ID: 961630861

View in Genome Browser
Species Human (GRCh38)
Location 3:128297353-128297375
Sequence CTCAATCCACAAATAAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 347}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961630861_961630866 11 Left 961630861 3:128297353-128297375 CCTTTCTTTATTTGTGGATTGAG 0: 1
1: 0
2: 0
3: 35
4: 347
Right 961630866 3:128297387-128297409 CACTGCTGTAGTTTCCTTTGTGG 0: 1
1: 0
2: 1
3: 14
4: 215
961630861_961630867 15 Left 961630861 3:128297353-128297375 CCTTTCTTTATTTGTGGATTGAG 0: 1
1: 0
2: 0
3: 35
4: 347
Right 961630867 3:128297391-128297413 GCTGTAGTTTCCTTTGTGGAAGG 0: 1
1: 1
2: 3
3: 25
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961630861 Original CRISPR CTCAATCCACAAATAAAGAA AGG (reversed) Intronic
901013619 1:6215032-6215054 CTCCATCCAAAAAAAAAAAAGGG - Intronic
901465813 1:9420334-9420356 CTCAGGCCCCAAAGAAAGAAAGG + Intergenic
902754581 1:18540610-18540632 TTCAATGAACAAATAAAGAGAGG - Intergenic
902781836 1:18709967-18709989 CCCCATTCACAAATAAATAAAGG - Intronic
902973654 1:20073117-20073139 CTCCCTCCTCAAAAAAAGAAGGG + Intronic
903429415 1:23281547-23281569 CACAATCCACAAAGAAAGAGGGG + Intergenic
903735883 1:25529794-25529816 CTCCATCTACAAATGAAGAAAGG - Intergenic
904350967 1:29906485-29906507 CTCTATTCAGAAATAAATAATGG - Intergenic
905927910 1:41765106-41765128 CTAAATCCAAAAATAAAGGGAGG - Intronic
906343546 1:45001557-45001579 CTCTATCCAAAAAAAAAAAAAGG - Intergenic
907119123 1:51993127-51993149 CTCTTTCTACAAATAAGGAAGGG - Intergenic
908439348 1:64137962-64137984 CTCATTTCACAGATGAAGAAGGG - Intronic
908485043 1:64583434-64583456 CTCATTCCAGAAATAAAGACAGG - Intronic
909481091 1:76129537-76129559 CTAAATCAACAGTTAAAGAAGGG - Intronic
910010369 1:82453702-82453724 CTGAATCAACAAGTGAAGAAAGG + Intergenic
910141742 1:84033739-84033761 CTGAATCAACAAGCAAAGAAGGG + Intergenic
910540959 1:88356377-88356399 CTCTATGCACAAAAAATGAAAGG + Intergenic
910611372 1:89146453-89146475 CTCAATGAAAAAACAAAGAAAGG + Intronic
911305472 1:96226703-96226725 CTCAATGCTCAAATAAAAAGTGG + Intergenic
912166494 1:107047742-107047764 CAAAATGCACAAATAAAGCAAGG + Intergenic
912237459 1:107867459-107867481 CTCCATCCAAAAACAAAGGAGGG + Intronic
914997230 1:152554915-152554937 TTAAATCAACAAGTAAAGAAGGG + Intronic
915208037 1:154285705-154285727 CTAAATGCACAAACAAAGCAAGG + Intergenic
915572528 1:156752104-156752126 CTCAATCCACAAATATTTACTGG + Intronic
916350030 1:163838521-163838543 ATCTACCCACAAATGAAGAAGGG - Intergenic
916725922 1:167524163-167524185 TTCAAACCACAAACTAAGAAAGG + Intergenic
918265279 1:182836712-182836734 CTCAATGATCAAATAATGAAAGG - Intergenic
919248183 1:195015571-195015593 CTCAACACACAAATTAAAAATGG - Intergenic
921207680 1:212862368-212862390 GTCAATCCACAGAAAGAGAAGGG - Intronic
921500195 1:215892705-215892727 CTCAAAACAAAAATTAAGAATGG + Intronic
921803336 1:219426918-219426940 CTTATTTCACAAATGAAGAAAGG + Intergenic
922364127 1:224847985-224848007 CTCAATTCAGATATGAAGAAAGG - Intergenic
923925973 1:238628127-238628149 CTGAATCAACAAGTAAAGAAGGG - Intergenic
1064550462 10:16495846-16495868 GTCACTGCACAAATAAAGAAAGG - Intronic
1064719799 10:18217475-18217497 CTCCATCTCAAAATAAAGAAAGG + Intronic
1065756054 10:28932180-28932202 CTCAATAAAAAAATAAAAAAAGG + Intergenic
1069139134 10:64802183-64802205 CTGAATCAACAGGTAAAGAAGGG - Intergenic
1069335585 10:67345993-67346015 CTCAAACCAAAAATATACAATGG - Intronic
