ID: 961629136

View in Genome Browser
Species Human (GRCh38)
Location 3:128283515-128283537
Sequence AACCCTAGGCAGCTCCAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 148}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961629130_961629136 2 Left 961629130 3:128283490-128283512 CCTCCAGGCAGCCCACGTCTTGT 0: 1
1: 0
2: 0
3: 9
4: 117
Right 961629136 3:128283515-128283537 AACCCTAGGCAGCTCCAGACTGG 0: 1
1: 0
2: 0
3: 13
4: 148
961629135_961629136 -10 Left 961629135 3:128283502-128283524 CCACGTCTTGTGGAACCCTAGGC 0: 1
1: 0
2: 0
3: 4
4: 46
Right 961629136 3:128283515-128283537 AACCCTAGGCAGCTCCAGACTGG 0: 1
1: 0
2: 0
3: 13
4: 148
961629133_961629136 -9 Left 961629133 3:128283501-128283523 CCCACGTCTTGTGGAACCCTAGG 0: 1
1: 0
2: 0
3: 5
4: 41
Right 961629136 3:128283515-128283537 AACCCTAGGCAGCTCCAGACTGG 0: 1
1: 0
2: 0
3: 13
4: 148
961629132_961629136 -1 Left 961629132 3:128283493-128283515 CCAGGCAGCCCACGTCTTGTGGA 0: 1
1: 0
2: 0
3: 10
4: 106
Right 961629136 3:128283515-128283537 AACCCTAGGCAGCTCCAGACTGG 0: 1
1: 0
2: 0
3: 13
4: 148
961629129_961629136 3 Left 961629129 3:128283489-128283511 CCCTCCAGGCAGCCCACGTCTTG 0: 1
1: 0
2: 1
3: 14
4: 127
Right 961629136 3:128283515-128283537 AACCCTAGGCAGCTCCAGACTGG 0: 1
1: 0
2: 0
3: 13
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961629136 Original CRISPR AACCCTAGGCAGCTCCAGAC TGG Intronic
901452166 1:9342494-9342516 ACCCTGAGGCAGCTCCAAACTGG - Intronic
901889494 1:12250402-12250424 AACCCTTGGAAGTTCCTGACAGG - Intronic
902896699 1:19484906-19484928 AAACCTAGGCCGCTGCAGAAGGG + Intronic
904791546 1:33026022-33026044 GACCCTAGACAGCTCAACACTGG + Intronic
905107200 1:35571317-35571339 AACCCAAGGAAGCCACAGACAGG + Intergenic
905236033 1:36548951-36548973 AACCCTTGGAATCTCCAGAATGG - Intergenic
906069260 1:43005775-43005797 AACCCTAGGCACTCCCAGGCTGG - Intergenic
908059446 1:60331460-60331482 AACCCTATGGATCTCCAAACAGG + Intergenic
909697087 1:78479851-78479873 AACCCTAGGCAGTACCATTCCGG + Intronic
912246519 1:107965932-107965954 AGCCCTGGGCAGCTCCTGCCGGG + Intergenic
912490041 1:110057760-110057782 GACCCTCTGCAGCTCCAGATGGG - Intronic
912549146 1:110473397-110473419 ATCCCTAGGCAGATCTAGCCGGG - Intergenic
913660304 1:121001219-121001241 AACCACAAGCAGCTTCAGACAGG + Intergenic
914011669 1:143784376-143784398 AACCACAAGCAGCTTCAGACAGG + Intergenic
914166163 1:145176758-145176780 AACCACAAGCAGCTTCAGACAGG - Intergenic
914246427 1:145889223-145889245 ATCCATCGTCAGCTCCAGACTGG - Intergenic
914650295 1:149693035-149693057 AACCACAAGCAGCTTCAGACAGG + Intergenic
915649767 1:157301228-157301250 GACCCTAGGCAGAACCGGACAGG - Intergenic
919260782 1:195190931-195190953 ATCCCTAATCATCTCCAGACAGG + Intergenic
922724094 1:227914565-227914587 AACCCTGCGCAGGGCCAGACTGG - Intergenic
922984788 1:229857872-229857894 AACCCTAAGAACCTCCAGAGTGG - Intergenic
924297750 1:242605275-242605297 GCCCCTAGGTAGCTCCAGGCTGG - Intergenic
924739717 1:246787978-246788000 GACCCAAGGTGGCTCCAGACTGG + Intergenic
1063077217 10:2729390-2729412 AAACCTAGGCAGCTGTAGCCAGG + Intergenic
1063426469 10:5953861-5953883 GCACCCAGGCAGCTCCAGACAGG - Intronic
