ID: 961625326

View in Genome Browser
Species Human (GRCh38)
Location 3:128258323-128258345
Sequence CCCTGTCCTTCCCACGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 296}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961625326_961625334 18 Left 961625326 3:128258323-128258345 CCAGCACCGTGGGAAGGACAGGG 0: 1
1: 0
2: 1
3: 22
4: 296
Right 961625334 3:128258364-128258386 GGGACCAGAGTGCTGAGCTCTGG 0: 1
1: 0
2: 3
3: 25
4: 242
961625326_961625333 -2 Left 961625326 3:128258323-128258345 CCAGCACCGTGGGAAGGACAGGG 0: 1
1: 0
2: 1
3: 22
4: 296
Right 961625333 3:128258344-128258366 GGCTCTGGAATAGGGCTTTTGGG 0: 1
1: 0
2: 0
3: 16
4: 156
961625326_961625331 -10 Left 961625326 3:128258323-128258345 CCAGCACCGTGGGAAGGACAGGG 0: 1
1: 0
2: 1
3: 22
4: 296
Right 961625331 3:128258336-128258358 AAGGACAGGGCTCTGGAATAGGG 0: 1
1: 0
2: 1
3: 23
4: 260
961625326_961625332 -3 Left 961625326 3:128258323-128258345 CCAGCACCGTGGGAAGGACAGGG 0: 1
1: 0
2: 1
3: 22
4: 296
Right 961625332 3:128258343-128258365 GGGCTCTGGAATAGGGCTTTTGG 0: 1
1: 0
2: 3
3: 8
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961625326 Original CRISPR CCCTGTCCTTCCCACGGTGC TGG (reversed) Intronic
900438081 1:2640942-2640964 CCCTGTCCTTCCCAAGGCAGAGG + Intronic
900656705 1:3762270-3762292 CTCTGTCCTCCCCAGGCTGCTGG + Intronic
901654538 1:10761919-10761941 CCCTTTCCTTCCCCCTTTGCGGG + Intronic
902606006 1:17569733-17569755 CCCAGCCTTTCCCACGGGGCAGG - Intronic
903217125 1:21849375-21849397 CCCTGTCCTTCACATGGGGAAGG + Intronic
903217364 1:21850613-21850635 CCCTGTCCTTCACATGGGGAAGG + Intronic
904058024 1:27685268-27685290 CCTTGTCCTCCCAAGGGTGCAGG - Intergenic
904192626 1:28758812-28758834 CCCTCTCCTCACCACTGTGCAGG - Intronic
905107208 1:35571355-35571377 CTCTGGCCTTCCCAAGCTGCTGG + Intergenic
905172934 1:36119687-36119709 CTCCTTCCTTCCCACTGTGCTGG - Intronic
905890590 1:41516293-41516315 CCCGGCCCTGCCCATGGTGCTGG - Intronic
906215066 1:44033867-44033889 CCATGCCCTTCCCACCCTGCAGG - Intergenic
906243482 1:44257077-44257099 CCCTTTCCTCCCCGGGGTGCTGG + Intronic
906920459 1:50058851-50058873 CCCTGAGCTTCCCAAAGTGCTGG + Intronic
913269622 1:117080259-117080281 CCTTGGCCTTCCCAAAGTGCTGG + Intronic
915189465 1:154136669-154136691 ACCTCGGCTTCCCACGGTGCTGG - Intronic
919814606 1:201429617-201429639 CACTGTCCTCAGCACGGTGCCGG + Intronic
919834191 1:201562510-201562532 CCCTGTCCTGCCCAGGGCTCAGG - Intergenic
922306638 1:224350410-224350432 GCCTGTGCCTCCCACGGTGCCGG - Intergenic
922408008 1:225338942-225338964 CTGTGTCCTCCCCACTGTGCAGG + Intronic
922950609 1:229556123-229556145 CCTTGGCCTTCCAAAGGTGCTGG - Intronic
924474482 1:244371230-244371252 CCCTTTCCTTCTCACTGGGCAGG - Intronic
1062908365 10:1195173-1195195 CCCTGTCCTTCCCCAGGTCCTGG + Intronic
1062958695 10:1557250-1557272 CCCCGTCCTCCCCTTGGTGCTGG + Intronic
1065333380 10:24627935-24627957 CCCTTTCCTTGCCAAGGTGAAGG - Intronic
