ID: 961630769

View in Genome Browser
Species Human (GRCh38)
Location 3:128296821-128296843
Sequence CTCTGCGTGTGTTGGCCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961630767_961630769 9 Left 961630767 3:128296789-128296811 CCAGTTGGCATAGGTGTGGCTTA 0: 1
1: 0
2: 0
3: 5
4: 72
Right 961630769 3:128296821-128296843 CTCTGCGTGTGTTGGCCAGAAGG 0: 1
1: 0
2: 0
3: 12
4: 122
961630766_961630769 10 Left 961630766 3:128296788-128296810 CCCAGTTGGCATAGGTGTGGCTT 0: 1
1: 0
2: 0
3: 3
4: 70
Right 961630769 3:128296821-128296843 CTCTGCGTGTGTTGGCCAGAAGG 0: 1
1: 0
2: 0
3: 12
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961630769 Original CRISPR CTCTGCGTGTGTTGGCCAGA AGG Intronic
900734762 1:4291612-4291634 CTGTGCGTGTGTATGCCAGTGGG + Intergenic
901103103 1:6734526-6734548 CTCAGTGTGTGTTGGCAAGTTGG - Intergenic
901886842 1:12229724-12229746 CTGTGGGTGAGTGGGCCAGACGG + Intergenic
901913789 1:12481827-12481849 CTCTCCCTATATTGGCCAGAAGG + Intronic
904775381 1:32902794-32902816 CGCTGTGTGTGTTGGGCAGTTGG + Intergenic
905925170 1:41744471-41744493 ATCAGGGTGTGCTGGCCAGATGG + Intronic
907250992 1:53139418-53139440 CCCTGTGTGTGTTGGGGAGAGGG - Intronic
921108410 1:212008210-212008232 CTCTACTTGGGTTTGCCAGAGGG + Intronic
922485860 1:225972598-225972620 CTCTGCCTCTGTTGGCCCCAGGG - Intergenic
924799501 1:247317420-247317442 CTCTGCTGGTGTTGGTAAGAAGG - Intronic
1070810789 10:79296737-79296759 CCCTGCGTGTGTTTGCCCCAAGG + Intronic
1071529508 10:86377961-86377983 CCCTCCGTGTGTGGTCCAGACGG - Intergenic
1073449367 10:103600550-103600572 TTCTGCGTGTGTTCCCCAGCTGG - Exonic
1074380166 10:112973033-112973055 TTCTATGTGTGTTGCCCAGAAGG - Intronic
1076689341 10:132213336-132213358 CTGTGGGTGTGTTGGGAAGATGG - Intronic
1078328874 11:10402356-10402378 CTCTGAGCCTGTTGGCCAGCTGG - Intronic
1083325214 11:61869642-61869664 TTCTGGGTGTGTTGGCAAGGGGG - Intergenic
1083812446 11:65113149-65113171 CTCTGCGTGTGTTTGCGGGGTGG + Intronic
1085391010 11:76182215-76182237 CTGTGTGTGTGTTGGCGCGAGGG - Intergenic
1088769478 11:113019174-113019196 CTCTTGGTGGGCTGGCCAGAGGG - Intronic
1088898016 11:114092450-114092472 CTCTTCTTGTGTTCTCCAGATGG + Intronic
1089269375 11:117291044-117291066 CTCCGTCTGTGTTGGCAAGAAGG + Exonic
1096007317 12:48183784-48183806 CTCTGCTTGTGGCGCCCAGAGGG + Exonic
1096768500 12:53914881-53914903 CTATGCGTGTGTGGGGCAGGGGG - Intergenic
1103731681 12:123032057-123032079 CACTGCATGTGTCGGCTAGATGG + Intronic