1065670037 10:28106406-28106428 ATCCCTTGGCATCTCCAAACTGG + Intronic
1066669148 10:37818405-37818427 AACCATGGGCAGCTCCAGCCAGG - Intronic
1072474114 10:95742334-95742356 AGGCCTAGGCTTCTCCAGACGGG - Intronic
1072489293 10:95888017-95888039 AACCCTTGGAATCTCCAGAGTGG + Intronic
1072989661 10:100179843-100179865 ACCCCTGGCCAGCTCCAGGCAGG - Intronic
1073286982 10:102395398-102395420 ATCCCAAGGTTGCTCCAGACCGG + Intronic
1074109960 10:110415851-110415873 ATCCCCAGGCAGCTCCTGAAAGG + Intergenic
1076667632 10:132102207-132102229 AACCCTAGGCAGCTTGGGAAAGG - Intergenic
1077149997 11:1068441-1068463 AACCCTGGGTAGCTCCCGAGTGG + Intergenic
1077563707 11:3282694-3282716 CACCCTGAACAGCTCCAGACAGG - Intergenic
1077569597 11:3328511-3328533 CACCCTGAACAGCTCCAGACAGG - Intergenic
1077578949 11:3404724-3404746 ACCCCTCGGCCGCTCCAGTCAGG - Intergenic
1078565409 11:12410165-12410187 AGCCCTAGGCATCTCCGGGCTGG + Intronic
1078931616 11:15916506-15916528 AACCATAGCAAGCTCCAAACTGG - Intergenic
1084235972 11:67788243-67788265 ACCCCTCGGCAGCTCCAGTCAGG - Intergenic
1084836427 11:71804748-71804770 ACCCCTTGGCAGCTCCAGTCAGG + Intergenic
1086555758 11:88109426-88109448 AAACCTAGGCAACTCCATTCAGG + Intergenic
1088554957 11:111052411-111052433 AACCCTTGGCAGCTGCGGTCAGG - Intergenic
1092406880 12:8227606-8227628 ACCCCTCGGCAGCTCCAGTCAGG - Exonic
1093703123 12:22245692-22245714 AGCCCTATGCAGCTTCAGAGTGG + Intronic
1098984430 12:76996405-76996427 AACCCCAGGCAGTTTCACACTGG + Intergenic
1100981453 12:100165883-100165905 AGCCAGAGGCAGCTCCAGCCTGG - Intergenic
1103355602 12:120317499-120317521 GACCCCAGGAAGCTGCAGACAGG + Intergenic
1103835424 12:123816238-123816260 AGCCCTAGGCAGCTTCAGCATGG + Intronic
1106510014 13:30404904-30404926 AAGCCTGGACAGCTACAGACAGG - Intergenic
1106517338 13:30466194-30466216 AACCCAAGCCAGCCCCACACCGG + Intronic
1108337636 13:49462302-49462324 ATCCCTAGACAGCTTCAGAATGG - Intronic
1109808206 13:67471356-67471378 AATCCTAAGCAGCTACAGCCTGG - Intergenic
1116039104 14:39664039-39664061 AACCCTTGGCTCCTCCAGCCGGG - Intergenic
1117470530 14:56039855-56039877 ACCCCTAGGCAGCTTCAGCATGG - Intergenic
1118772614 14:68952260-68952282 AGCCCTGGGCAGCTTCTGACAGG + Intronic
1121160882 14:91738848-91738870 AAGGTTAGGCAGCTCCAGAGGGG - Intronic
1122937460 14:104966718-104966740 AGCTCCAGGCAGCTCCAGAGGGG - Intronic
1124564047 15:30798860-30798882 AGCCAGAGGCAGCTCCAGCCTGG + Intergenic
1131397312 15:92097005-92097027 CACCCAAGGCAGCACAAGACAGG + Intronic
1133347549 16:5080816-5080838 ACCCCTCAGCAGCTCCAGTCAGG - Intronic
1134241713 16:12511727-12511749 ATCCCTGGGCAGCTCAAGAGAGG - Intronic
1135405603 16:22195369-22195391 AACCCCAGGAAGACCCAGACAGG + Intergenic
1135613452 16:23888682-23888704 AACCCAGGGAAGGTCCAGACAGG - Intronic
1139525945 16:67516770-67516792 AAAACTGGGCAGCTCCAGAGAGG + Intergenic
1143610291 17:8014090-8014112 AACCTGAGACAGCTGCAGACAGG + Intronic
1143624271 17:8100048-8100070 AAGCCTGGTCAACTCCAGACAGG - Intronic
1143734593 17:8901531-8901553 GACCCTAGAAAGCTCAAGACTGG - Intronic
1143871117 17:9957868-9957890 AACCCAAGCCAGCTCCAGAAGGG + Intronic
1146580858 17:34037421-34037443 AACCTTGGGCAGCTCCGGCCAGG - Intronic
1147538215 17:41334698-41334720 AACCCTAGGAAGCAGCAGATGGG - Intergenic