1067082894 10:43221594-43221616 CCCTGTCCATCCCACAGGCCTGG - Intronic
1069405409 10:68093487-68093509 GCCTGGCCTTCCCAAAGTGCTGG - Intergenic
1069823995 10:71244244-71244266 CCCTGGCCTTCACAGGGTGGTGG + Intronic
1070578803 10:77703096-77703118 CTCTGTCCTTCTCCTGGTGCTGG - Intergenic
1070752560 10:78972814-78972836 CCTTGCCCTCCCCACGGTGGGGG + Intergenic
1076884676 10:133256590-133256612 GCCTCTGCTTCCCACAGTGCTGG - Intergenic
1076992506 11:282813-282835 CCCAGCTCTTCCCACGGAGCGGG + Intronic
1077218644 11:1405565-1405587 CCCTGTCCTGCCCAGGGGTCTGG + Intronic
1077225475 11:1437478-1437500 CCCTGCCCTTACCTCGGAGCAGG + Intronic
1078222771 11:9365175-9365197 GCCTCTCCTTCCCAAAGTGCTGG - Intergenic
1078502284 11:11892558-11892580 CCTTGGCCTTCCCAAAGTGCTGG - Intronic
1083241959 11:61395224-61395246 CCTTGGCCTCCCCAAGGTGCTGG + Intronic
1084129116 11:67119588-67119610 CCCTGTCCGCCCCCCGGGGCCGG + Intronic
1084313075 11:68327746-68327768 CCCTCTTCTTCCTAAGGTGCCGG - Intronic
1084560809 11:69904675-69904697 CACTGTCCCTCCCCAGGTGCTGG + Intergenic
1086926204 11:92643254-92643276 CCCTTTGCTTCTGACGGTGCAGG - Intronic
1088884932 11:113998996-113999018 CCCTGTCCTTCTGACGGTGGGGG - Intergenic
1088889674 11:114034785-114034807 CCCTCTCCTTCCCAGACTGCGGG - Intergenic
1089384791 11:118060494-118060516 CCCTGTCCTGCCCTCGCTGCCGG - Intergenic
1090217394 11:124981868-124981890 ACCTCAGCTTCCCACGGTGCTGG + Intronic
1090867008 11:130709929-130709951 CCCTGACCTTCCCAAGGCACAGG - Intronic
1091802826 12:3335155-3335177 CGCTGTCATCCCCACAGTGCAGG + Intergenic
1091807535 12:3366649-3366671 CCCTGTCCCTCTCAGGGTCCTGG + Intergenic
1092467576 12:8746988-8747010 CCCTCTGCTTCCCAAAGTGCTGG + Intronic
1092526480 12:9312942-9312964 CCCTGTCCTGGCCAAGCTGCCGG + Intergenic
1092540796 12:9418840-9418862 CCCTGTCCTGGCCAAGCTGCCGG - Intergenic
1093428102 12:19052032-19052054 ACCTGTGCTTCCCAAAGTGCTGG + Intergenic
1093925064 12:24902071-24902093 CCCTGCACTTCCCACCCTGCCGG + Intronic
1094512252 12:31103644-31103666 CCCTGTCCTGGCCAAGCTGCCGG + Exonic
1095881262 12:47139369-47139391 CCCTGACCCTCCCCCAGTGCAGG - Intronic
1095886103 12:47190232-47190254 CCCCGTTCTTCCCATGGTGCTGG + Intronic
1096263043 12:50104759-50104781 CCCTGTTCTTCGCAGGGTGTTGG - Intronic
1096650207 12:53058840-53058862 CCCTGTACCTCCCACCCTGCAGG - Intronic
1097025454 12:56052068-56052090 TCCTGGCCTTCCCAAAGTGCTGG - Intergenic
1101925992 12:108971801-108971823 CCTTGGCCTTCCCACAGCGCTGG - Intronic
1103413590 12:120729610-120729632 CTTTTTCCTTCCCTCGGTGCTGG + Intronic
1103918738 12:124388848-124388870 CCTTCTCCGTCCCACGGTGAGGG + Intronic
1104856279 12:131903867-131903889 CTCTGCCCTCCCCACTGTGCTGG - Intronic
1104954956 12:132459825-132459847 CCCTGGCCTTGCCACCATGCCGG + Intergenic
1105929922 13:25042628-25042650 ACCTGCCCTTCCCATGGTGAGGG - Intergenic
1107893220 13:44932191-44932213 CCCTTGCCTTCCCAAAGTGCTGG + Intergenic
1113191996 13:107759455-107759477 ACCTCGCCTTCCCACAGTGCTGG + Intronic
