ID: 961631041

View in Genome Browser
Species Human (GRCh38)
Location 3:128298732-128298754
Sequence TACCAAAGGCTGGTGGGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1477
Summary {0: 1, 1: 1, 2: 9, 3: 70, 4: 1396}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961631041 Original CRISPR TACCAAAGGCTGGTGGGCAG GGG (reversed) Intronic
900268674 1:1775067-1775089 TCCCCCAGGCTGGAGGGCAGTGG - Intronic
900277189 1:1838482-1838504 TCCCACAGGCTGGAGTGCAGTGG + Intronic
900288422 1:1913297-1913319 TGCCATAGGCTGGGGGGCGGGGG + Intergenic
901285474 1:8075304-8075326 TCCCACAGGCTGGAGTGCAGTGG + Intergenic
901689187 1:10961353-10961375 TAATAAAGGTAGGTGGGCAGAGG + Intronic
901826922 1:11868161-11868183 TCCCCCAGGCTGGAGGGCAGTGG + Intergenic
901844759 1:11974853-11974875 TCCCAGAGGCTGCTGGGCAGTGG - Exonic
902082323 1:13829436-13829458 TACAATAGGCTGGTGGGGAGGGG + Intergenic
902183945 1:14711151-14711173 TCCCCCAGGCTGGAGGGCAGTGG - Intronic
902228033 1:15009076-15009098 TAGCTAAGGCTGGAGGGAAGGGG - Intronic
902231947 1:15033560-15033582 TAGCAAGGGCTGGTGGGATGTGG - Intronic
902408772 1:16200859-16200881 TACCCCAGGCTGGAGTGCAGTGG - Intronic
902743486 1:18457114-18457136 TTGCTAAGGCTGGAGGGCAGTGG + Intergenic
902954548 1:19916196-19916218 TACCAGGGGCTGGTGGACAATGG + Intergenic
903208094 1:21798121-21798143 TCCCACAGGCTGGAGTGCAGTGG + Intergenic
903418730 1:23202952-23202974 TCACCAAGGCTGGTGTGCAGTGG + Intergenic
903444601 1:23414124-23414146 TAGCACAGGCTGGCGTGCAGTGG + Intronic
903687776 1:25145002-25145024 CACCCAAGGCTGGAGTGCAGTGG + Intergenic
904018110 1:27439959-27439981 TCTCAAAGGCTGGAGGGCAGTGG - Intronic
904159532 1:28512832-28512854 CTCCAAAGGCTGGAGTGCAGTGG + Intronic
904182733 1:28678147-28678169 TACCCCAGGCTGGAGTGCAGTGG - Intronic
904242267 1:29155389-29155411 TACCCCAGGCTGGAGTGCAGTGG - Intronic
904649918 1:31997743-31997765 CACCCAAGGCTGGTGTGCAGTGG + Intergenic
904788289 1:32998795-32998817 TACCAAGCGCTGCTGGGCACTGG - Intergenic
904989119 1:34577203-34577225 TACCAAAGGCTGAGGGCGAGGGG - Intergenic
905067602 1:35196568-35196590 TACCCCAGGCTGGAGTGCAGTGG + Intergenic
905122806 1:35694872-35694894 TCACTAAGGCTGGTGTGCAGTGG + Intergenic
905186151 1:36198402-36198424 TCCCCCAGGCTGGTGTGCAGTGG + Intergenic
905187731 1:36208704-36208726 TACCCCAGGCTGGTATGCAGTGG + Intergenic
905213540 1:36390945-36390967 TCCCACAGGCTGGTGGGCACTGG + Intergenic
905420043 1:37835838-37835860 TCCCCAAGGCTGGAGTGCAGTGG + Intronic
905850468 1:41270656-41270678 TCCCCAAGGCTGGAGTGCAGTGG + Intergenic
906036544 1:42754017-42754039 AAACACAGACTGGTGGGCAGTGG + Intronic
906503451 1:46359417-46359439 TGCCAAAGGCTGGAGTGCAGTGG + Intronic