1070992943 10:80748532-80748554 AGCAATACACAAATAAATAATGG - Intergenic
1071402430 10:85287588-85287610 ATCAAACCACAAAAGAAGAAAGG + Intergenic
1072877406 10:99187559-99187581 CTCAATTTAAAGATAAAGAAAGG + Intronic
1073036426 10:100567097-100567119 CTCAATACACATATAAAATAGGG + Intergenic
1074032769 10:109705144-109705166 CTCACTCATCAAATACAGAATGG + Intergenic
1074928411 10:118097871-118097893 ATTAATCCACATATAAATAAAGG - Intergenic
1077278694 11:1732082-1732104 CTCAATAAATAAATAAATAAAGG - Intergenic
1078018985 11:7639956-7639978 CACAATCCACAATTGGAGAATGG + Intronic
1078888331 11:15528361-15528383 ATCAAATCACAAAGAAAGAAAGG + Intergenic
1079397372 11:20076571-20076593 TTAAAGCCAAAAATAAAGAATGG - Intronic
1079993903 11:27275006-27275028 GTCAGTCCAAAAATAAACAATGG + Intergenic
1080249168 11:30213868-30213890 CTCATTCCACATAGAAATAAAGG + Intergenic
1080270284 11:30443910-30443932 CTCAATCCACATTTGATGAATGG + Intronic
1080292028 11:30681575-30681597 ATCAATCCAAAAATATTGAATGG + Intergenic
1080913157 11:36626081-36626103 ATCAATCAACAAATAAACAAAGG - Intronic
1081839412 11:46186084-46186106 CTAAAGCCACAAACAAACAAAGG + Intergenic
1082978956 11:59102934-59102956 CTTAATTTACAAATAAGGAATGG + Intergenic
1084043602 11:66556448-66556470 CTCAAAAAACAAACAAAGAATGG - Intronic
1084635923 11:70392600-70392622 CTCCATCTACAAAAAAAAAAAGG - Intergenic
1085789814 11:79487281-79487303 CCCAATGCAAATATAAAGAAAGG - Intergenic
1085920074 11:80943449-80943471 CTCAATCAACCAAAAGAGAATGG - Intergenic
1086535921 11:87845751-87845773 CTCAATTCAAACATAAAAAAAGG + Intergenic
1086723490 11:90150360-90150382 ATTACTCCCCAAATAAAGAAAGG + Intronic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087978931 11:104586179-104586201 CCCATCCCACAAAAAAAGAAGGG + Intergenic
1088041447 11:105389054-105389076 CACAAACCACAAATAAAAAATGG + Intergenic
1089192557 11:116663654-116663676 CTGCATCCACAAAATAAGAATGG + Intergenic
1091676942 12:2498442-2498464 CCCAATAAATAAATAAAGAATGG - Intronic
1092817979 12:12327591-12327613 CTAAATCCATTAATAAAGAGAGG + Exonic
1093328671 12:17809811-17809833 CTGAATAAACTAATAAAGAAGGG + Intergenic
1093543399 12:20315937-20315959 TTAAATGCATAAATAAAGAAGGG - Intergenic
1094274861 12:28661647-28661669 CTCATACCACAAATAAATTAAGG + Intergenic
1094593711 12:31844879-31844901 CTCAATTAAAAAATAAAGCATGG - Intergenic
1094639409 12:32259340-32259362 CTCCACCCACAAATAAATAAAGG + Intronic
1097754117 12:63390128-63390150 CAAAATGCACAAATAAAGCAAGG - Intergenic
1097852052 12:64421724-64421746 CTGTATTCACAAATAAAGACAGG - Intronic
1098834068 12:75399612-75399634 CTCATTTCCCAAATAAATAATGG - Intronic
1100108111 12:91202986-91203008 CTCAATACACATATAAACATTGG + Intergenic
1102463239 12:113113142-113113164 CTCAATCTGTAAAGAAAGAAAGG - Intronic
1102945322 12:116982080-116982102 CTCAATCCAAAAAATAAAAAAGG + Intronic
1103055387 12:117816127-117816149 CTCCTTCAACCAATAAAGAATGG + Intronic
1105444949 13:20445474-20445496 CTCAATCCACAATTAAGTTAGGG + Intronic
1106740896 13:32639938-32639960 CCAAATCAACAAATAAAGACCGG - Intronic
1107480537 13:40782230-40782252 CCCAAACCAGAAAAAAAGAAGGG - Intergenic
1108069535 13:46614107-46614129 CTCTCGCCACAAAAAAAGAAAGG - Intronic
1108505970 13:51112714-51112736 ATCAATTCACAGATGAAGAAGGG + Intergenic
1109928666 13:69183540-69183562 CAAAATGCACAAAGAAAGAAAGG - Intergenic
1110465073 13:75790981-75791003 CTCCATCCAAAAAAAAAAAAGGG - Intronic
1110545080 13:76747057-76747079 CTCTATCCAAAAAAAAAAAAAGG - Intergenic