1113448457 13:110388281-110388303 CCCAGTGCCTCCCAAGGTGCCGG - Intronic
1114250189 14:20953138-20953160 CCCTGGACTTCCCAAAGTGCTGG - Intergenic
1115786245 14:36829145-36829167 ACCTCTCCCTCCCAAGGTGCTGG + Intronic
1118031989 14:61826916-61826938 CCGTGTCCTTACCAGGGTGGAGG + Intergenic
1118309558 14:64682407-64682429 CCCTGCCCTGCCCACGGCTCGGG - Intergenic
1118315548 14:64723748-64723770 CCCTCTGCCTCCCACAGTGCTGG + Intronic
1119019382 14:71094675-71094697 CCTTGGCCTCCCAACGGTGCTGG - Intronic
1119141321 14:72269813-72269835 CCTTGGCCTTCCCAAAGTGCTGG + Intronic
1119405471 14:74396047-74396069 CCATACCCTTCCCACTGTGCAGG - Intergenic
1121076593 14:91074004-91074026 ACCTCTACTTCCCAAGGTGCTGG - Intronic
1122311883 14:100802634-100802656 CCCTGTCCTGACCATGGTGATGG + Intergenic
1122312685 14:100807156-100807178 CCCTGGGCTTCCCAAAGTGCTGG - Intergenic
1122503055 14:102214017-102214039 CCCTGCCCTGCCTCCGGTGCCGG + Intronic
1125508031 15:40278241-40278263 CCCTGCCCGTCCTACTGTGCTGG - Intronic
1125679717 15:41523144-41523166 CCAGGTCCATCCCAGGGTGCAGG - Intronic
1128562130 15:68675826-68675848 CCCAGTGCTTCCCACAGTGCCGG - Intronic
1128634882 15:69296851-69296873 CCCAGTCCTTCCCACACTTCAGG + Intergenic
1129244096 15:74269324-74269346 CCCTGCCAGGCCCACGGTGCTGG - Intronic
1129673546 15:77620426-77620448 GCCTGTCCCTCCCACTGTGGGGG - Intronic
1131066167 15:89436155-89436177 CTCTGTCCTTCCTCTGGTGCAGG - Intergenic
1131191605 15:90321384-90321406 CCTTGGCCTCCCCAAGGTGCTGG - Intergenic
1132023594 15:98385615-98385637 CCATGTCCTTCCTTCGTTGCTGG - Intergenic
1132047608 15:98577874-98577896 CCTTGTCCTTCCAAAAGTGCTGG - Intergenic
1132505833 16:308215-308237 CTCTGTGCTTCCCTCGGTTCTGG + Intronic
1132958384 16:2608693-2608715 CCCTGCCCTCCCCACAGTGCAGG - Intergenic
1132970996 16:2688789-2688811 CCCTGCCCTCCCCACAGTGCAGG - Intronic
1134640902 16:15828495-15828517 CCCTGTCCCTGGCACTGTGCGGG - Intronic
1135092004 16:19524454-19524476 TCTTCTCCCTCCCACGGTGCTGG + Intronic
1135539866 16:23321502-23321524 CCCTGCCTTTCCCAGGGTCCAGG - Intronic
1135662108 16:24305920-24305942 CCCTGTGCCTCCCAAAGTGCTGG + Intronic
1135799211 16:25476883-25476905 CCTTGGCCTCCCCAAGGTGCTGG + Intergenic
1137649795 16:50110089-50110111 GCCTCTGCTTCCCAAGGTGCTGG + Intergenic
1138500757 16:57442409-57442431 GCCTCGCCTTCCCAAGGTGCTGG - Intronic
1138550241 16:57743883-57743905 CCCTCTCCTTTCCACGGGGATGG + Intronic
1138689131 16:58751397-58751419 CCCTCTCCTTTCCAAAGTGCTGG + Intergenic
1139738661 16:69015727-69015749 CCCTCTGCTTCCCAAAGTGCTGG + Intronic
1141614546 16:85202900-85202922 CTCTGACCTTCCCACAGAGCTGG - Intergenic
1142194544 16:88733389-88733411 CCCTGCCCTACCCACGCTTCCGG - Exonic
1142418203 16:89954467-89954489 CCCTGGCTTTCCCACGGAGCCGG + Intronic
1142574711 17:898906-898928 CCCTGTCCTTCCTTCTTTGCAGG - Intronic
1143494195 17:7301996-7302018 CACTGTCCTTCCCTCTTTGCAGG + Intergenic
1143671358 17:8398096-8398118 CACTGTCCTTCCCACCCTCCTGG + Intergenic