907199685 1:52715752-52715774 TACCCTAGGCTGGAGTGCAGTGG - Intergenic
907284406 1:53370801-53370823 TCCCCATGACTGGTGGGCAGGGG - Intergenic
907387219 1:54133854-54133876 TCCCACAGGCTGGAGTGCAGTGG - Intronic
907589587 1:55653564-55653586 CACCCAAGGCTGGAGTGCAGTGG + Intergenic
907761006 1:57359919-57359941 TACCAGAGGCTGGTGTGCTTGGG + Intronic
908908331 1:69041968-69041990 TAACCAAGGCTGGAGTGCAGTGG - Intergenic
909000837 1:70215820-70215842 TACCCCAGGCTGGAGTGCAGTGG + Intronic
909569958 1:77098366-77098388 TCACACAGGCTGGTGTGCAGTGG + Intronic
909578274 1:77201699-77201721 TACCCCAGGCTGGAGTGCAGTGG - Intronic
909624263 1:77698538-77698560 TGCCAAGGGCTGGAGTGCAGTGG + Intronic
909723519 1:78806115-78806137 TGCCAGAGGCTGGTGGAGAGAGG - Intergenic
910220639 1:84886484-84886506 TACTACAGGCTGGAGTGCAGTGG - Intronic
910252408 1:85211607-85211629 TAGCCCAGGCTGGTGTGCAGTGG + Intergenic
910353011 1:86321257-86321279 TTCCCAAGGCTGGAGTGCAGTGG + Intergenic
910888000 1:91986975-91986997 TTGCCAAGGCTGGAGGGCAGTGG + Intronic
911064122 1:93772642-93772664 TCCCCAAGGCTGGAGTGCAGTGG + Intronic
911373516 1:97023700-97023722 TAGCCTAGGCTGGTGTGCAGTGG + Intergenic
911449570 1:98046058-98046080 TACCAGCGGCAGGGGGGCAGCGG - Intergenic
911542070 1:99169240-99169262 TACCCCAGGCTGGAGTGCAGTGG + Intergenic
911629879 1:100171540-100171562 TCCCATAGGCTGGAGTGCAGAGG + Intronic
911737525 1:101354211-101354233 TAGCCAAGGCTGGAGTGCAGTGG + Intergenic
911737920 1:101357897-101357919 TCCCACAGGCTGGAGTGCAGTGG + Intergenic
912044685 1:105438705-105438727 TAGCCAAGGCTGGAGTGCAGTGG - Intergenic
912328805 1:108797450-108797472 TAGCACAGGCTGGAGTGCAGTGG + Intronic
912847038 1:113083692-113083714 ACCCAAAGCCTGATGGGCAGAGG - Intronic
914693080 1:150048637-150048659 TTCCCCAGGCTGGTGTGCAGTGG - Intergenic
915173490 1:153995289-153995311 TCCCCCAGGCTGGAGGGCAGTGG + Intronic
915524923 1:156469844-156469866 TCCCACAGGCTGGAGTGCAGTGG - Intronic
915849374 1:159304565-159304587 TAGCCCAGGCTGGAGGGCAGTGG - Intronic
915952369 1:160197969-160197991 TCCCCCAGGCTGGTGTGCAGTGG - Intronic
916004619 1:160648091-160648113 TACCAGAGGCTGAAGGGTAGTGG - Intergenic
916065032 1:161129498-161129520 TACCCCAGGCTGGAGTGCAGTGG - Intronic
916769234 1:167892011-167892033 TCCCCAAGGCTGGAGTGCAGTGG + Intronic
916854770 1:168738185-168738207 CACCAAGGCCTGGTTGGCAGTGG + Intergenic
916989267 1:170224857-170224879 TACCGGAGGCTGGTGGGGATGGG + Intergenic
917214995 1:172669055-172669077 TGCCACAGGCTGGAGTGCAGTGG - Intergenic
918165159 1:181938003-181938025 TCGCCAAGGCTGGAGGGCAGTGG + Intergenic
918231400 1:182536441-182536463 TACCAAAGGTTGGTGAGGATGGG - Intronic
918302781 1:183219126-183219148 TCCCAGAGGCTGTTGAGCAGAGG + Intronic
