ID: 961628630

View in Genome Browser
Species Human (GRCh38)
Location 3:128280674-128280696
Sequence CCTCTGTACGGTCTTCCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 106}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961628623_961628630 2 Left 961628623 3:128280649-128280671 CCTCCACATGGCAGTGCCCTCCT 0: 1
1: 0
2: 1
3: 40
4: 288
Right 961628630 3:128280674-128280696 CCTCTGTACGGTCTTCCCTCTGG 0: 1
1: 0
2: 0
3: 10
4: 106
961628620_961628630 17 Left 961628620 3:128280634-128280656 CCAGTTGGCATTTGCCCTCCACA 0: 1
1: 0
2: 1
3: 14
4: 156
Right 961628630 3:128280674-128280696 CCTCTGTACGGTCTTCCCTCTGG 0: 1
1: 0
2: 0
3: 10
4: 106
961628624_961628630 -1 Left 961628624 3:128280652-128280674 CCACATGGCAGTGCCCTCCTTGC 0: 1
1: 0
2: 0
3: 17
4: 230
Right 961628630 3:128280674-128280696 CCTCTGTACGGTCTTCCCTCTGG 0: 1
1: 0
2: 0
3: 10
4: 106
961628622_961628630 3 Left 961628622 3:128280648-128280670 CCCTCCACATGGCAGTGCCCTCC 0: 1
1: 0
2: 2
3: 32
4: 315
Right 961628630 3:128280674-128280696 CCTCTGTACGGTCTTCCCTCTGG 0: 1
1: 0
2: 0
3: 10
4: 106
961628618_961628630 25 Left 961628618 3:128280626-128280648 CCCTGGCACCAGTTGGCATTTGC 0: 1
1: 0
2: 1
3: 9
4: 147
Right 961628630 3:128280674-128280696 CCTCTGTACGGTCTTCCCTCTGG 0: 1
1: 0
2: 0
3: 10
4: 106
961628619_961628630 24 Left 961628619 3:128280627-128280649 CCTGGCACCAGTTGGCATTTGCC 0: 1
1: 0
2: 0
3: 14
4: 161
Right 961628630 3:128280674-128280696 CCTCTGTACGGTCTTCCCTCTGG 0: 1
1: 0
2: 0
3: 10
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961628630 Original CRISPR CCTCTGTACGGTCTTCCCTC TGG Intronic
900728260 1:4233230-4233252 CCTTTGTACTGTCTTCACTTGGG - Intergenic
901401413 1:9017443-9017465 CCTCTGTACAGCCTTCCTTCTGG - Intronic
911072692 1:93845214-93845236 CCTCTGTATGGTTTTCCCACAGG + Intronic
914334324 1:146701041-146701063 CCTCAGGCCTGTCTTCCCTCTGG - Intergenic
914827106 1:151144434-151144456 CCTTTGTCCTGTCTTCCATCAGG - Exonic
915940226 1:160114242-160114264 CCTCTGCAGGGAGTTCCCTCTGG + Intergenic
917454706 1:175176463-175176485 CCTCTGCACAGACTGCCCTCTGG - Intronic
918088173 1:181263022-181263044 CCTCTGGATGGTTTTCCCTGAGG + Intergenic
918362606 1:183774185-183774207 CCTCTGCACTTTCTTCCCTGTGG - Intronic
920166242 1:204038092-204038114 CCTGTGTTCTGTCTTCCCTGTGG + Intergenic
920403824 1:205694083-205694105 CCTCTGTGGGGGCTTCCCTCTGG + Intergenic
922129909 1:222767276-222767298 CCTAGGTACTGTCTTTCCTCTGG - Intergenic
1066155297 10:32670119-32670141 ACCCTTTACTGTCTTCCCTCTGG + Intronic
1072478270 10:95784683-95784705 CCTCAGTACTCTTTTCCCTCAGG + Intronic
1073201861 10:101741680-101741702 CCTCAGTACCAGCTTCCCTCGGG - Intergenic
1073484127 10:103805954-103805976 TCTCTGTCAGCTCTTCCCTCTGG - Intronic
1075093382 10:119455842-119455864 CCTCTGTCTGCTCTTCCTTCAGG + Intronic
1083849041 11:65354833-65354855 CCTCGGTCCGCTCTGCCCTCGGG + Exonic
1083934880 11:65864995-65865017 CCTCAGTCCCTTCTTCCCTCAGG + Exonic
1090873904 11:130771838-130771860 TCTCTGTACCTCCTTCCCTCTGG - Intergenic
1105676824 13:22680785-22680807 CAGCTGCACGGTCTGCCCTCAGG + Intergenic
1107028067 13:35823873-35823895 CCCCTGTACAGTCTCCACTCTGG + Intronic
1112784932 13:102941108-102941130 CCTCTGCACTATCTTCCCTCTGG + Intergenic