1144561152 17:16321185-16321207 CCCTCTGCTTCCCAAAGTGCTGG + Intronic
1144782927 17:17816921-17816943 CCCTGCCCTGCCCACTCTGCCGG + Intronic
1144834740 17:18150918-18150940 GCCTGGCCTGCCCAGGGTGCAGG + Intronic
1145769795 17:27484942-27484964 CACTGTCCTCCCCACGGAGTTGG + Intronic
1146069384 17:29666120-29666142 CCTAGTCCTTCCCAAAGTGCTGG - Intronic
1146906337 17:36620696-36620718 CCCCGTCCATCCCACCCTGCTGG - Intergenic
1147022969 17:37553527-37553549 CACTGTGCTGCCCACGTTGCTGG + Exonic
1147975561 17:44246366-44246388 GCCTGGGCCTCCCACGGTGCTGG - Intergenic
1148352029 17:46948018-46948040 CCTTGGCCTTCCCAAAGTGCTGG + Intronic
1150050859 17:61961277-61961299 ACCTGTGCTTCCCAAAGTGCTGG - Intronic
1151963518 17:77419624-77419646 CCCGGTCCCTCCCCCGGTGCTGG + Intronic
1152290288 17:79436457-79436479 CCCTGTCCCGCCCATGGGGCTGG - Intronic
1152460674 17:80440685-80440707 CCATGTCCTTCCCACGATGGCGG + Intergenic
1152477850 17:80529802-80529824 TCCTCTGCCTCCCACGGTGCTGG - Intergenic
1152579154 17:81158409-81158431 CGCTTTCCTTCCCAGGGAGCTGG - Intronic
1153264589 18:3257547-3257569 CACTGGCCTTCCCACGTTACAGG - Intergenic
1154502879 18:15005281-15005303 CCCTGTCCTCTCCAGGGTGTGGG + Intergenic
1158271650 18:55723208-55723230 GCCTGGGCTTCCCACAGTGCTGG - Intergenic
1158320253 18:56254339-56254361 CCCTCTGCTTCCCACATTGCTGG - Intergenic
1158356940 18:56631667-56631689 CCTTGGCCTCCCCACAGTGCTGG - Intronic
1158698715 18:59727117-59727139 CCTTGGCCTTCCCAAAGTGCTGG + Intergenic
1160178373 18:76613966-76613988 CCCTGTCCTTCCCTTTGTGTCGG - Intergenic
1160392313 18:78543480-78543502 CCTTGTTCTTCCCACTGTGCTGG + Intergenic
1160815487 19:1033846-1033868 CCGTGTCCCACCCACGCTGCCGG - Intronic
1160815522 19:1033986-1034008 CCGTGTCCCACCCACGCTGCCGG - Intronic
1160815644 19:1034478-1034500 CCGTGTCCCACCCACGCTGCCGG - Intronic
1160815661 19:1034548-1034570 CCGTGTCCCACCCACGCTGCCGG - Intronic
1160815678 19:1034618-1034640 CCGTGTCCCACCCACGCTGCCGG - Intronic
1161008469 19:1948178-1948200 CCCTCTCATCCCCAGGGTGCTGG + Intronic
1162319100 19:9960247-9960269 CCTTCTCCTTTCCAGGGTGCTGG - Exonic
1162414944 19:10530159-10530181 CCCTGTGCCTCCCAAAGTGCTGG - Intergenic
1163269083 19:16239180-16239202 CCCTCACCTTCCCAAAGTGCTGG + Intronic
1163532010 19:17855506-17855528 CCCTGCCCTTCCCTCTGTGCTGG - Intergenic
1163615197 19:18323006-18323028 CCCTGCCCTCACCATGGTGCCGG + Exonic
1164644010 19:29844933-29844955 CCCTGCCCCTCCCGCAGTGCGGG - Intergenic
1165256066 19:34577820-34577842 CCCAGCCCCTCCCATGGTGCTGG + Intergenic
1165762387 19:38329300-38329322 CCTTGGCCTTCCCAAGGTGCTGG - Intergenic
1166605635 19:44140530-44140552 CCTTGGCCTTCCCAAAGTGCTGG + Intergenic
925077249 2:1027149-1027171 CCCTGTTCTCTCCAGGGTGCAGG - Intronic
925189251 2:1869423-1869445 CCTTGTCCTGTGCACGGTGCCGG + Intronic
925237763 2:2293959-2293981 CCCTGTCCTGCCCCCCGTGCTGG - Intronic
925342280 2:3145879-3145901 GCCTGTCCTTCACACAGAGCTGG + Intergenic