918393332 1:184089204-184089226 TATCAAAGACTGGTGGACTGTGG - Intergenic
918603525 1:186392963-186392985 AGCCAAAGGCTGGAGTGCAGTGG - Intronic
919111867 1:193230186-193230208 TCCCCCAGGCTGGAGGGCAGTGG + Intronic
919141785 1:193581853-193581875 TAACACAGGCTGGAGTGCAGTGG + Intergenic
921135320 1:212254583-212254605 TACCCCAGGCTGGAGTGCAGTGG - Intergenic
921248701 1:213275876-213275898 TACCAGAGGCTGCGGGCCAGGGG - Intergenic
921555380 1:216592538-216592560 TCACCAAGGCTGGTGTGCAGTGG + Intronic
921987737 1:221330433-221330455 TAGCATAGGCTGGAGTGCAGTGG - Intergenic
922150897 1:223003434-223003456 TAACAAAAGCTGCTGGACAGTGG + Exonic
922195344 1:223354995-223355017 TCCCCTAGGCTGGAGGGCAGTGG + Intronic
922793902 1:228328564-228328586 TAGCCCAGGCTGGAGGGCAGTGG + Intronic
923022071 1:230172676-230172698 TGCCAAAGGCAAGTGGTCAGGGG - Intronic
923054879 1:230418545-230418567 TACCACAGTCTGGAGTGCAGTGG + Intronic
923597045 1:235368596-235368618 CGCCCAAGGCTGGTGTGCAGTGG + Intronic
923929662 1:238680862-238680884 TCTCCAAGGCTGGAGGGCAGTGG - Intergenic
924042087 1:239993402-239993424 TAGCACAGGCTGGAGTGCAGTGG - Intergenic
924047850 1:240050844-240050866 GACCAAAGTCTGGGGGACAGTGG + Intronic
924162379 1:241246062-241246084 TCCCCCAGGCTGGAGGGCAGTGG - Intronic
924204050 1:241692909-241692931 CACCAAATGCTGGTGGGGTGTGG + Intronic
924272891 1:242352212-242352234 TACCAGAGGCTGGTGGGTAGAGG - Intronic
924284032 1:242466851-242466873 TACCGCAGGCTGGAGTGCAGTGG - Intronic
924307180 1:242701913-242701935 TGCCCAAAGCTGGAGGGCAGTGG + Intergenic
924324315 1:242880274-242880296 TAGCCTAGGCTGGAGGGCAGTGG + Intergenic
924350853 1:243113245-243113267 TACCAGAGGCTGGGTGGCTGGGG + Intergenic
924364929 1:243282884-243282906 TAGCACAGGCTGGAGTGCAGTGG + Intronic
924434618 1:244028163-244028185 TCCCCCAGGCTGGTGTGCAGTGG + Intergenic
924605833 1:245534200-245534222 TCCCCCAGGCTGGTGTGCAGTGG + Intronic
924854157 1:247858798-247858820 TAGCTCAGGCTGGAGGGCAGTGG + Intronic
1062872167 10:914759-914781 TAGCACAGGCTGGAGTGCAGTGG - Intronic
1063163012 10:3433555-3433577 TCCCCCAGGCTGGTGTGCAGTGG + Intergenic
1063298238 10:4827034-4827056 TCCCCAAGGCTGGAGTGCAGTGG - Intronic
1063377780 10:5564291-5564313 CACCAAAGGCTTGTAAGCAGAGG - Intergenic
1063468163 10:6261955-6261977 TCCCCAAGGCTGGAGTGCAGTGG - Intergenic
1064057195 10:12107455-12107477 TCCCTCAGGCTGGTGTGCAGTGG + Intronic
1064339531 10:14473926-14473948 TACCCCAGGGGGGTGGGCAGAGG - Intergenic
1064365444 10:14703366-14703388 TCCCCCAGGCTGGAGGGCAGTGG + Intronic
1064422482 10:15202669-15202691 TCACCCAGGCTGGTGGGCAGTGG - Intergenic
1065053075 10:21815783-21815805 TTGCACAGGCTGGAGGGCAGTGG + Intronic
1065546904 10:26830934-26830956 TACCCAAGGCTGGAATGCAGTGG + Intronic
