ID: 961627170

View in Genome Browser
Species Human (GRCh38)
Location 3:128272126-128272148
Sequence GTGTGGGCCACACACTCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961627164_961627170 1 Left 961627164 3:128272102-128272124 CCAGAACTGGCTCTGCCCTGTCG 0: 1
1: 0
2: 2
3: 49
4: 165
Right 961627170 3:128272126-128272148 GTGTGGGCCACACACTCAGGTGG 0: 1
1: 0
2: 1
3: 16
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961627170 Original CRISPR GTGTGGGCCACACACTCAGG TGG Intronic
900421260 1:2556952-2556974 GAGTGGGGGACACACGCAGGAGG - Intronic
903027052 1:20436859-20436881 CTGTGGGCCTCACACACAGTAGG - Intergenic
903063212 1:20684484-20684506 GAGTGGGTCTCACATTCAGGAGG + Intronic
903220066 1:21864509-21864531 GTTTGGGCCACACTCTCCGGGGG - Intronic
906282496 1:44563932-44563954 GTGTGGGTCTCTAACTCAGGAGG - Intronic
906611618 1:47208006-47208028 GTGTGGGGCTCACCCACAGGAGG - Intergenic
909959748 1:81825239-81825261 CTGTGGTCCCCACTCTCAGGAGG + Intronic
911631792 1:100191903-100191925 CTGTGTGCCACCTACTCAGGAGG - Exonic
913234612 1:116768891-116768913 CTGTGGCCCACAGCCTCAGGAGG - Exonic
915089786 1:153416386-153416408 GTGTGTGGGACACACCCAGGAGG - Intergenic
916637949 1:166693983-166694005 CTGTGAGCCACACACTCTAGGGG + Intergenic
917436386 1:175025280-175025302 AAGTGGCCCACACACTAAGGGGG - Intergenic
917798074 1:178546265-178546287 TTGAGGGCCACACACAGAGGAGG + Intronic
920323335 1:205141522-205141544 CTGTGGTCCAGATACTCAGGAGG + Intergenic
920938200 1:210455782-210455804 GGGTGGGAAACACAATCAGGAGG - Intronic
921225417 1:213015169-213015191 GTGTGTGGCACACGCCCAGGAGG - Intronic
921673520 1:217952029-217952051 GTGTGGGCCTCATCTTCAGGTGG - Intergenic
1067111853 10:43407169-43407191 GTCAGGGCCACAGCCTCAGGCGG - Intronic
1070126460 10:73625914-73625936 GTGAGTGCGACACCCTCAGGGGG - Intronic
1071235717 10:83645938-83645960 GTGTGTGACACAGCCTCAGGAGG + Intergenic
1074046855 10:109847236-109847258 GTGTGGGCTATATCCTCAGGAGG + Intergenic
1074543432 10:114384813-114384835 GCGGGGCCCACACACTCAGTGGG + Intronic
1076898287 10:133324972-133324994 CTGTGGGCCACACATCTAGGAGG + Intronic
1077327675 11:1970720-1970742 CTGTGGGCCGCAGACTCAGAAGG + Intronic
1077888791 11:6404459-6404481 GTGGGTACCACACACACAGGCGG + Intronic
1083293077 11:61700482-61700504 TTGCAGGCCACACCCTCAGGAGG - Intronic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1087904900 11:103684434-103684456 GTGTCTGCCACACATGCAGGTGG - Intergenic
1089319418 11:117614869-117614891 GTGTTGGCCACACTGTGAGGGGG - Intronic
1089682692 11:120128211-120128233 GTCTGAGCCAGGCACTCAGGTGG - Intronic
1090360306 11:126167688-126167710 CTGTGGTCCACACTCTTAGGAGG + Intergenic
1091231497 11:133990843-133990865 TTGTGGGGTACACACTCTGGTGG - Intergenic
1091281050 11:134381886-134381908 GGGTGGGCCACACACTGGGCAGG - Intronic