926017373 2:9466089-9466111 CCCTGTGCCTCCCAAAGTGCTGG - Intronic
926411933 2:12613617-12613639 CCCTGCCCTTCCCACGCTTATGG + Intergenic
927975790 2:27337138-27337160 TCCTGTCCTTCCCCTGATGCTGG - Intronic
928541483 2:32288557-32288579 CCCTGGCCTTCCCCAAGTGCTGG - Intronic
928859469 2:35839462-35839484 CCTTGTCCTTGCAATGGTGCAGG + Intergenic
930320870 2:49853295-49853317 CCCTCTCCCTGCCACGGTGTGGG + Intergenic
931398745 2:61911222-61911244 CCCTGGCCTCCCCAAAGTGCTGG - Intronic
931770485 2:65492927-65492949 CTCTGCCCTTTCCACTGTGCAGG + Intergenic
932729466 2:74208132-74208154 CTCTGTGCTTCCCAAAGTGCTGG + Intronic
937874727 2:126814483-126814505 CCCTGGACTTCCCAAAGTGCTGG + Intergenic
938502045 2:131835451-131835473 CCCTGTCCTCTCCAGGGTGTGGG + Intergenic
942807235 2:179946192-179946214 CCCTCTGCTTCCCAAAGTGCTGG - Intronic
943834735 2:192504972-192504994 CCCTGCCCCTCCTACGATGCAGG + Intergenic
947184442 2:227442487-227442509 GCCTCTGCTTCCCAAGGTGCTGG + Intergenic
947403966 2:229755546-229755568 CCCTCGCCCTCCCACAGTGCTGG - Intergenic
948493444 2:238329237-238329259 CCCTGTCCTTCCCTTTGTCCCGG - Exonic
948712527 2:239833849-239833871 CCATGTCCCTCCCAGGGTGGAGG - Intergenic
948861758 2:240755932-240755954 GCCTGTACTTCCCACTCTGCAGG - Intronic
1169017855 20:2306218-2306240 CTCTTTCCTTACCACTGTGCTGG + Intronic
1169783894 20:9338428-9338450 CCCTCTGCCTCCCACAGTGCTGG - Intronic
1170691006 20:18614958-18614980 CCTTGGCCTCCCCACGTTGCTGG + Intronic
1172291020 20:33776907-33776929 GCCTGGCCTTCCCAAAGTGCTGG + Intronic
1172432988 20:34907959-34907981 CCCTGTCCTTCACACTATGAGGG + Intronic
1173180969 20:40806068-40806090 ACCTTTGCTTCCCAAGGTGCTGG - Intergenic
1175089431 20:56489643-56489665 CCATGTCCTCCTAACGGTGCTGG + Intronic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1176964327 21:15194644-15194666 CCCTCACCTTCCCAAAGTGCTGG - Intergenic
1178323650 21:31625441-31625463 TCCTGTCCTTGCCAAGGTTCTGG - Intergenic
1179323735 21:40318930-40318952 CCCTGTCCTTCCCACCCAGAAGG - Intronic
1180068064 21:45422654-45422676 CCCTTTCCTTGGCAGGGTGCTGG - Intronic
1180833415 22:18918023-18918045 CCCGGTCCTCCCCACCCTGCAGG - Intronic
1181256695 22:21567598-21567620 CTGTGTGCTTCCCACTGTGCTGG - Intronic
1181862350 22:25828845-25828867 CCCGGTCCTTGCCCTGGTGCCGG - Exonic
1182041470 22:27241911-27241933 CCCTGGCCTTGGCTCGGTGCCGG - Intergenic
1182388014 22:29963194-29963216 CCCTGGACTTCCCAAAGTGCTGG + Intronic
1182419687 22:30242903-30242925 CCCTGGCCATCCCAGGCTGCAGG + Exonic
1183412640 22:37664342-37664364 ACCTGTGCTTCCCAAAGTGCTGG + Intronic
1183479769 22:38057161-38057183 CCCTGCCCTTCCCAAGATGGCGG + Intronic
1183647032 22:39132854-39132876 CCCTGTCCTTCCTCCCGTGAGGG - Exonic
1184117569 22:42431212-42431234 CCCTGTCCTTAAAATGGTGCAGG + Intronic
1185062032 22:48612132-48612154 CCCTGTGCTTCCCACGGACGGGG + Intronic
1203283499 22_KI270734v1_random:143321-143343 CCCGGTCCTCCCCACCCTGCAGG - Intergenic