1116872870 14:50084405-50084427 CTTCCTTATGGTCTTCCCTCTGG + Intronic
1118905235 14:70018770-70018792 CCACAGTACAGTCTCCCCTCAGG - Intronic
1120669541 14:87348195-87348217 CCTGGGTTCTGTCTTCCCTCAGG + Intergenic
1121718027 14:96089961-96089983 CCTCTGTACTGGCTTCTCCCTGG + Exonic
1132591645 16:728697-728719 CCCCTGCCCGGTCTGCCCTCAGG - Intronic
1132794184 16:1710955-1710977 CCTCTGTCCCGTGTTCTCTCTGG - Intronic
1133301265 16:4784140-4784162 CCTCTGGGCGGTCCTCCCTTGGG + Intronic
1138600730 16:58052326-58052348 CTTCTGTACTGGCTTCACTCCGG - Intergenic
1139999293 16:71010191-71010213 CCTCAGGCCTGTCTTCCCTCTGG + Intronic
1143722576 17:8823050-8823072 CCTCAGTAGGGTCTTGGCTCAGG + Exonic
1144112967 17:12056318-12056340 TATTTGTACTGTCTTCCCTCTGG + Intronic
1147995205 17:44356352-44356374 GCCCTGTACCCTCTTCCCTCAGG - Exonic
1148363651 17:47035319-47035341 CCCCAGTGCTGTCTTCCCTCAGG + Intronic
1152126992 17:78453160-78453182 CCTCTTTCCAGTCTTTCCTCAGG + Intronic
1154388672 18:13918017-13918039 CCACTGTCCCGTCTCCCCTCTGG - Intergenic
1158929293 18:62306231-62306253 CCTATGTGCTGTCTTTCCTCAGG - Exonic
1163625098 19:18384761-18384783 CCTCTGTGGGGTCTTCACACTGG + Intronic
1164325833 19:24190676-24190698 TCTTTGTATGTTCTTCCCTCAGG - Intergenic
1166558119 19:43715091-43715113 TCTCTGTCCTGTCTCCCCTCCGG - Intergenic
1166892311 19:46000950-46000972 CCTCTGTGCGGTCTCCTCCCGGG + Intronic
925608245 2:5681216-5681238 CCTCTGTAGGATCTTCCATGAGG + Intergenic
925890862 2:8433531-8433553 CCTCTGTAAGTACTGCCCTCTGG + Intergenic
925890868 2:8433562-8433584 CCTCTGTAAGTACTGCCCTCTGG + Intergenic
925890879 2:8433626-8433648 CCTCTGTAAGTACTGCCCTCTGG + Intergenic
925980556 2:9173706-9173728 CTTCTCTCCTGTCTTCCCTCTGG + Intergenic
927151014 2:20196267-20196289 GCTCTGTGCCGTCTTACCTCTGG + Intergenic
931258933 2:60599880-60599902 CCTCTGAATGGTCCTCGCTCAGG - Intergenic
935747058 2:106197727-106197749 CTTCTATACGGTCTTCCTTAAGG + Intergenic
942043974 2:172088343-172088365 CCACTGTTCCTTCTTCCCTCTGG - Exonic
946668484 2:222076451-222076473 CCTCAGGAAGGTCCTCCCTCAGG + Intergenic
948609837 2:239159742-239159764 GCTCTGTAGGTTCTGCCCTCAGG - Intronic
1171123396 20:22583620-22583642 CCTCTGTCCGGTCTCCCTCCAGG + Intronic
1175413089 20:58784417-58784439 CCTCTGTCCCGTCTGCCTTCTGG - Intergenic
1175859333 20:62142051-62142073 CCTCTGCAAGGTCTTACCACTGG + Intronic
1178053221 21:28770335-28770357 CCCCTTTACTTTCTTCCCTCTGG + Intergenic
1179286132 21:39978804-39978826 CCTCTGTACCCTCTCTCCTCAGG - Intergenic
1181623431 22:24106295-24106317 CCTCTGCAAGGTCATCTCTCAGG - Intronic
1182501714 22:30752953-30752975 CCTCTGTACCCTCCTCCCTTTGG - Intronic
1182621831 22:31622674-31622696 CCTCTGTTCTCTCTTCCTTCAGG + Intronic
1183491636 22:38120012-38120034 CCCCTCTGCGGTCTTCCCTAGGG - Intronic
1184044709 22:41965655-41965677 GCTCTGTGCCCTCTTCCCTCTGG - Intergenic
949537842 3:5009688-5009710 CCTCTGCACTGGCCTCCCTCAGG - Intergenic
951515580 3:23555445-23555467 CCTCCATACTGTTTTCCCTCAGG - Intronic
951577303 3:24126947-24126969 CCTCTATGCGGCCTTTCCTCCGG - Intronic
957376763 3:79368640-79368662 CCACTTCACGTTCTTCCCTCAGG + Intronic
959917897 3:111838325-111838347 CCTCAGTACGCTCTTGCCTCTGG + Intronic
960941500 3:122937923-122937945 CCTCTGCACTGGCTTCCCCCAGG + Intronic