1104380517 12:128303772-128303794 TTCTGATTGTGTTGGCCAGTAGG + Intronic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1106303139 13:28487435-28487457 CTCTGCCTGTGTAGTCCACATGG + Intronic
1107616251 13:42171357-42171379 CTTTATGTGTGTAGGCCAGATGG + Intronic
1107633091 13:42362532-42362554 GTTTGAGTGTGTTGGCAAGAGGG + Intergenic
1109393477 13:61724125-61724147 CTTTGTCTGTGTTGGTCAGATGG + Intergenic
1110050857 13:70897261-70897283 CTCTGAATGTTTTGGGCAGAAGG - Intergenic
1113990243 14:16022962-16022984 CTCTGGGTGTGTGGGCCAAGAGG + Intergenic
1115913326 14:38281093-38281115 CTCTGCAAGTGTTGGGTAGAAGG + Intergenic
1118594009 14:67422124-67422146 CCCTGGGTGTATAGGCCAGATGG - Intergenic
1119893777 14:78202612-78202634 TTCTATGTGTGTTGGCCAGGTGG + Intergenic
1120884468 14:89441135-89441157 CTCTGGGGGAGTTGGCCTGAAGG - Intronic
1122431847 14:101655834-101655856 CTCTGCATGTGTTCTCTAGATGG + Intergenic
1128677955 15:69625529-69625551 CTCTGTGTGTGCTGGCCACTCGG - Intergenic
1129768964 15:78191432-78191454 CTCTGCAGTTGTTGGCTAGAAGG - Intronic
1130977236 15:88786462-88786484 CTGTGTGTGTGTTGGGGAGAGGG - Intergenic
1133724953 16:8528786-8528808 CTCAGTGAGTGATGGCCAGAAGG - Intergenic
1134345660 16:13388988-13389010 CTATGCGTGTATAGGACAGAGGG - Intergenic
1137911014 16:52378538-52378560 GTGTGTGTGTGTTGGCCAGAGGG + Intergenic
1139842764 16:69894837-69894859 CTCTGTGTGTGTGGGACCGAGGG - Intronic
1142629688 17:1216752-1216774 CTCTGGGTCTGGTGGCCAAAGGG + Intronic
1143256576 17:5562110-5562132 CTCTGCCTGTGGTAGCCAGATGG + Intronic
1146324492 17:31874014-31874036 CTCTGAGTGACTTGGTCAGAAGG - Intronic
1150648204 17:66992963-66992985 CTCTGTGTGGGTTTCCCAGAGGG + Intronic
1151719137 17:75845666-75845688 CTCTGCGTGTGGTGACCCGGGGG - Intergenic
1152555905 17:81053126-81053148 CTCTGGGTCTGTTTGCCCGACGG - Intronic
1153739712 18:8111123-8111145 CTCTGTGTGTGTTGGGCACCTGG + Intronic
1158904353 18:61997674-61997696 CTTTGCGTGTGTTTGGCAGGAGG - Intergenic
1161822209 19:6536705-6536727 CTCTGCCTCTGTTGGTCACATGG + Intergenic
1162254762 19:9481052-9481074 CTCTGCCTGTATTGCCCAGGTGG - Intronic
1165130743 19:33630279-33630301 TTCTGGTTGTGTTGGCCAGGAGG + Intronic
1165830873 19:38729594-38729616 CTCTTTGTGGGTTGGCCAGGAGG + Exonic
1167940389 19:52941973-52941995 CTGTGATTGTGTTGGCCAAAGGG - Intronic
1167987975 19:53334339-53334361 CTGTGATTGTGTTGGCCAAAGGG + Intronic
925101160 2:1247217-1247239 TTCTGGGTGTGTTGACCTGATGG + Intronic
928092406 2:28383041-28383063 CTCTGCGTGTGTTGTCCTTGGGG + Intergenic
929761378 2:44810399-44810421 CTCTGTGTGTGTTGGTGGGAAGG + Intergenic