949708668 3:6848308-6848330 ACCTGAGCTTCCCACAGTGCTGG - Intronic
951220412 3:20063291-20063313 TCCTGACCTTCCCAGCGTGCTGG + Intronic
953694436 3:45146496-45146518 GCCTCTCCCTCCCAGGGTGCAGG + Intergenic
953992894 3:47497673-47497695 CCCTTTGCTTCCCAAAGTGCTGG - Intronic
954077942 3:48194937-48194959 CCCTGTCCTTCCCAAAGTGCTGG + Intergenic
954338559 3:49935283-49935305 CCTTGGCCTTCCCAAAGTGCTGG + Intergenic
954423691 3:50432235-50432257 CCCTGTGATTCCCAAGGGGCTGG + Intronic
954771635 3:52975437-52975459 GCCTTGCCTTCCCACAGTGCTGG - Intronic
956816055 3:72909317-72909339 GCCTGTCCCTCCCAAAGTGCTGG + Intronic
959541479 3:107544618-107544640 CCTTGGCCTTCCCAAAGTGCTGG - Intronic
961036655 3:123647186-123647208 CCCTGTGGTGCCCACGCTGCTGG + Intronic
961384876 3:126517744-126517766 TCCTGGCCTCCCCACAGTGCTGG - Exonic
961625326 3:128258323-128258345 CCCTGTCCTTCCCACGGTGCTGG - Intronic
961693280 3:128685956-128685978 GCCTCACCTTCCCACAGTGCTGG + Intergenic
962382401 3:134908563-134908585 CCCTGTCCTCACCACGCTGGTGG - Intronic
962579622 3:136786011-136786033 GCCTGTGCTTCCCAATGTGCTGG + Intergenic
962967109 3:140365538-140365560 CCATGTCCTTCCCACAGCCCAGG + Intronic
964752174 3:160062862-160062884 GCCTGGGCTTCCCAAGGTGCTGG + Intergenic
967310542 3:188102050-188102072 GCCTCTCCTTCCCAAAGTGCTGG + Intergenic
967739201 3:192986577-192986599 GCCTCGCCCTCCCACGGTGCTGG - Intergenic
967981669 3:195069663-195069685 CCCTGTCCTTCCCCCAGATCTGG + Exonic
968621268 4:1604432-1604454 CCCCCTCCTGCCCACGGTACGGG - Intergenic
968751967 4:2394835-2394857 CCCTGTGCCACCCACTGTGCTGG - Intronic
969686115 4:8675207-8675229 CCGTGTTCTTCTCACAGTGCAGG + Intergenic
970315821 4:14827442-14827464 CCTCGGCCTTCCCACAGTGCTGG - Intergenic
972032995 4:34486088-34486110 GCCTCTGCTTCCCAAGGTGCTGG + Intergenic
973705553 4:53576474-53576496 CCCTGCCCTTCCCATGAGGCAGG + Intronic
974564059 4:63561040-63561062 CCCTGGGCTTCCCAAAGTGCTGG + Intergenic
974794459 4:66730626-66730648 CCTTGGCCTTCCCAAAGTGCTGG + Intergenic
976183108 4:82417840-82417862 CCCTTGGCTTCCCAAGGTGCTGG + Intergenic
978470643 4:109063590-109063612 GCCTCTGCTTCCCAAGGTGCTGG - Intronic
979542659 4:121903609-121903631 CTCTGTGCTGCCCACGGTGATGG + Intronic
981050204 4:140302081-140302103 CCCTGGGCCTCCCAAGGTGCTGG + Intronic
981336009 4:143569579-143569601 CCCTTGGCTTCCCAAGGTGCTGG + Intergenic
981399531 4:144297191-144297213 GCCTCTCCCTCCCAAGGTGCTGG + Intergenic
981999642 4:151010629-151010651 CCTTGGCCTTCCCAAAGTGCTGG - Intronic
982824757 4:159988916-159988938 GCCTGTGCTTCCCAAAGTGCTGG - Intergenic
982995214 4:162335518-162335540 ACCTGGGCTTCCCAAGGTGCTGG + Intergenic
984860090 4:184230245-184230267 CCTGGTCCTAGCCACGGTGCTGG - Intergenic
985709907 5:1422371-1422393 CCCAGTGCTGCCCAAGGTGCTGG + Intronic
985709963 5:1422597-1422619 CCCAGTGCTGCCCATGGTGCTGG + Intronic
985709973 5:1422633-1422655 CCCAGTGCTGCCCATGGTGCTGG + Intronic
985709983 5:1422669-1422691 CCCAGTGCTGCCCATGGTGCTGG + Intronic