1112474688 13:99720486-99720508 CTCAATCCAAAAGAAAAGAGTGG - Intronic
1114469841 14:22952823-22952845 AAAAATCCACAAATAAACAAGGG + Intronic
1114650813 14:24283601-24283623 CTCAATAAATAAATAAATAAAGG + Intergenic
1114787837 14:25621404-25621426 CTCAATAAATAAATAAATAAAGG + Intergenic
1114959726 14:27870763-27870785 TTCTGTCCACAAATAAGGAAAGG - Intergenic
1116076783 14:40120932-40120954 CTCATTCCACAACAAAACAAAGG + Intergenic
1117902796 14:60552413-60552435 CTAAATACACAAATTAAGATAGG - Intergenic
1117935336 14:60898611-60898633 CTCAATTCAACAATAAAAAAAGG - Intronic
1119006126 14:70931116-70931138 CTCCATCCACCAAGAATGAAAGG + Intronic
1119566242 14:75631551-75631573 CAGAATCCACAGAAAAAGAAAGG - Intronic
1119878255 14:78078553-78078575 CACAATCTACAAATATAAAATGG + Intergenic
1119912690 14:78364509-78364531 GTCAATCCACATATAAAAATAGG - Intronic
1120066593 14:80048194-80048216 TTAAATCTACAAATAAAGCACGG - Intergenic
1121432323 14:93896335-93896357 CCCAACCCACAAGTTAAGAACGG + Intergenic
1122242484 14:100378047-100378069 CACAATCCAGAGAAAAAGAAGGG - Intronic
1123837578 15:24211764-24211786 CTCACTTCACACACAAAGAAGGG - Intergenic
1123846801 15:24311518-24311540 CTCACTTCACAGACAAAGAAGGG - Intergenic
1124364117 15:29060167-29060189 CACAAACCACAAAATAAGAAAGG - Intronic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1124956396 15:34363307-34363329 CTCAGTCCTCAGATGAAGAAGGG + Intronic
1125076979 15:35630900-35630922 CTCATTTCCAAAATAAAGAAAGG - Intergenic
1125879746 15:43183915-43183937 CTCACTCCACCAAAAAAGAGGGG + Intronic
1126835403 15:52658982-52659004 CTCAAAAAACAAAAAAAGAAAGG + Intronic
1128500660 15:68225337-68225359 GTCAATCCACAGATAAAACATGG + Intronic
1129469858 15:75746554-75746576 CTCACACCATAAATAAATAATGG - Intergenic
1130077802 15:80704710-80704732 CTCCATCCACAACTAGAGGAGGG - Intronic
1131185324 15:90268958-90268980 GTCAATCAATAAATAAATAATGG - Intronic
1131231148 15:90660540-90660562 ATCAAACCACTAATAAAGCATGG - Intergenic
1132238195 15:100237585-100237607 CTCAATACACAAGTAGGGAAAGG + Intronic
1132997787 16:2832244-2832266 CTGAATCCACCAATAAATAAAGG + Exonic
1133551234 16:6856173-6856195 CTCAATACACATTTGAAGAAGGG - Intronic
1133812275 16:9169955-9169977 CTCAAAAAACAAAGAAAGAAAGG - Intergenic
1133881011 16:9782116-9782138 TTGAATTCACAAATACAGAAAGG - Intronic
1134635090 16:15785988-15786010 CTCAATCCACAGTTACTGAATGG + Intronic
1136125069 16:28173391-28173413 CTCATTTTACAAAGAAAGAAAGG + Intronic
1136604408 16:31323720-31323742 CTCACTTTAAAAATAAAGAATGG + Intronic
1137652445 16:50132144-50132166 CTGAATCAACAAAAAAAGAAGGG - Intergenic
1140643060 16:76999499-76999521 CTTAATCCAGAAATAAAAACTGG + Intergenic
1142281916 16:89153315-89153337 CTCCATTCACCATTAAAGAAGGG - Intronic
1142957259 17:3530355-3530377 CGCATTCCACAGATAAAGACGGG - Intronic
1143561813 17:7700977-7700999 CTCAATCTAAAAAAAAAAAAAGG - Intronic
1144802359 17:17938517-17938539 CTCAATCCTCCACTAGAGAATGG + Intronic
1145032951 17:19519114-19519136 CTCAATAAATAAATAAATAAGGG - Intronic
1146542526 17:33709957-33709979 GTCAATGCAAAAAGAAAGAAGGG - Intronic
1146667897 17:34716944-34716966 CTCCATCAAAAAAGAAAGAAAGG + Intergenic
1146961909 17:36987831-36987853 CTTAATCCTCAAATCAATAAGGG - Intronic
1147282225 17:39371380-39371402 CTCCATCCAATAAAAAAGAATGG - Intronic
1148655964 17:49283790-49283812 CTCAATAAATAAATAAATAAAGG - Intergenic
1156960671 18:43025969-43025991 CTCAATCTATAAATAAATAAAGG + Intronic