1065551473 10:26872258-26872280 TAGCCCAGGCTGGAGGGCAGTGG + Intergenic
1065635812 10:27732785-27732807 TTCCTCAGGCTGGTGTGCAGTGG + Intronic
1065706773 10:28477742-28477764 TCCCCAAGGCTGGAGTGCAGTGG - Intergenic
1065767449 10:29043930-29043952 TTCCCAAGGCTGGGGTGCAGTGG + Intergenic
1065812938 10:29459147-29459169 TAACCCAGGCTGGAGGGCAGTGG + Intronic
1065898617 10:30185771-30185793 TCCCACAGGCTGGAGTGCAGTGG + Intergenic
1066318158 10:34270178-34270200 TCCCCCAGGCTGGAGGGCAGTGG + Intronic
1066318877 10:34279184-34279206 TCACAAAAGCTGGAGGGCAGTGG + Intronic
1066623376 10:37381280-37381302 TACCCTAGGCTGGAGTGCAGTGG - Intronic
1066684260 10:37965320-37965342 TTCCAAAGTATGGAGGGCAGTGG - Intronic
1066705348 10:38171662-38171684 TCCCATAGGCTGGAGTGCAGTGG - Intergenic
1066711823 10:38244451-38244473 TACCAGAGGCTGGTGGGTAGAGG + Intergenic
1067001862 10:42622678-42622700 TACCACAGGCTGGTGGGAATGGG + Intronic
1067001951 10:42623656-42623678 TACCATAGGCTGTTGGGAGGGGG + Intronic
1067005947 10:42662654-42662676 TACAACAGGCTGGAGGGCAGTGG + Intergenic
1067086988 10:43247723-43247745 TACCAGAAGCTGGTGGGTTGGGG + Intronic
1067364104 10:45609253-45609275 TAACCCAGGCTGGAGGGCAGTGG + Intergenic
1068344032 10:55747726-55747748 TCCCCCAGGCTGGAGGGCAGTGG + Intergenic
1068639668 10:59389156-59389178 TCTCCAAGGCTGGAGGGCAGTGG + Intergenic
1068641000 10:59407726-59407748 TACCAGAGGCTGACGGGTAGTGG - Intergenic
1068649483 10:59505656-59505678 TACCAAAGGTTGGTGGGAGGGGG + Intergenic
1068818726 10:61348235-61348257 TCCCCCAGGCTGGTGTGCAGTGG - Intergenic
1069086896 10:64151125-64151147 TACCAGAGGCTGGTGGGCAGAGG - Intergenic
1069299589 10:66889828-66889850 TCCCCAAGGCTGGAGTGCAGTGG + Intronic
1069538371 10:69273253-69273275 TAACACAGGCTGGAGTGCAGTGG + Intronic
1069692108 10:70360474-70360496 TAGCCAAGGCTGGAGTGCAGTGG + Intronic
1069883777 10:71610715-71610737 TGTGAAAGGCTGCTGGGCAGGGG - Intronic
1070189790 10:74101444-74101466 CACCCCAGGCTGGAGGGCAGTGG - Intronic
1070297868 10:75179305-75179327 TCCCCAAGGCTGGAGTGCAGTGG - Exonic
1070429115 10:76318457-76318479 CAGCAGAGGCTGGTGGGGAGGGG - Intronic
1070643936 10:78188416-78188438 TACCTCAGGCTGGAGTGCAGTGG - Intergenic
1070737343 10:78872304-78872326 TCCCCGAGGCTGGAGGGCAGTGG + Intergenic
1071123161 10:82303825-82303847 TCCCCCAGGCTGGTGTGCAGTGG - Intronic
1071146114 10:82574368-82574390 TACCAAAGGCTGGGAAGCATAGG + Intronic
1071201891 10:83228613-83228635 TACCAGAGGCAGGAGGACAGGGG + Intergenic
1071287216 10:84160014-84160036 TACCAGGGGCTGGTGGGTGGGGG + Intergenic
1071848289 10:89542340-89542362 TCCCACAGGCTGGAGTGCAGTGG + Intronic
1072099838 10:92218365-92218387 TAGCACAGGCTGGAGTGCAGTGG - Intronic