985709994 5:1422707-1422729 CACAGTGCTGCCCACGGTGCTGG + Intronic
985710003 5:1422743-1422765 CCCAGTGCTGCCCAAGGTGCTGG + Intronic
985710014 5:1422781-1422803 CACAGTGCTGCCCACGGTGCTGG + Intronic
985710031 5:1422855-1422877 CCCAGTGCTGCCCATGGTGCTGG + Intronic
985710068 5:1423005-1423027 CCCAGTGCTGCCCAAGGTGCTGG + Intronic
985710113 5:1423191-1423213 CCCAGTGCTGCCCATGGTGCTGG + Intronic
985710134 5:1423267-1423289 CACAGTGCTGCCCACGGTGCTGG + Intronic
985710143 5:1423303-1423325 CCCAGTGCTGCCCATGGTGCTGG + Intronic
986139617 5:5017573-5017595 CACCCTCCTTCCCACGATGCAGG - Intergenic
986410396 5:7473631-7473653 CCCTGTCATTCCCAGGGTACAGG - Intronic
986497465 5:8359645-8359667 CACTGGCCTTCCCCTGGTGCTGG - Intergenic
987055768 5:14189969-14189991 ACCTGGCCTTCCCAAAGTGCTGG + Intronic
987148235 5:15013225-15013247 CCTTGGCCTTCCCAAAGTGCTGG - Intergenic
989987059 5:50713488-50713510 CCCTGTGCCTCCCATAGTGCTGG + Intronic
990529751 5:56661440-56661462 TCCTGTCCTTCCCAGAGTGATGG + Intergenic
991988904 5:72318543-72318565 GCCTCTACTTCCCAAGGTGCTGG - Intronic
998013499 5:138714186-138714208 CCTTGGCCTTCCCAAAGTGCTGG + Intronic
999445326 5:151634141-151634163 CCCTGCCCTGCCCAGGCTGCTGG + Intergenic
999798770 5:155013662-155013684 CCCTCCCCTTCCCACCGTGCTGG + Intergenic
1001285929 5:170424170-170424192 CCCTGTCCTTACCCAAGTGCGGG + Intronic
1001381994 5:171311367-171311389 CCCTCTCCCTCCCCCGGTGCAGG + Exonic
1001966472 5:175913452-175913474 CCTTGTCCTTTCCACTGTGTGGG - Intergenic
1002185946 5:177454868-177454890 CCCGCTCCTTCCCATGGCGCCGG - Exonic
1002250475 5:177925752-177925774 CCTTGTCCTTTCCACTGTGTGGG + Intergenic
1003968996 6:11280475-11280497 CCCAGTCCTCCCCATGGTGGGGG - Intronic
1004225665 6:13782184-13782206 CCCTTGCCTTCCCAAAGTGCTGG + Intergenic
1006002984 6:30980935-30980957 ACCTGTGCTTCCCAAAGTGCTGG + Intergenic
1006037675 6:31226426-31226448 GCCTCTCCTTCCCAGGGTGGGGG - Intergenic
1011507877 6:88067969-88067991 CCCGTTCCTTCTCACGGGGCGGG - Intergenic
1011695265 6:89906777-89906799 CCTTGGCCTTCCCAAAGTGCTGG + Intergenic
1012853158 6:104470729-104470751 GCCTTGCCTTCCCAAGGTGCTGG - Intergenic
1013367101 6:109444791-109444813 CCCTGACCTCCACAGGGTGCAGG - Exonic
1017014451 6:150088881-150088903 CGCTGTGCTTCACATGGTGCAGG - Intergenic
1017770698 6:157642354-157642376 CCCTGTCCTGTCCCCAGTGCAGG + Intronic
1019578499 7:1748996-1749018 CCCTGTCCTTCCTAAAGTCCCGG + Intergenic
1019711159 7:2518913-2518935 CCCGGCCCTTCCCACGGGCCCGG - Intronic
1022310936 7:29195049-29195071 CTCTGTCCATCCCAGGCTGCGGG - Intronic
1023809376 7:43900202-43900224 CCTTGGCCTCCCCAAGGTGCTGG - Intronic
1027606394 7:80304779-80304801 ACCTGGGCCTCCCACGGTGCTGG + Intergenic
1027894547 7:84024288-84024310 CCTTGGCCTCCCCATGGTGCCGG - Intronic
1028721950 7:94043172-94043194 CCTACTCCTTCCCACTGTGCAGG + Intergenic
1029102373 7:98142725-98142747 CCCTGTTCTTCCTACGGTCTGGG - Intronic