936068614 2:109350436-109350458 CTCTGGGTGTGATCCCCAGAGGG + Intronic
939638758 2:144614049-144614071 CTCTGAGTGTTTGGGGCAGAAGG - Intergenic
944698600 2:202225517-202225539 GTCTCCGTCTGTTGCCCAGATGG - Intronic
947912710 2:233811861-233811883 CCCTGCTTGTGTTGGACAGGCGG + Exonic
1169947539 20:11005392-11005414 GTCTGTGTGTGTTGGCAAGCAGG - Intergenic
1170278046 20:14614989-14615011 CTCTGCGTGTGCTGGGGAAAGGG + Intronic
1171426028 20:25049275-25049297 CTCTGTGTGTGTTGGGGAGCTGG + Intronic
1171771631 20:29326709-29326731 CTCTGGGTGTGTGGGCCAAGAGG - Intergenic
1171813585 20:29763942-29763964 CTCTGGGTGTGTGGGCCAAGAGG - Intergenic
1172635370 20:36406472-36406494 CTCTGCGTGTCTTGGTCACAGGG + Intronic
1172635376 20:36406522-36406544 CTCTGCGTGTCTTGGTCACAGGG + Intronic
1178830348 21:36051138-36051160 CGCTGGGTGAGCTGGCCAGAGGG - Intronic
1179021285 21:37643365-37643387 CTCTGAGTGTCTTGGTCTGATGG - Intronic
1180317029 22:11284564-11284586 CTCTGGGTGTGTGGGCCAAGAGG - Intergenic
1181802050 22:25354154-25354176 GTGCGCGTGTGTTGGCCACAGGG + Intronic
1182720726 22:32396931-32396953 AACTGCGTCTGTTGCCCAGAAGG + Intronic
1184351096 22:43944809-43944831 CTGTGGGTGTGTGGGCCGGACGG + Intronic
1185379576 22:50502257-50502279 CTCTGCCTGGGTGGGCCAGATGG + Intergenic
951829335 3:26906996-26907018 CTCTGCGTGTGGTTGTGAGAGGG - Intergenic
952943379 3:38459710-38459732 CTCAGGGTGTGGTGGCCAGATGG + Intronic
952956642 3:38561941-38561963 CTCTGTCTGTGATGGCCAGTGGG - Intronic
954459012 3:50615971-50615993 GTGTGCGTGTGTTAACCAGAGGG + Intronic
955092859 3:55769447-55769469 CTCTGTCTGGGTTGGGCAGAAGG + Intronic
955914226 3:63890791-63890813 CTCAGAGTGTGTTGGCAAGGAGG + Intronic
958468072 3:94482987-94483009 CTCTGCTTCCGTTGGCCTGAGGG - Intergenic
961630769 3:128296821-128296843 CTCTGCGTGTGTTGGCCAGAAGG + Intronic
966318432 3:178674769-178674791 CTCAGATTGTGGTGGCCAGATGG - Intronic
983969377 4:173852254-173852276 CTCTCCGTGTTTTGGACATAGGG + Intergenic
990731594 5:58814685-58814707 CTCTCCCTTTGTTGTCCAGAAGG + Intronic
990735307 5:58854026-58854048 GTGTGTGTGTGTTGGCCAAAAGG - Exonic
996301245 5:121988736-121988758 CTCTGAGTCTGTGGGCCACAAGG - Intronic
1002315475 5:178340656-178340678 CTCTGCATGTGTTTGGCTGATGG + Intronic
1003081186 6:3023056-3023078 CACTGAGTGTGTTGGCCTCAGGG + Intergenic
1003499047 6:6689109-6689131 CTGTGCATGTGTTGGCCAGTAGG + Intergenic
1003680280 6:8245885-8245907 CTCTGCATGTGCTGGCCTCAGGG - Intergenic
1004053352 6:12110158-12110180 CTCTGCCTGTGCTGTACAGATGG - Intronic
1004135292 6:12960463-12960485 GTCTGCGTGTTTTGGACAGAAGG + Intronic