1148547533 17:48529400-48529422 ACCCCCAGGCAGCTCTAAACTGG + Exonic
1150122125 17:62612743-62612765 AACCTTGGGCAGCTCCGGCCAGG + Exonic
1150122394 17:62615150-62615172 AAGCCTAGTTAGCTCCAAACAGG - Intronic
1150138437 17:62708907-62708929 AACCCCAGGAAGCCCCAGCCAGG + Intronic
1152538706 17:80964158-80964180 ATCCTTAGGCAGCTCCTGCCGGG - Intronic
1156499337 18:37547262-37547284 CACCCAAGGCTGCTCCAGCCTGG - Intronic
1157711215 18:49850934-49850956 AGCCCAGGGCTGCTCCAGACTGG + Intronic
1158794062 18:60820186-60820208 AATCCTAGTCAGCCCCAGAGGGG - Intergenic
1164518986 19:28963100-28963122 GACCCTAGGTAGCTTCAGAATGG + Intergenic
1166138506 19:40792050-40792072 AGCCCTTGGCAGCTCCAGGGTGG + Intronic
1166907039 19:46118610-46118632 AACCCTGGGCAGCCTCAGATGGG + Intergenic
926124608 2:10264526-10264548 AACCCAAGAGACCTCCAGACAGG - Intergenic
927847648 2:26479714-26479736 AACCCAAGGCAGCACCGGATTGG - Intronic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
932581349 2:72994575-72994597 TCCCCCAGGCAGCTCCTGACTGG + Intronic
934027204 2:88010870-88010892 ACCCCTAGGTAGCTTCAGAAGGG - Intergenic
940272867 2:151910388-151910410 AAACCTAGGCAGTTCCATTCAGG - Intronic
941870979 2:170385332-170385354 CCCCCTAGACAGCTTCAGACTGG - Intronic
1169008550 20:2230464-2230486 AGCCCTACTCAGCTCCAGATGGG - Intergenic
1170294993 20:14813917-14813939 ACCCCTAGACAGCTTCAGAATGG - Intronic
1172900938 20:38334467-38334489 AACCCTGGGCAGCACAAGAATGG - Exonic
1173360524 20:42340380-42340402 AACCCTAAGCAGCTGTAGCCAGG + Intronic
1176088084 20:63307081-63307103 AACCCCGGGGAGCGCCAGACCGG + Intronic
1176119533 20:63447970-63447992 CACCCCAGGAAGCTGCAGACAGG + Intronic
1177452991 21:21296283-21296305 AACCCAATGCAGCTGAAGACAGG + Intronic
1179190929 21:39121222-39121244 CACCCTAGGCAGCTACAGCAGGG + Intergenic
1179954942 21:44733354-44733376 GGCCCTAGGCAGCTTCAGAATGG - Intergenic
1179994833 21:44969199-44969221 AGGCCCAGGCAGCTCCAGGCTGG + Intronic
1181159689 22:20951651-20951673 AAACCTAGGAACCTCCAGACAGG - Exonic
1185233634 22:49698877-49698899 AACCCCAGGCAGCTGTGGACAGG + Intergenic
1185233642 22:49698904-49698926 AACCCCAGGCAGCTGTGGACAGG + Intergenic
1185233650 22:49698931-49698953 AACCCCAGGCAGCTGTGGACAGG + Intergenic
1185233658 22:49698958-49698980 AACCCCAGGCAGCTGTGGACAGG + Intergenic
1185233666 22:49698985-49699007 AACCCCAGGCAGCTGTGGACAGG + Intergenic
1185233674 22:49699012-49699034 AACCCCAGGCAGCTGTGGACAGG + Intergenic
1185233920 22:49700118-49700140 AACCCTAGGCAGCTGTGGACAGG + Intergenic
1185233927 22:49700145-49700167 AACCCCAGGCAGCTGTGGACAGG + Intergenic
949829183 3:8196420-8196442 AACCCCAGGCAGGTCCAGAGAGG + Intergenic
950173174 3:10853201-10853223 AAGTCTGGGCAGCTCCAGGCAGG + Intronic
950596336 3:13986226-13986248 AACCCTAGGCAGTACCATTCAGG - Intronic
953392526 3:42541825-42541847 AACTCTGGAGAGCTCCAGACTGG + Intergenic
956719096 3:72102494-72102516 AACCCCAGGCACTTCCAGCCTGG + Intergenic
956953524 3:74310556-74310578 AACCCTATGCAGCTGTGGACAGG - Intronic
957051938 3:75418041-75418063 ACCCCTCAGCAGCTCCAGTCAGG - Intergenic
961629136 3:128283515-128283537 AACCCTAGGCAGCTCCAGACTGG + Intronic