1157107224 18:44785706-44785728 CTCAATCAAGAGATAACGAAGGG - Intronic
1157742316 18:50104538-50104560 CTTCATCCCCAAATAAAGACAGG - Intronic
1158167368 18:54555503-54555525 CTCAAAAGAAAAATAAAGAAAGG + Intergenic
1159282756 18:66309008-66309030 CTTTATCCAAAAATACAGAATGG - Intergenic
1159456283 18:68663358-68663380 CTAAATCAACAAGCAAAGAAGGG + Intergenic
1160683057 19:421041-421063 CTCCATCAAGAAAGAAAGAAAGG + Intronic
1163838721 19:19592721-19592743 TTCAATCAACAAAAACAGAAAGG + Intronic
1165259742 19:34602544-34602566 ATCAACCCACAAAAAAACAAAGG - Intronic
1166985519 19:46658090-46658112 CTCAATGAATAAATAAATAAAGG + Intronic
1167571937 19:50293755-50293777 CTTATTCAACAAATATAGAAAGG + Intronic
925425756 2:3747694-3747716 ATTGATCAACAAATAAAGAAAGG - Intronic
925799830 2:7587356-7587378 CTCAATCAACAATGAATGAATGG - Intergenic
926793855 2:16602680-16602702 CTCATTTTACAAAAAAAGAATGG + Intronic
926960055 2:18346966-18346988 CTTAATCCACAAATAATAAATGG - Intronic
927673225 2:25086591-25086613 CTCAATAAATAAATAAATAAAGG - Intronic
928089881 2:28367544-28367566 CTCAATGAAGAAATAAATAAAGG - Intergenic
929665923 2:43833683-43833705 CTCAATAAATAAATAAATAAAGG - Intronic
929693319 2:44092745-44092767 CTCCATCAAGAAAGAAAGAAAGG - Intergenic
929933182 2:46274459-46274481 CTCAGTCTACAAATACAGGAAGG + Intergenic
930924932 2:56805947-56805969 TTCAATACAAAACTAAAGAAGGG + Intergenic
935866877 2:107397679-107397701 CACAATCTACAAAAAAAGAAAGG - Intergenic
936768509 2:115883602-115883624 CACAATCCACACTTAATGAATGG + Intergenic
936845188 2:116822252-116822274 CTCAATTAACAAATAAGGAATGG + Intergenic
938301457 2:130217019-130217041 CTCTGTCAACAAAGAAAGAAAGG + Intergenic
938455252 2:131457454-131457476 CTCTGTCAACAAAGAAAGAAAGG - Intergenic
938802905 2:134779157-134779179 CACAATGCACAAACAAAGCAAGG + Intergenic
939114029 2:138040163-138040185 CTCATTCCACAGAAACAGAAAGG - Intergenic
939426453 2:142044201-142044223 TTTAATGCACAAATAAAGCAAGG - Intronic
939723463 2:145684055-145684077 CTCCATGCCCATATAAAGAAGGG - Intergenic
940389258 2:153112312-153112334 CTCCATCCACAGCTAATGAAGGG - Intergenic
940876510 2:158902995-158903017 GTCTATCCAGAAATAAACAAGGG - Intergenic
941634148 2:167917344-167917366 CTCCATCCAAAAAAAAAAAAAGG - Intergenic
945426773 2:209715353-209715375 CTCAATGGTCAAGTAAAGAAAGG - Intronic
947090031 2:226499245-226499267 CTCAATAAATAAATAAATAATGG - Intergenic
947127178 2:226881810-226881832 CCCATTTCACAAATAAAGAACGG - Intronic
947649144 2:231769817-231769839 CTCAATCCATAAATACTTAAGGG + Intronic
948438359 2:237968499-237968521 CTCAATCCAAGCATAAAGGATGG - Intronic
1170202092 20:13755322-13755344 TTCCATCCAGAAATAAATAATGG - Intronic
1170216648 20:13898654-13898676 CTCTACCCATAAATGAAGAATGG - Intronic
1171329854 20:24327949-24327971 CTGAATCCACAGGCAAAGAAAGG - Intergenic
1171436359 20:25127613-25127635 CTAAATCAACAAGCAAAGAAGGG + Intergenic
1173437392 20:43045344-43045366 CTCAATAAACAAATAAAGATTGG - Intronic
1173717993 20:45227513-45227535 TTCAATCCACAAACATGGAATGG + Intergenic
1174843280 20:53919555-53919577 CTAAATAAATAAATAAAGAAGGG + Intergenic
1178971185 21:37178620-37178642 CTCAATTCAAAAATGAATAAAGG - Intronic
1179632199 21:42685440-42685462 CTCAGTCCCCAAATACCGAAAGG + Intronic
1180251666 21:46594282-46594304 CTCCATCCAAAAAAAAAAAAAGG + Intergenic
1181529718 22:23510515-23510537 CTCATTCAACAAACAAACAATGG + Intergenic
949335762 3:2973547-2973569 CTCTACCCACACATCAAGAAAGG + Intronic
949926289 3:9044582-9044604 GCGAAACCACAAATAAAGAAGGG + Intronic