1202810657 11_KI270721v1_random:25900-25922 CTGTGGGCCGCAGACTCAGAAGG + Intergenic
1093284374 12:17240166-17240188 GTGGGGTCCACTCAGTCAGGAGG - Intergenic
1094234669 12:28150083-28150105 GTGTGTGGCACACACTCATATGG - Intronic
1094336446 12:29361128-29361150 GTGTGCGCCAGCTACTCAGGAGG + Intronic
1096548095 12:52355088-52355110 GTCTGGGCCACACACACACCAGG + Intergenic
1097107021 12:56631972-56631994 GTGTGGGCCACAGACACAGAAGG + Intronic
1097690398 12:62729212-62729234 GAGTGGGTCACACACTGAAGAGG + Intronic
1099074285 12:78085658-78085680 GTGTGGGCTGAACATTCAGGAGG + Intronic
1101748101 12:107559357-107559379 GTCTGGGGCCAACACTCAGGGGG + Intronic
1103046253 12:117737079-117737101 GTGTGGATCAAACACTCATGAGG - Intronic
1104278038 12:127348025-127348047 CTGTTGGCCACAGACTCAGGGGG + Intergenic
1104766363 12:131332898-131332920 GTGAGGGCCGCACACAGAGGTGG + Intergenic
1104772163 12:131370183-131370205 GGGTGGGCCACACCCTCCTGGGG - Intergenic
1104842074 12:131830125-131830147 GTGGGGCCCACACACTCAGGAGG + Intronic
1105787755 13:23766755-23766777 GTGGTGGACACACTCTCAGGAGG + Intronic
1106561114 13:30847088-30847110 ATGAGGGCTACACACTCAGTGGG - Intergenic
1107612408 13:42129247-42129269 GTGTATGCCACGCACTCAGCAGG + Intronic
1111243951 13:85510013-85510035 GTGTGGGCCACAGTCTTAGTGGG - Intergenic
1114022998 14:18498003-18498025 GTGAGGGTCAAACACTCAGAAGG - Intergenic
1114023032 14:18498291-18498313 GTGAGGGTCAAACACTCAGAAGG - Intergenic
1116851293 14:49912081-49912103 GTGTGGGCCACTTACTCCTGGGG + Intergenic
1118216252 14:63811375-63811397 CTGTGGGCCAGCTACTCAGGAGG - Intergenic
1118278107 14:64404131-64404153 ATGTGGCCCACACACTCTTGAGG - Intronic
1118720748 14:68591963-68591985 GAGCTGGGCACACACTCAGGAGG + Intronic
1119147473 14:72330247-72330269 GTGTGTTACACACACTCAGTGGG - Intronic
1119647600 14:76359658-76359680 CTGTGGGCCACTTCCTCAGGTGG - Intronic
1121736790 14:96224311-96224333 GTCTGGGCCAGAACCTCAGGTGG - Intronic
1122423030 14:101589309-101589331 GTGTGGGGCACACACTCCCTGGG - Intergenic
1122970099 14:105149016-105149038 ATGGGGGCCACACACGCCGGAGG + Exonic
1124829542 15:33134593-33134615 CTGTGGGCCACAAAGTCAAGTGG + Intronic
1127384905 15:58459649-58459671 GTGTGGGCCACACCCTATGTGGG - Intronic
1127388566 15:58486997-58487019 GTGTGAGGTACACACGCAGGAGG - Intronic
1128664840 15:69530560-69530582 AAGTGGGGCAGACACTCAGGTGG + Intergenic
1129363906 15:75042836-75042858 GTGTGTGCCCTACACTCATGGGG - Intronic
1130704337 15:86218426-86218448 GTGGGGGACAGACTCTCAGGTGG + Intronic
1134477277 16:14586099-14586121 GTGTGGTCCAGCTACTCAGGAGG - Intronic
1135405140 16:22192053-22192075 GAGTGGGACACACACTGCGGTGG - Intergenic
1137274150 16:46922514-46922536 CTGCAGGCCACACCCTCAGGAGG - Intronic
1137712668 16:50577176-50577198 GTGAGGGCCACAAGGTCAGGAGG - Intronic