1072103105 10:92247867-92247889 AAACAAAGGATGGGGGGCAGTGG - Intronic
1072162463 10:92781297-92781319 TTGCCAAGGCTGGAGGGCAGTGG - Intergenic
1072482966 10:95827523-95827545 TAGCACAGGCTGGAGTGCAGTGG + Intronic
1072866743 10:99070664-99070686 TGCCAAAGGCTGGGGGCCTGGGG - Intronic
1072974553 10:100046430-100046452 TAGCCCAGGCTGGAGGGCAGTGG - Intronic
1073006580 10:100329797-100329819 CACCAAAAGCTTTTGGGCAGGGG - Intronic
1073007047 10:100332334-100332356 TACCAGAGGCTGGGGGTGAGGGG + Intergenic
1073211883 10:101810773-101810795 TGCCCAAGGCTGGAGTGCAGTGG + Intronic
1073410760 10:103339755-103339777 TTCCCCAGGCTGGAGGGCAGTGG - Intronic
1074803746 10:117027536-117027558 TAGCACAGGCTGGAGTGCAGTGG + Intronic
1074969289 10:118522434-118522456 TCCCCAAGGCTGGAGTGCAGTGG + Intergenic
1075151870 10:119940225-119940247 TCCCCAAGGCTGGAGTGCAGTGG + Intronic
1075325713 10:121530580-121530602 TTGCACAGGCTGGAGGGCAGTGG - Intronic
1075348285 10:121700907-121700929 TCCCCAAGGCTGGAGTGCAGTGG + Intergenic
1075388581 10:122075837-122075859 TGCCCAAGGCTGGAGTGCAGTGG + Intronic
1076061313 10:127416413-127416435 TACAAAGGGCTCATGGGCAGAGG - Intronic
1076061456 10:127417145-127417167 TACCAAGGGCTCTTGGGCATGGG + Intronic
1076342849 10:129761428-129761450 CACCAAAGGCTGGTGGGGGAGGG - Intronic
1076990415 11:270723-270745 TACCTTAGGCAGGTGGTCAGAGG + Intergenic
1077030424 11:463265-463287 TACCCCAGGCTGGAGTGCAGTGG + Intronic
1077072014 11:679273-679295 TCCCCCAGGCTGGAGGGCAGTGG - Intronic
1077097830 11:806620-806642 TCCCAGAGGCTGGAGTGCAGTGG + Intronic
1077362051 11:2145155-2145177 TGCAGAAGGCTGGTGGGAAGGGG - Intronic
1077381800 11:2246817-2246839 TACCTAAGGCTGGGGAGGAGGGG + Intergenic
1077580057 11:3411463-3411485 TTCCCAAGGCTGGAGTGCAGTGG + Intergenic
1077670112 11:4149558-4149580 CACCCAAGGCTGGAGAGCAGTGG - Intergenic
1077983800 11:7330734-7330756 TTCCCCAGGCTGGAGGGCAGTGG + Intronic
1078169976 11:8922331-8922353 TCACCCAGGCTGGTGGGCAGTGG - Intronic
1078455004 11:11468184-11468206 TTCCAAAGGCTGTGGGACAGAGG - Intronic
1078583138 11:12555484-12555506 TGCCAAAGGCTGGGGGGGTGGGG + Intergenic
1079077420 11:17392856-17392878 GCCCTAAGTCTGGTGGGCAGGGG - Intergenic
1079397447 11:20077398-20077420 TCCCAAAGAGTGGTGGGGAGTGG + Intronic
1079455702 11:20634322-20634344 TACCCAAGGCAGATGGGGAGCGG - Intronic
1079631475 11:22682833-22682855 AACCACAGGCTGGAGTGCAGTGG - Intronic
1079873319 11:25827524-25827546 TACCCCAGGCTGGAGTGCAGTGG - Intergenic
1079921840 11:26442562-26442584 AACCCAAGGCTGGTGTGCAAGGG + Intronic
1081027206 11:38030802-38030824 TAGCCCAGGCTGGAGGGCAGTGG + Intergenic
1081556066 11:44162534-44162556 TCCCCCAGGCTGGAGGGCAGTGG - Intronic
1081757684 11:45556338-45556360 GACAAGAGGGTGGTGGGCAGAGG + Intergenic