951524706 3:23642771-23642793 CTCAATAAATAAATAAATAAGGG + Intergenic
951700863 3:25495323-25495345 CTTAAATCACAAATCAAGAAAGG - Intronic
953025496 3:39142585-39142607 CTCAATCTCCAAATAAATTATGG + Exonic
954563609 3:51579577-51579599 CTCAATTCACAAAGGAAGACAGG - Intronic
955029373 3:55201424-55201446 TTGAATCCACAAATAAAGGGTGG - Intergenic
955578787 3:60396207-60396229 CTCCCTCAAAAAATAAAGAACGG + Intronic
955720816 3:61878829-61878851 CTCATTCCAAAAATATAGGACGG - Intronic
955731968 3:61996675-61996697 AGCATTCCCCAAATAAAGAATGG - Intronic
956260838 3:67339181-67339203 CTCAATTAACAAAGAAAGGAGGG + Intergenic
956914516 3:73857224-73857246 CTCCATCAAGAAAGAAAGAAAGG - Intergenic
957384499 3:79478499-79478521 CACAATCGACATATAAATAATGG - Intronic
957480537 3:80787792-80787814 CTGAATCAACAGAAAAAGAAGGG + Intergenic
959388190 3:105739557-105739579 CTCACTCCACACACAAAGTATGG - Intronic
959793478 3:110393473-110393495 CTGAATCTATAGATAAAGAAGGG - Intergenic
960765533 3:121125744-121125766 CTGAATCCAGAATTAATGAAAGG - Intronic
960869584 3:122235178-122235200 CTCATTCCACAAATTTAAAAAGG + Intronic
960919022 3:122727795-122727817 CTCAATCTGCAAATTAATAAAGG - Exonic
961630861 3:128297353-128297375 CTCAATCCACAAATAAAGAAAGG - Intronic
962155179 3:132939498-132939520 TTCAATCTATAGATAAAGAATGG - Intergenic
962578225 3:136774009-136774031 CTCCATCTAAAAAAAAAGAAAGG - Intergenic
963420749 3:145058002-145058024 CTAAATCAACAAGTAAAGAAAGG + Intergenic
964629134 3:158790545-158790567 CTAAATACACAAATATAGAAGGG + Intronic
965337478 3:167444922-167444944 ATCAATGCACAAGTAAATAATGG - Intronic
965936052 3:174114041-174114063 CTTAATCTAAAAATAAAGGAGGG - Intronic
966130519 3:176633277-176633299 CCCAATCTAAAAAGAAAGAAAGG - Intergenic
969409487 4:7018688-7018710 GGCAAGCCACAATTAAAGAACGG - Intronic
970889178 4:21023491-21023513 CTCAATTGAAAAATTAAGAAAGG + Intronic
971211328 4:24620007-24620029 CTCAATCAAAAAACATAGAATGG - Intergenic
971630105 4:28980092-28980114 CACGACCCACAAATAAAGTATGG - Intergenic
972093414 4:35317541-35317563 CTGAATCAACAGGTAAAGAAGGG + Intergenic
972116528 4:35642551-35642573 CAAAATGCACAAATAAAGCAAGG + Intergenic
972243810 4:37223522-37223544 CTCAGGCCACAAAAAGAGAAAGG - Intergenic
972457173 4:39265891-39265913 CTCTAGCAACAAATGAAGAAAGG + Intronic
973896729 4:55421194-55421216 CTCAGTATACAAATAAAGACTGG + Intronic
975207956 4:71665886-71665908 CTCAATAAATGAATAAAGAAAGG + Intergenic
975219560 4:71798684-71798706 CTTAATACACTAATAAAGAAAGG - Intronic
975920953 4:79386922-79386944 CTGATTCCAAAAACAAAGAATGG - Intergenic
976029818 4:80738908-80738930 CTCAAACCAAAAATATACAATGG - Intronic
976564413 4:86537391-86537413 CTCTATTCACAGAGAAAGAACGG + Intronic
977036375 4:91958589-91958611 CTCTATACACAAATCAAGGAAGG - Intergenic
978409485 4:108411330-108411352 ATCAATACAAAAAGAAAGAAAGG + Intergenic
978978065 4:114904890-114904912 TACAATCCACAATTAAAGACTGG + Intronic
980340639 4:131540780-131540802 CTCTCTCCATATATAAAGAATGG + Intergenic
980663040 4:135892286-135892308 TAAAATCCAGAAATAAAGAATGG - Intergenic
980686310 4:136234414-136234436 CTCATACAACAAAGAAAGAAAGG - Intergenic
981086030 4:140684828-140684850 CTCAATAAATAAATAAATAAAGG + Intronic
981404082 4:144346953-144346975 CTCCATTCAGAACTAAAGAAAGG + Intergenic
981786020 4:148480568-148480590 CTCAATCCACAAGTAGCTAAGGG + Intergenic
982043352 4:151417107-151417129 CTAAATGCACAAACAAAGCAAGG + Intronic