1138346137 16:56321388-56321410 GTGTTGGCTGCACACTCAGAGGG + Intronic
1138926040 16:61592599-61592621 GTGTGGGTCACAGATCCAGGTGG - Intergenic
1143356337 17:6331519-6331541 GTCTGGGTCACATGCTCAGGTGG + Intergenic
1143526847 17:7478094-7478116 GTGTGGGCCTCAGACCCAAGAGG - Intronic
1144949220 17:18985038-18985060 GTGTGGGCTCCAAGCTCAGGAGG + Intronic
1147690815 17:42313242-42313264 GAGGGGGCCTCACACACAGGTGG - Intergenic
1148091799 17:45026880-45026902 GTCTGGGCCACACCTTCAGGAGG - Intronic
1150221409 17:63497618-63497640 GTGAGGGACACAGACTCAGATGG - Intronic
1151578027 17:74962696-74962718 GTGTGGGGCTCAGACACAGGAGG - Intronic
1152339478 17:79716286-79716308 GTGTGGGGCTGACACCCAGGAGG + Intergenic
1154215740 18:12414821-12414843 ATTTGGGCCACACACCCTGGTGG - Intronic
1155025437 18:21936165-21936187 TTCTGGGCCACACACTCTGTGGG + Intergenic
1157815289 18:50725523-50725545 GTGTGGGCCACACTCAGAGGTGG - Intronic
1160021553 18:75185434-75185456 TAGTGGGCCACAGACTCTGGAGG - Intergenic
1160131071 18:76225394-76225416 GTGTGGGCCACATGCACAGATGG + Intergenic
1160154090 18:76419939-76419961 GCGTGGGCCTCACACACAGTGGG - Intronic
1161041923 19:2114909-2114931 ATGCGGGCCACACGCACAGGTGG + Intronic
1161296979 19:3525091-3525113 ATGAGGGCCACACTCCCAGGTGG + Intronic
1161323857 19:3653622-3653644 GGCTGGGCCACAGACTCACGGGG + Intronic
1162950229 19:14067708-14067730 GTGTGGGCCTGCTACTCAGGAGG - Intergenic
1165405572 19:35628964-35628986 GATTTGGCCACACCCTCAGGGGG - Intergenic
1166390392 19:42406138-42406160 GTGAGGCCCACACCCTCAGCAGG - Intronic
1167118712 19:47503637-47503659 GCGGGGGCCACAGACTCAAGAGG - Intronic
925142106 2:1557734-1557756 CTGTGTCCCACACAGTCAGGGGG - Intergenic
926043288 2:9691699-9691721 GGGTGGGACACAGACTCTGGTGG + Intergenic
926574607 2:14566400-14566422 GTGTGGGACACACACTGGGTAGG + Intergenic
927068357 2:19496811-19496833 CTGTTGACCACACACCCAGGTGG + Intergenic
933391112 2:81668193-81668215 GTGTGGGCAAAAGACTGAGGAGG + Intergenic
934157748 2:89219030-89219052 GTGTGGGGAACACAATCAGCAGG + Intergenic
934209516 2:89963396-89963418 GTGTGGGGAACACAATCAGCAGG - Intergenic
935296692 2:101656153-101656175 GTGGGGGACTCACACTGAGGGGG - Intergenic
936108368 2:109645019-109645041 CTGGGGGCCACACAGTCGGGAGG - Intergenic
937440321 2:121909714-121909736 CTCTGGGCCACACACTCTGGAGG + Intergenic
937680583 2:124640357-124640379 GTGTGGCCCACGCAGGCAGGTGG + Intronic
938385756 2:130865850-130865872 GTGTGGGCCTTAGACTGAGGGGG + Intronic
938765078 2:134455558-134455580 GTAGGGGCCACACACTCACCTGG - Intergenic
942026197 2:171913054-171913076 GTGGGGGCCACAAAATCAGATGG + Intronic
942323202 2:174753837-174753859 CTGTGGGTCACACACCCAGGAGG + Intronic
944479935 2:200145978-200146000 CTGTGGAACTCACACTCAGGTGG + Intergenic
946429060 2:219614984-219615006 GTGTGAACCACACTCTGAGGTGG - Intronic