1029624802 7:101714013-101714035 ACCTCTGCTTCCCACAGTGCTGG + Intergenic
1030192729 7:106825545-106825567 GCCTCACCTTCCCAAGGTGCTGG + Intergenic
1030289219 7:107855722-107855744 CCTTGGCCTTCCAAAGGTGCTGG - Intergenic
1031545271 7:123044431-123044453 CCCTCTCCCTCCCAAAGTGCTGG + Intergenic
1032087843 7:128893070-128893092 CCCTGTCCTTCCCAGGACACAGG + Intronic
1032088971 7:128901375-128901397 CCCTCTGCCTCCCACAGTGCTGG - Intronic
1033587000 7:142781419-142781441 CCCTTTGCCTCCCAAGGTGCTGG + Intergenic
1034917446 7:155052525-155052547 GCCTGGCCCTCCCAAGGTGCTGG - Intergenic
1035043885 7:155951639-155951661 CCCTGACCGTCCCTCCGTGCAGG + Intergenic
1035827160 8:2656835-2656857 ACCTGTGCTTCCCAAAGTGCTGG + Intergenic
1035888459 8:3318849-3318871 CCCTGTGCTTTCCACGGGGCAGG + Intronic
1036682051 8:10882420-10882442 CCCTGACCTCGCCACGGTGGGGG + Intergenic
1036926341 8:12909554-12909576 CCCTGTCCTGCCCAAGGCCCTGG - Intergenic
1037797650 8:22010168-22010190 CCCTTTCTTTCGCAGGGTGCAGG - Intergenic
1039702902 8:39979600-39979622 GCCTGGGCTTCCCACAGTGCTGG + Intronic
1040566939 8:48575991-48576013 TCCTGTCCTTCCCCAAGTGCTGG + Intergenic
1042044522 8:64634318-64634340 ACCTTGCCTTCCCAAGGTGCTGG - Intronic
1042839400 8:73108554-73108576 TCCTGTCCCACCCATGGTGCTGG - Intronic
1049796291 8:144498679-144498701 CCTTGTCCTTCCCTGGGTCCTGG + Intronic
1049854038 8:144850555-144850577 CCCTGCCCTTCCCATGAGGCAGG - Exonic
1051174401 9:14348097-14348119 ACATTTCCTTCCCAGGGTGCAGG - Intronic
1051184391 9:14443076-14443098 TTCTGTCCTTCCCAGAGTGCAGG + Intergenic
1055381143 9:75707640-75707662 CCCTCGGCTTCCCACAGTGCTGG - Intergenic
1057306943 9:93918039-93918061 CACTGTCCTTTCCACGGAGCTGG - Intergenic
1058649187 9:107159229-107159251 CCCTGTCCTTCCCACAACACAGG - Intergenic
1058697169 9:107569327-107569349 CTCTGACCTTTCCACGGGGCAGG + Intergenic
1058847622 9:108976780-108976802 CCTTGGCCTCCCCACAGTGCTGG + Intronic
1060463878 9:123885116-123885138 CCCTGTACTTCCCACTCTCCAGG + Intronic
1061014535 9:127974230-127974252 CATTGTCCTTCCCTGGGTGCAGG + Intronic
1061124671 9:128666949-128666971 CCCTCTGCTTCCCAAAGTGCTGG - Intergenic
1061676201 9:132217140-132217162 CACTGTCCTTCCCACTTTACAGG - Intronic
1061726267 9:132583547-132583569 CCCTGCCCTTCCAGCAGTGCTGG + Intronic
1061848677 9:133402247-133402269 CCCTCTCCTTCCCACAGTCCTGG - Intronic
1061974238 9:134060345-134060367 TCCTGCCCCTCCCAAGGTGCTGG - Intronic
1062431500 9:136528637-136528659 CCCTTCCCTTCCCAGGGAGCCGG - Intronic
1062497401 9:136838228-136838250 CCCTGTCCTCTCCAGGGTGTGGG - Intronic
1062634955 9:137485844-137485866 CCATGTCCTTGCCACTGTGCTGG - Intronic
1191253430 X:58269869-58269891 GCGTGTCCTTCCCACAGTGGGGG - Intergenic
1192344486 X:70289974-70289996 CCCTCCCCTTCCCACCGCGCCGG + Exonic
1192466030 X:71356760-71356782 GCCTGTGCTTCCCAAAGTGCTGG + Intergenic
1192496794 X:71621614-71621636 TCATGTCCTTCCCAGGTTGCTGG + Intergenic
1199929940 X:152507681-152507703 CCATGTCCCTCCCACAGTGGAGG + Intergenic