961474084 3:127136169-127136191 CCTCTGTCCGGGCTCCCCTCTGG - Intergenic
961628630 3:128280674-128280696 CCTCTGTACGGTCTTCCCTCTGG + Intronic
975437809 4:74374332-74374354 CCTCTGTACTGGCCTCCTTCTGG + Intronic
981877931 4:149571066-149571088 CCTCTGTACTGTTTTCCATAAGG - Intergenic
985536099 5:466459-466481 GCTCTCCACGGTCTCCCCTCTGG + Intronic
986282908 5:6338020-6338042 CCTCTGGTTGATCTTCCCTCAGG + Intergenic
988134443 5:27151353-27151375 ACTCTGTATAGTCTTCTCTCAGG + Intergenic
991937981 5:71821176-71821198 CCTCTATACTGTCCTCCCTGTGG + Intergenic
992851160 5:80809661-80809683 CTTCTGTGCGGTATTCTCTCTGG + Intronic
993825386 5:92678776-92678798 TCTCTGTACAGTCTGCCCTCTGG - Intergenic
995395160 5:111679691-111679713 CCTCTGCCCGGACTTCACTCAGG + Intronic
998512224 5:142723036-142723058 CCTCTGTACTGGCTCCCCGCAGG - Intergenic
1002703261 5:181142303-181142325 CCTCTGTCCGAGCCTCCCTCTGG - Intergenic
1003324560 6:5082806-5082828 CCTCTGTGCTCTCTGCCCTCAGG + Intergenic
1012934437 6:105351397-105351419 CCTCTGTACTGTCTTCCTTTTGG + Intronic
1018095701 6:160385529-160385551 CCTCTGTACTGTCTGCCCCGTGG + Intronic
1022820293 7:33953215-33953237 CCTCTGTGTGGCCTTGCCTCTGG - Intronic
1027469083 7:78551584-78551606 CCTCAGAACTGTCTTCTCTCAGG - Intronic
1028271453 7:88795744-88795766 CCTGTGTTCTGCCTTCCCTCGGG + Intronic
1032127459 7:129205391-129205413 CCTCTGCACGCTCTTCACCCTGG + Exonic
1034176662 7:149105169-149105191 CCTGAGTTCGGACTTCCCTCTGG + Exonic
1034904208 7:154929673-154929695 CCTCTGCAGGGTCTCCCCTCTGG + Intronic
1035182483 7:157099474-157099496 CCTCTGTGGGGTCTTCACACTGG - Intergenic
1036934310 8:12986292-12986314 CCACTGTACTGTCTTCCCTGGGG + Intronic
1041108781 8:54466842-54466864 CCTCTGCACGTTCTTTCCTGTGG + Intergenic
1042683662 8:71414085-71414107 ACTATGTAGGGCCTTCCCTCTGG - Intronic
1043734204 8:83724013-83724035 CCACTTTAGGGTCTTCTCTCTGG - Intergenic
1046857727 8:119052998-119053020 CCTCTTTGCCGTCTTCGCTCAGG - Intronic
1049702208 8:144020424-144020446 CCTCAGAACGCTCTTCTCTCAGG + Intronic
1049702227 8:144020520-144020542 CCTCAGAACCCTCTTCCCTCAGG + Intronic
1049702327 8:144020890-144020912 CCTCAGGACCCTCTTCCCTCAGG + Intronic
1049702486 8:144021470-144021492 CCTCAGGACTGCCTTCCCTCAGG + Intronic
1049702599 8:144021934-144021956 CCTCAGGACCCTCTTCCCTCAGG + Intronic
1049702630 8:144022062-144022084 CCTCAGGACTGCCTTCCCTCAGG + Intronic
1049702676 8:144022238-144022260 CCTCAGGACTGCCTTCCCTCAGG + Intronic
1049702693 8:144022317-144022339 CCTCAGGACTGCCTTCCCTCAGG + Intronic
1049702751 8:144022555-144022577 CCTCAGGACCCTCTTCCCTCAGG + Intronic
1049702782 8:144022683-144022705 CCTCAGGACTGCCTTCCCTCAGG + Intronic
1049703117 8:144023942-144023964 CCTCAGGACCCTCTTCCCTCAGG + Intronic
1049703265 8:144024445-144024467 CCTCTGGATCCTCTTCCCTCAGG + Intronic
1054161194 9:61672960-61672982 CCTCTGCTCTGTCCTCCCTCTGG - Intergenic
1056931323 9:90880399-90880421 CCTCTGAAGGGGCTTCCTTCTGG - Intronic
1057524562 9:95786911-95786933 CCTCAGTAGTGTCTTCCATCGGG + Intergenic
1060846475 9:126841732-126841754 CCTCTGTAAGGGCTTCCTCCTGG + Intergenic
1186897828 X:14022228-14022250 CCTCTGTTGGGTCTTGCCTTAGG + Intronic
1189700777 X:43715155-43715177 CCTATGTACCCTCTTCCCTGTGG - Intronic
1196417602 X:115488412-115488434 GCCCAGTACAGTCTTCCCTCTGG - Intergenic