946682620 2:222233182-222233204 CTCAGGGCCACACACTCAGAAGG - Intronic
947552218 2:231054503-231054525 GCATGGGCCAGTCACTCAGGAGG + Intergenic
1168815635 20:734717-734739 GTGTGAGCCAGCCACTCAGAAGG - Intergenic
1170152185 20:13237231-13237253 CTGTTGGGCACATACTCAGGTGG - Intronic
1172975206 20:38900913-38900935 GTGTCACCCACACACGCAGGTGG + Intronic
1174106035 20:48162924-48162946 GTGTGAGCCACACAGAAAGGTGG - Intergenic
1174536558 20:51255851-51255873 GTGTGGGCCACCCACTCTGCAGG - Intergenic
1174547093 20:51333799-51333821 GTGCAGGCCACACACTAAGATGG - Intergenic
1175373701 20:58510263-58510285 GTGTGTGGCACATACACAGGAGG + Intronic
1175912810 20:62412803-62412825 GTCCAGGCCACACACTCAGCAGG - Intronic
1176597349 21:8759262-8759284 GTGCGGGCCACGGACCCAGGCGG + Intergenic
1177023673 21:15895397-15895419 TTGCGGGCCACACACTCAAAAGG - Intergenic
1178297058 21:31418900-31418922 GTCAAGGTCACACACTCAGGTGG + Intronic
1178518321 21:33266736-33266758 GTCTGGGCCCTAAACTCAGGGGG + Intronic
1179779481 21:43690212-43690234 GTGCTGCCCACACACACAGGAGG - Intronic
1180447102 22:15424959-15424981 GTGAGGGTCAAACACTCAGAAGG - Intergenic
1180447136 22:15425247-15425269 GTGAGGGTCAAACACTCAGAAGG - Intergenic
1180727483 22:17957208-17957230 GAGTGGGCCACACAATCACCAGG + Intronic
1181343128 22:22198708-22198730 ATGTGGACCACAGACCCAGGAGG - Intergenic
1182567931 22:31213345-31213367 AGGTGGGCCACCCACACAGGTGG - Intronic
1182773833 22:32816307-32816329 CTACGGGCCACACACTCAGTAGG + Intronic
950543558 3:13626165-13626187 TTGTGGGGCAGACACTCAAGGGG - Intronic
950547363 3:13646394-13646416 GTGTGGGCCCCACAGGCAGCAGG - Intergenic
951687856 3:25364443-25364465 ATGTGGGCTTCACACTCAGGAGG + Intronic
951896851 3:27617742-27617764 ATGAGGGCCACACAGCCAGGAGG + Intergenic
952958532 3:38575626-38575648 GTGGGGGCCACACGCTCTGCGGG + Intronic
953862598 3:46557863-46557885 GTGTGGTCCACACACTCTGAAGG - Intronic
960626959 3:119690551-119690573 GTGAGGGTCAAACACTCATGGGG - Intergenic
960784369 3:121356144-121356166 GTGTCAGCGACACACTTAGGAGG + Intronic
961175328 3:124830625-124830647 GTGTGGGCCCCATACCCAGGTGG - Intronic
961457456 3:127031271-127031293 GTGGGGGCCACACACACAGCAGG - Intronic
961542092 3:127606941-127606963 GTGTTGGCCACACCCTGGGGTGG + Intronic
961627170 3:128272126-128272148 GTGTGGGCCACACACTCAGGTGG + Intronic
964191309 3:154004240-154004262 GTGTGGGCCAGCCAAACAGGGGG + Intergenic
965179833 3:165388277-165388299 GTGTGGGCTACAAAGTCTGGCGG + Intergenic
966464585 3:180215707-180215729 GTGTGTGACACACACGCAAGAGG + Intergenic
967560255 3:190909427-190909449 CTGTGCGCCAGACATTCAGGAGG - Intergenic
967944301 3:194790786-194790808 GTGTGTGCCAGCTACTCAGGAGG - Intergenic
967978015 3:195046214-195046236 GGGAGGCCCACACACTCATGCGG + Intergenic
968003557 3:195224283-195224305 GTGTGGGCCCCACCCTCTGAGGG - Intronic
