGCAGGGGG - Intergenic
1061047784 9:128176463-128176485 GGTCCTGGAACTCCTGCAGCAGG + Exonic
1062401216 9:136373528-136373550 GCTCCTGGAAGACCCTCAGGTGG - Exonic
1202796436 9_KI270719v1_random:124348-124370 TGTCCTGTACCACCCCCAGGAGG - Intergenic
1203731726 Un_GL000216v2:98108-98130 GGTTCTGGAACACCGGAAGGAGG - Intergenic
1188263320 X:28041898-28041920 TCTCCAGGAACACCAGCACGTGG + Intergenic
1189344125 X:40227826-40227848 AGTCCTGGAACACTGGGAGGAGG + Intergenic
1197333412 X:125181570-125181592 TTTCATGGGACACCCGCAGCAGG - Intergenic