1004191624 6:13469031-13469053 CTCTGCAAGTGCTGGCCACAGGG + Intronic
1004271795 6:14202210-14202232 CTCTGCGTGTGTGGGGTGGAGGG - Intergenic
1006949293 6:37808352-37808374 CTCTGCATGTCTTTGCCTGAGGG + Intergenic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1009032846 6:58081248-58081270 CTGTGTGTGTGTTAGCCAGTGGG - Intergenic
1009208462 6:60833022-60833044 CTGTGTGTGTGTTAGCCAGTGGG - Intergenic
1012477706 6:99633213-99633235 CTCTGTGTGAGATGGCAAGATGG + Intergenic
1014168934 6:118256464-118256486 CTTTGCCTGTGATAGCCAGAGGG + Intronic
1016723868 6:147336461-147336483 ATTTGCATGTGTTGGCCAAAGGG - Intronic
1019566938 7:1688065-1688087 GTCTCCCTGTGTTGCCCAGACGG + Intergenic
1022259446 7:28690294-28690316 CTCTGTGTCTGGTGGGCAGAGGG - Intronic
1024578921 7:50785988-50786010 CTGTGCGTGTGTGGGGCAGAGGG + Intronic
1028838152 7:95396879-95396901 CTCGGAGTGTGCTGCCCAGACGG + Intergenic
1034987033 7:155522620-155522642 CTCTGAGTGTCAGGGCCAGAGGG + Intronic
1035314985 7:157991965-157991987 CTGTGCCTGTGCTGGCCTGATGG - Intronic
1036787378 8:11697237-11697259 CTGTGCGTGTGTTTGACAGAAGG - Intronic
1037600278 8:20387981-20388003 CTCTGCATGTGGTGGCTTGATGG + Intergenic
1037619636 8:20552042-20552064 CTCTGGGTGGGTGGGCCAGCAGG - Intergenic
1038675708 8:29621028-29621050 CTCTGCCTGGGTTGGAAAGAGGG + Intergenic
1045883498 8:107068684-107068706 GTCTGCCTGTGCTGGCAAGATGG - Intergenic
1056824059 9:89864600-89864622 CTCTGTGTGTGTGGTCCTGAGGG - Intergenic
1057304899 9:93906362-93906384 CTCTGCGTGTTTGGGCAGGATGG + Intergenic
1057864922 9:98672532-98672554 CGGTGCCTGTCTTGGCCAGATGG + Intronic
1060456517 9:123803621-123803643 CTCTGTCTGAGTTGGCAAGAGGG - Intronic
1062103128 9:134738662-134738684 CTCTGCCTTGGTTGGCCAGTTGG + Intronic
1062321416 9:135992339-135992361 CTCTGGGTAGGGTGGCCAGAGGG - Intergenic
1189297701 X:39930363-39930385 CTCTGTGTGTGCTGGACAGATGG + Intergenic
1191896012 X:65994172-65994194 CTCGGAGTGTGTTGCCTAGAAGG + Intergenic
1197739124 X:129875779-129875801 CTCTGCCTCTGCAGGCCAGAAGG - Intergenic
1198133672 X:133725327-133725349 GTCTCCCTGTGTTGCCCAGACGG - Intronic
1200698065 Y:6378596-6378618 CTCTCCCTGTGTTGACCATAGGG + Intergenic
1200931410 Y:8700278-8700300 CTCTCCCTGTGTTAGCCATAGGG + Intergenic
1200931994 Y:8705302-8705324 CTCTTCCTGTGTTGGCCTTAGGG + Intergenic
1201036047 Y:9786103-9786125 CTCTCCCTGTGTTGACCATAGGG - Intergenic
1202182925 Y:22154896-22154918 GTCTCCCTGTGTTGGCCACACGG + Intergenic
1202208434 Y:22431505-22431527 GTCTCCCTGTGTTGGCCACACGG - Intergenic