982051381 4:151505884-151505906 ATCATTCAACAAAAAAAGAAGGG - Intronic
982664005 4:158239037-158239059 CTCAATCGTAAAACAAAGAAAGG - Intronic
982983924 4:162179536-162179558 ATGAATCCACAACTAAATAATGG - Intergenic
983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG + Intronic
983816933 4:172141921-172141943 CTCATTCCTGAAATAAAGATAGG + Intronic
984311156 4:178060587-178060609 CACAATCAAAAAATAAAGTAAGG - Intergenic
985874305 5:2583730-2583752 CTCATTCAACAAATAATGAATGG - Intergenic
988493589 5:31726119-31726141 CACAATCTACAGATAAGGAAAGG - Intronic
990118856 5:52424325-52424347 CTTAATCAAAAAATAAAAAAAGG + Intergenic
991072836 5:62504148-62504170 CACAGTTCACAAATACAGAAAGG - Intronic
992109642 5:73481027-73481049 CTGAGTCAACAAGTAAAGAAGGG - Intergenic
995960946 5:117838874-117838896 CTGACTTCACAAATAAATAATGG - Intergenic
996248475 5:121295793-121295815 CTCAATAAATAAATAAATAAGGG + Intergenic
998176965 5:139907493-139907515 CTCCTTCCACTAGTAAAGAATGG + Intronic
998421377 5:141990309-141990331 CTCAACCCACTCATAAAAAAAGG - Intergenic
998971276 5:147595151-147595173 CTCAATCCTCAGAAAAATAATGG + Intronic
999696607 5:154192657-154192679 CTCAAGACAGAAAAAAAGAAGGG - Intronic
1000756963 5:165173455-165173477 CTGAATCCTCACATAAAGGAGGG - Intergenic
1004377304 6:15101997-15102019 CTCAGAGAACAAATAAAGAAAGG - Intergenic
1005451696 6:25979416-25979438 CTCAAAAAACAAATAAAGCATGG - Intronic
1007213951 6:40221371-40221393 CTGAATCAACAAGCAAAGAATGG + Intergenic
1007214190 6:40223736-40223758 CTGAATCAACAAGCAAAGAATGG - Intergenic
1007723015 6:43896947-43896969 GACAATGCACACATAAAGAAAGG - Intergenic
1008088219 6:47266681-47266703 TTCAATCCTAAAATACAGAAGGG + Intronic
1008411472 6:51185040-51185062 CTCCACCCACAAATAAATATGGG + Intergenic
1009738526 6:67711909-67711931 CTGAAAGCATAAATAAAGAAAGG - Intergenic
1010145440 6:72663835-72663857 GTCAACACACATATAAAGAATGG - Intronic
1010256538 6:73764837-73764859 CTAAAACGACAAAGAAAGAATGG + Intronic
1010743324 6:79532867-79532889 TTCATTTCACAAATAATGAATGG - Intronic
1011161514 6:84396173-84396195 CCAAATCCCCAAATAAACAAGGG - Intergenic
1011967616 6:93178600-93178622 CTCATTCTACAATGAAAGAAAGG - Intergenic
1012202283 6:96421465-96421487 CTTAATCCACAGACAAGGAAAGG + Intergenic
1012263089 6:97110986-97111008 TTCAAACCACAAAGGAAGAAAGG + Intronic
1012773741 6:103478033-103478055 CTAAATGCACAAGTAAACAATGG - Intergenic
1014876533 6:126667754-126667776 CTCAGTTCACATATATAGAATGG + Intergenic
1015734606 6:136385325-136385347 GGCAATCCAAACATAAAGAAAGG + Intronic
1015974434 6:138774905-138774927 CACTATGCACAAATAAAGTATGG + Intronic
1017041599 6:150312838-150312860 CAAAATGCACAAATAAAGCAAGG - Intergenic
1017452563 6:154567336-154567358 CTGAATCAACAAACAAACAAGGG + Intergenic
1017458442 6:154624700-154624722 CTCAATCAACAAATATAAAAAGG + Intergenic
1018327031 6:162681915-162681937 CAAAATGCACAAACAAAGAAAGG - Intronic
1018503668 6:164441250-164441272 CTGCTTCCACATATAAAGAATGG - Intergenic
1018865359 6:167743082-167743104 CTCAATCAACAAGCTAAGAAGGG + Intergenic
1019222091 6:170480952-170480974 CTGAATCAACAGACAAAGAAAGG + Intergenic
1019762317 7:2822551-2822573 CTCAATCAACAAAAAGAAAAAGG + Intronic
1021001405 7:15335792-15335814 CTGAAACCACAACTGAAGAAAGG - Intronic
1021017612 7:15553933-15553955 CTCAAGACACAAAGAAAGAGGGG + Intronic
1023230510 7:38022911-38022933 CACAAACCAAAAAAAAAGAATGG - Intronic
1023289164 7:38651423-38651445 AACAGTCCACAAATAGAGAAAGG + Intergenic
