ID: 961628630

View in Genome Browser
Species Human (GRCh38)
Location 3:128280674-128280696
Sequence CCTCTGTACGGTCTTCCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 106}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961628620_961628630 17 Left 961628620 3:128280634-128280656 CCAGTTGGCATTTGCCCTCCACA 0: 1
1: 0
2: 1
3: 14
4: 156
Right 961628630 3:128280674-128280696 CCTCTGTACGGTCTTCCCTCTGG 0: 1
1: 0
2: 0
3: 10
4: 106
961628618_961628630 25 Left 961628618 3:128280626-128280648 CCCTGGCACCAGTTGGCATTTGC 0: 1
1: 0
2: 1
3: 9
4: 147
Right 961628630 3:128280674-128280696 CCTCTGTACGGTCTTCCCTCTGG 0: 1
1: 0
2: 0
3: 10
4: 106
961628624_961628630 -1 Left 961628624 3:128280652-128280674 CCACATGGCAGTGCCCTCCTTGC 0: 1
1: 0
2: 0
3: 17
4: 230
Right 961628630 3:128280674-128280696 CCTCTGTACGGTCTTCCCTCTGG 0: 1
1: 0
2: 0
3: 10
4: 106
961628622_961628630 3 Left 961628622 3:128280648-128280670 CCCTCCACATGGCAGTGCCCTCC 0: 1
1: 0
2: 2
3: 32
4: 315
Right 961628630 3:128280674-128280696 CCTCTGTACGGTCTTCCCTCTGG 0: 1
1: 0
2: 0
3: 10
4: 106
961628619_961628630 24 Left 961628619 3:128280627-128280649 CCTGGCACCAGTTGGCATTTGCC 0: 1
1: 0
2: 0
3: 14
4: 161
Right 961628630 3:128280674-128280696 CCTCTGTACGGTCTTCCCTCTGG 0: 1
1: 0
2: 0
3: 10
4: 106
961628623_961628630 2 Left 961628623 3:128280649-128280671 CCTCCACATGGCAGTGCCCTCCT 0: 1
1: 0
2: 1
3: 40
4: 288
Right 961628630 3:128280674-128280696 CCTCTGTACGGTCTTCCCTCTGG 0: 1
1: 0
2: 0
3: 10
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961628630 Original CRISPR CCTCTGTACGGTCTTCCCTC TGG Intronic