969537290 4:7764295-7764317 CTGTGGGACACACAGACAGGAGG + Intronic
969835562 4:9837364-9837386 GTTTGTGTCACACACTCAGTTGG + Intronic
972309400 4:37866030-37866052 GTTTGGGCCAAACACTAAAGTGG - Intergenic
982922197 4:161289997-161290019 TTGTGGTCCTCACTCTCAGGTGG - Intergenic
985862383 5:2482291-2482313 GTGTGGGCCAAACAGAGAGGGGG + Intergenic
987314212 5:16709296-16709318 GCGGGGGGCACACCCTCAGGTGG + Intronic
991561631 5:67959595-67959617 GCGTGGGACACACACTCCTGCGG + Intergenic
1002278560 5:178118191-178118213 TGCTGGGCCACACACTCTGGAGG - Intronic
1003061957 6:2870508-2870530 GTGTGAGCCACTCTCTGAGGTGG - Intergenic
1003069001 6:2929431-2929453 GCCTGGGCCACACACTCTTGTGG - Intergenic
1005510476 6:26507862-26507884 GTGTGGGAAACACACAAAGGAGG - Intronic
1005850412 6:29816703-29816725 GTGTGGGCCCCACATGAAGGTGG - Intergenic
1006456912 6:34137167-34137189 GTGTGGGCCCCACCCCCAGACGG + Intronic
1008562409 6:52735765-52735787 GTGTGGGTCAGCCACCCAGGTGG - Intergenic
1013836594 6:114342403-114342425 GAGCGGGCCCCACACGCAGGCGG + Exonic
1014213906 6:118735095-118735117 GTGAGTGCCACAGTCTCAGGAGG + Intergenic
1019724451 7:2593422-2593444 GTGTGGGCCACATCCTTAAGAGG + Intronic
1023454174 7:40320665-40320687 GTGTGGGTCACAAACAAAGGAGG - Intronic
1024179564 7:46877346-46877368 GTGGGGGCCTCACAATCATGGGG - Intergenic
1024979810 7:55147685-55147707 GTGATGGCCACACACCCATGTGG - Intronic
1025010630 7:55394780-55394802 GAGTGGGCCACAGCCTCAGTGGG + Intronic
1028747515 7:94344579-94344601 GTGTGGGCCACGCACCCAGCAGG + Intergenic
1034448986 7:151127428-151127450 GTGTGGGGCTCACCCTCAGCTGG - Intronic
1034474030 7:151272574-151272596 GTGTGGGGCGCACGCTCATGAGG + Intronic
1036154280 8:6327361-6327383 GCGAGGACCACAAACTCAGGTGG + Intergenic
1036719803 8:11163614-11163636 ATGTGGTCGAGACACTCAGGAGG + Intronic
1038463174 8:27733929-27733951 GTGTGAGCCATACACACAGCAGG - Exonic
1039444960 8:37623571-37623593 CTGTAGTCCACACACTCGGGAGG + Intergenic
1041169193 8:55123723-55123745 CTGTGGGACACACACACAGCAGG - Intronic
1042953054 8:74220688-74220710 GTGTGGGCTACAGACTCCTGTGG - Intergenic
1043864871 8:85363437-85363459 GTGTGGGCAAGTCACTCAGGTGG - Intronic
1047762159 8:127962303-127962325 GAGTGGGCCACACATTTAGGGGG + Intergenic
1057690304 9:97277917-97277939 GTGTGGGCCTCACAGTTAGGTGG + Intergenic
1057730456 9:97603819-97603841 GTGTGTACCAGATACTCAGGAGG - Intronic
1059474893 9:114538492-114538514 GTGAGGGCTACACCCTCTGGAGG - Intergenic
1190157323 X:48004529-48004551 ATGTGGGACACACACACCGGGGG + Intronic
1190173093 X:48127414-48127436 ATGTGGGACACACACACCGGGGG + Intergenic
1190917610 X:54821905-54821927 GGGAGGGCCACACACACAGATGG - Intergenic
1191107818 X:56783130-56783152 GTGTGGCCCTCAAACTGAGGCGG + Intergenic
1192564599 X:72153371-72153393 GTGTGGGCCCCATACTCGTGTGG - Intergenic