1023531728 7:41163803-41163825 ATCAATCCACAAAGAACAAATGG - Intergenic
1024778020 7:52810887-52810909 CACAATCTACAAATAAGGAATGG + Intergenic
1025107282 7:56182416-56182438 CTCAAAAAACAAAAAAAGAATGG - Intergenic
1025907108 7:65796011-65796033 CTCCATCTAAAAAAAAAGAAAGG - Intergenic
1026003244 7:66579836-66579858 CTCAATCCACAAATATAAGCTGG + Intergenic
1026541330 7:71282500-71282522 CTCATTCAACAAATACGGAATGG - Intronic
1026601295 7:71779459-71779481 ATCAAACCACACATAATGAATGG + Intergenic
1027127289 7:75565736-75565758 CTCCATCCAAAAAAAAAAAAAGG - Intronic
1027689348 7:81322702-81322724 CACAAACCAGAATTAAAGAAGGG - Intergenic
1028680869 7:93529740-93529762 CTCAATGAAGAAATAAATAAAGG + Intronic
1030207074 7:106961426-106961448 CTCAATGGACATATGAAGAAGGG + Intergenic
1031360127 7:120839374-120839396 ATCAATCTACATTTAAAGAAAGG + Intronic
1031832424 7:126644169-126644191 TTCATTCCACAAATAAAGTTTGG - Intronic
1032486597 7:132292307-132292329 CTCCATCCACAAAGAAACTAGGG + Intronic
1032542868 7:132718159-132718181 CTCAATGCACAAATAGAAAGTGG + Intronic
1033252417 7:139772586-139772608 CTCAATAAATAAATAAAGAGTGG - Intronic
1034887289 7:154807464-154807486 ATCAATCCATCAATAAAGATAGG + Intronic
1035916426 8:3629359-3629381 CTAAATACACATATAAATAATGG - Intronic
1039414497 8:37381978-37382000 CTAAATACACAACAAAAGAAAGG + Intergenic
1040610839 8:48980452-48980474 CCCAATCCACGAAAATAGAATGG + Intergenic
1041602982 8:59744134-59744156 TTGAATCCACTAATGAAGAATGG + Intergenic
1042212161 8:66391714-66391736 ATCAACCCACTGATAAAGAAGGG + Intergenic
1042397707 8:68311115-68311137 CACAATCCAGAAAGAAAGAAAGG - Intronic
1042716595 8:71779931-71779953 CTCAATCTAGAAAGGAAGAAAGG + Intergenic
1042974961 8:74458525-74458547 GTCCATCCACAACTCAAGAATGG + Intronic
1043037643 8:75218334-75218356 CTCAACAGAGAAATAAAGAATGG + Intergenic
1043179708 8:77072070-77072092 CCCAATACTCAAATAAAGCATGG - Intergenic
1043616117 8:82127739-82127761 CTCTATCCATAACAAAAGAATGG - Intergenic
1043859107 8:85295025-85295047 CTCCTTCCCCAAATAATGAAAGG + Intergenic
1044032726 8:87258363-87258385 CTACACACACAAATAAAGAAGGG - Intronic
1044403905 8:91804618-91804640 CTAAAAACAAAAATAAAGAAAGG + Intergenic
1045962551 8:107984949-107984971 CTAAATTCACAAATAATAAATGG - Intronic
1046122763 8:109866188-109866210 CACAATCCAGAAACAGAGAAAGG + Intergenic
1047231338 8:123000634-123000656 CTCCATCAAAAAAGAAAGAAGGG + Intergenic
1047477258 8:125245280-125245302 CTCAATAAATAAATAAATAAAGG + Intronic
1049248144 8:141573774-141573796 CAAAATGCACAAATAAAGCAAGG - Intergenic
1050052000 9:1612262-1612284 CACAATACACAAGGAAAGAAAGG - Intergenic
1050869237 9:10545512-10545534 ATCAATCAATAAATAAACAAGGG - Intronic
1051462832 9:17342741-17342763 CTCATTCCAAAAATGAAGCACGG - Intronic
1052010667 9:23404692-23404714 GCCAAGCCAAAAATAAAGAAAGG - Intergenic
1052097982 9:24408234-24408256 CTGAATCAACGAATAAAGATAGG - Intergenic
1053118155 9:35523941-35523963 CTAAATCAATAAATTAAGAAAGG + Intronic
1055312202 9:74994138-74994160 CTCTATGCACAACCAAAGAAAGG + Intronic
1055863511 9:80784202-80784224 TGCAATCCACAAATAAAAAGTGG + Intergenic
1055927720 9:81527613-81527635 CTCAATAAATAAATAAATAAAGG + Intergenic
1057002019 9:91518891-91518913 GGCATTCCACAAATTAAGAAAGG + Intergenic
1057238375 9:93385984-93386006 CTAAGTCCAAAAATAAAGCAAGG + Intergenic
1058368836 9:104241014-104241036 CTCAAAACAAAAAGAAAGAAGGG + Intergenic
1061137650 9:128744482-128744504 CTCCATCCAAAAAAAAAAAAAGG - Intronic