961885546 3:130094273-130094295 ACCCCTCGGCAGCTGCAGTCAGG - Intronic
967503636 3:190228173-190228195 AACTCCAAGCAGCTCCAAACAGG + Intergenic
968994738 4:3938416-3938438 ACCCCTCGGCAGCTCCAGTCAGG - Intergenic
969415434 4:7054757-7054779 AAACCTAGCCGGCTCCAAACGGG + Exonic
969639630 4:8389068-8389090 GACCCTTGGCAGTTCCAGCCGGG - Intronic
969759261 4:9170378-9170400 ACCCCTCGGCAGCTCTAGTCAGG + Intergenic
969819225 4:9707857-9707879 ACTCCTCGGCAGCTCCAGTCAGG + Intergenic
977634376 4:99280173-99280195 AACCCTATGCTGCTACTGACTGG - Exonic
977637054 4:99311550-99311572 AACCCTATGCTGCTACTGACTGG - Exonic
977639499 4:99340604-99340626 AACCCTATGCTGCTACTGACTGG - Exonic
977738600 4:100448500-100448522 AAACATAGGCAACTCAAGACAGG - Intronic
981037583 4:140188305-140188327 TACCCTTGGCAGAGCCAGACAGG - Intergenic
982214073 4:153065086-153065108 AACCCAAGGGAGCTCCTGCCTGG - Intergenic
985256583 4:188076294-188076316 ATCCCCAGGGAGCTGCAGACTGG + Intergenic
985731458 5:1551570-1551592 TACCCCAGCCAGCTCCAGGCCGG - Intergenic
993362662 5:86997518-86997540 AATCCTAGGCAGCTGCAGCATGG - Intergenic
997186317 5:131885072-131885094 GACCCTGGGCAGGTCCAGAGTGG - Intronic
998763188 5:145455065-145455087 AAACCTAGGCAGCACCATTCAGG - Intergenic
1010175280 6:73020682-73020704 ACCCCTAGGCAGCTTCAGGATGG - Intronic
1011393636 6:86882018-86882040 AAACCTAGGCAGTACCAGTCAGG - Intergenic
1013591508 6:111622762-111622784 ACCACTAGGCTGCTCCAGTCTGG - Intergenic
1017408025 6:154140668-154140690 AATCATATGCAGCTCCAGATAGG + Intronic
1018866550 6:167751033-167751055 AGCCCTGGCCAGCACCAGACTGG - Intergenic
1019480681 7:1265330-1265352 AGCCCTGGGCACCTCCATACTGG - Intergenic
1020319007 7:6926739-6926761 ACCCCTCGGCAGCTCCAGTCAGG - Intergenic
1023959491 7:44914440-44914462 CACACTAGGCTGCCCCAGACTGG + Intergenic
1026822157 7:73557199-73557221 GACGCCAGGCAGCTCCAGTCCGG + Intronic
1036381404 8:8238408-8238430 ACCCCTCGGCAGCTCCAGTCAGG + Intergenic
1036847254 8:12178584-12178606 ACCCCTCGGCAGCTCCAGTCAGG - Intergenic
1036868620 8:12420905-12420927 ACCCCTCTGCAGCTCCAGTCAGG - Intergenic
1038634671 8:29276080-29276102 AACCCAAGACAGCTGCAGCCAGG + Intergenic
1039497624 8:37992942-37992964 AGCCTTAGGCAGCTCCACCCAGG + Intergenic
1041383621 8:57277858-57277880 AAAACAAGGCAGCTCCAGAAAGG - Intergenic
1041998163 8:64088704-64088726 AAACCTAGGCAGTTCCATTCAGG + Intergenic
1042731037 8:71935215-71935237 AAACCTAGGCAGCACCATTCAGG - Intronic
1042788562 8:72577752-72577774 AACCCGGTGCAGCTCCAGATGGG + Intronic
1046569612 8:115946804-115946826 AGCCCCAGGCAGATCTAGACAGG - Intergenic
1051201669 9:14633511-14633533 AGCCCTAAGCAGCTCCAGGAAGG + Intronic
1051314618 9:15815244-15815266 AACCCAAAGCAGCTACAGAAAGG - Intronic
1057851645 9:98571041-98571063 AACCTCAGGCAGCTGCAGGCCGG + Intronic
1062002997 9:134226191-134226213 AAACCTTGGCAGCTCCAGGGGGG + Intergenic
1190493191 X:51003084-51003106 AACCCTAGGGAGCTCCTGATAGG + Intergenic
1192932249 X:75819233-75819255 AATCCTAGGCAACACCAGTCAGG + Intergenic
1197800292 X:130340591-130340613 AACGCTAGGCATCTCTAGGCTGG - Intronic
1198392378 X:136189190-136189212 GACCCTCTGCAGCTCAAGACTGG + Intronic
1199700863 X:150374706-150374728 AGCCCTCGGCAGTTCCAGAATGG + Intronic