1061250568 9:129424030-129424052 CTCATTCAACAAACAAACAATGG + Intergenic
1061854602 9:133434824-133434846 GTCAATCCACAGAGACAGAAGGG - Intronic
1186328233 X:8503036-8503058 CTGAATCTACAAATAAAGGAAGG + Intergenic
1186873211 X:13792550-13792572 CCCCATCCCCAAATAAAGAATGG + Intronic
1187312856 X:18162287-18162309 CTCAGTCCACAAACACAGGAGGG - Intergenic
1187808042 X:23142888-23142910 CTCCATCAACAAAAAAAAAAAGG + Intergenic
1188327624 X:28824914-28824936 ATGAATACACAAATACAGAAAGG - Intronic
1188407975 X:29836024-29836046 CTCAACCCAAAATTAAGGAAGGG - Intronic
1188649713 X:32617058-32617080 CTGAATCCACAGACAGAGAAAGG + Intronic
1188730878 X:33645248-33645270 CTCAACCCCAAATTAAAGAAAGG + Intergenic
1190365228 X:49686882-49686904 GTCAATCTACAAAAAAAGTACGG + Intergenic
1190522556 X:51295150-51295172 CTCAATCCCAATATAAAGGAAGG + Intergenic
1190527650 X:51344239-51344261 TTGAATCAACAAGTAAAGAAAGG - Intergenic
1191755789 X:64590916-64590938 CTCAATCAAGAAATAATGACGGG + Intergenic
1192348542 X:70334173-70334195 TTCCATCAACAAAAAAAGAAAGG - Intronic
1193071542 X:77311090-77311112 CTCCATCCAAAAAAAAAAAAAGG + Intergenic
1193251412 X:79295594-79295616 CTCAATAGACAAAGAAAAAAAGG + Intergenic
1193433887 X:81448113-81448135 CTTAATCCAAGAATAAAGAGTGG + Intergenic
1194562640 X:95441600-95441622 GTCAATCTACAAAGAAAGACTGG + Intergenic
1194791321 X:98154324-98154346 CTCAATCCAAAGATATAGAATGG - Intergenic
1194919923 X:99752169-99752191 ATAAATGGACAAATAAAGAAAGG - Intergenic
1195007043 X:100695507-100695529 CTTAATCCACAAAGAAAAAAGGG + Intronic
1196002253 X:110798074-110798096 CTCAATTCAGAAATCAAGATTGG - Intergenic
1196944120 X:120807354-120807376 CTCCATCAAAAAAAAAAGAAAGG - Intergenic
1197084769 X:122458909-122458931 ATGAAGACACAAATAAAGAAAGG + Intergenic
1197828157 X:130612841-130612863 CTCATGCCACCAACAAAGAAAGG - Intergenic
1198212186 X:134526701-134526723 CTCAATAAATAAATAAATAATGG - Intergenic
1200696796 Y:6368094-6368116 CTGACTCCAAAAAAAAAGAAGGG + Intergenic
1201037317 Y:9796605-9796627 CTGACTCCAAAAAAAAAGAAGGG - Intergenic
1202049075 Y:20762350-20762372 AACAATCCACAAAAACAGAAGGG - Intronic
1202277738 Y:23142744-23142766 CTACATCCAGAAATGAAGAATGG + Intronic
1202278634 Y:23152536-23152558 CTATATCCACAAATGAAGAAGGG + Intronic
1202286104 Y:23249073-23249095 CTATATCCACAAATGAAGAAGGG - Intronic
1202286569 Y:23256228-23256250 CTATATCCACAAATGAAGAAGGG - Intronic
1202287465 Y:23266023-23266045 CTACATCCAGAAATGAAGAATGG - Intronic
1202287630 Y:23268407-23268429 CTACATCCAGAAATGAAGAATGG - Intronic
1202287795 Y:23270792-23270814 CTACATCCAGAAATGAAGAATGG - Intronic
1202287959 Y:23273176-23273198 CTACATCCAGAAATGAAGAATGG - Intronic
1202288125 Y:23275560-23275582 CTACATCCAGAAATGAAGAATGG - Intronic
1202288289 Y:23277944-23277966 CTACATCCAGAAATGAAGAATGG - Intronic
1202431458 Y:24783876-24783898 CTATATCCACAAATGAAGAAGGG + Intronic
1202431761 Y:24788633-24788655 CTATATCCACAAATGAAGAAGGG + Intronic
1202432064 Y:24793389-24793411 CTATATCCACAAATGAAGAAGGG + Intronic
1202438204 Y:24869529-24869551 CTATATCCACAAATGAAGAAGGG - Intronic
1202438507 Y:24874286-24874308 CTATATCCACAAATGAAGAAGGG - Intronic
1202439405 Y:24884080-24884102 CTACATCCAGAAATGAAGAATGG - Intronic
1202439569 Y:24886465-24886487 CTACATCCAGAAATGAAGAATGG - Intronic
1202439734 Y:24888850-24888872 CTACATCCAGAAATGAAGAATGG - Intronic
1202439899 Y:24891234-24891256 CTACATCCAGAAATGAAGAATGG - Intronic
1202440064 Y:24893619-24893641 CTACATCCAGAAATGAAGAATGG - Intronic