1081849877 11:46267749-46267771 TACCCCAGGCTGGAGTGCAGTGG - Intergenic
1081961406 11:47140460-47140482 TAGCCCAGGCTGGAGGGCAGTGG + Intronic
1083262881 11:61532616-61532638 AGGGAAAGGCTGGTGGGCAGAGG - Intronic
1083300950 11:61739402-61739424 TAGCACTGGCTGGGGGGCAGGGG - Intronic
1083444199 11:62696594-62696616 TCACAAAGGCTGGAGTGCAGTGG + Intronic
1083519525 11:63295634-63295656 TACCAAGGGCTTGTCTGCAGGGG + Intronic
1083548367 11:63565632-63565654 TAACCCAGGCTGGAGGGCAGTGG - Intergenic
1083768587 11:64854021-64854043 CAGCAAAGGCCGGGGGGCAGAGG + Exonic
1083913307 11:65723061-65723083 TAACCCAGGCTGGTGTGCAGTGG - Intergenic
1083971829 11:66082262-66082284 TCCCACAGGCTGGAGTGCAGTGG + Intronic
1084136531 11:67187612-67187634 TTGCCAAGGCTGGTGTGCAGTGG + Intronic
1084236978 11:67794290-67794312 TTCCCAAGGCTGGAGTGCAGTGG + Intergenic
1084239166 11:67806500-67806522 GTCCAAAGGCTGGGGGACAGAGG - Intergenic
1084283900 11:68119507-68119529 TGTCAAAGGCTGGAGTGCAGTGG + Intronic
1084953494 11:72679343-72679365 TACCCATGGCTGCTAGGCAGGGG + Intergenic
1085111611 11:73894782-73894804 TAACACAGGCTGGAGTGCAGTGG - Intronic
1085118400 11:73950571-73950593 TCACCCAGGCTGGTGGGCAGTGG - Exonic
1085553046 11:77393332-77393354 TACCCCAGGCTGGAGTGCAGTGG + Intronic
1085794505 11:79525669-79525691 TGCCAAAGGCTGAGGGGGAGGGG - Intergenic
1086320337 11:85640037-85640059 TACCAAAGGCTGGGGGAAATGGG + Intergenic
1086353752 11:85970761-85970783 TCCCCCAGGCTGGAGGGCAGTGG - Intronic
1086860584 11:91921016-91921038 TACCCCAGGCTGGAGTGCAGTGG + Intergenic
1086860640 11:91921463-91921485 TCCCCCAGGCTGGAGGGCAGTGG + Intergenic
1086977164 11:93147015-93147037 TAACTCAGGCTGGTGTGCAGTGG + Exonic
1087633317 11:100675996-100676018 TACCCCAGGCTGGAGTGCAGTGG - Intergenic
1087801763 11:102512306-102512328 TACCTCAGGCTGGAGTGCAGTGG + Intergenic
1088125063 11:106414470-106414492 AACCAAATGCTGATGGCCAGGGG - Intergenic
1088321050 11:108554882-108554904 CACCCAAGGCTGGAGTGCAGTGG - Intronic
1088587789 11:111375434-111375456 TACCCCAGGCTGGAGTGCAGTGG + Intronic
1088692679 11:112341464-112341486 TACCCCAGGCTGGAGTGCAGTGG + Intergenic
1088886192 11:114008912-114008934 TTGCCCAGGCTGGTGGGCAGTGG + Intergenic
1088948805 11:114543479-114543501 TACCCCAGGCTGGAGTGCAGTGG - Intronic
1089033683 11:115361764-115361786 TACCCTAGGCTGGAGTGCAGTGG + Intronic
1089232062 11:116986948-116986970 TGCCAGAGGCTGGAGGGAAGGGG + Intronic
1089487382 11:118857479-118857501 TACCCCAGGCTGGAGTGCAGTGG + Intergenic
1089925340 11:122251204-122251226 TCCCACAGGCTGGAGTGCAGTGG - Intergenic
1090152500 11:124400481-124400503 TACCAGAGGCTGGGGGTGAGGGG - Intergenic
1090346951 11:126079236-126079258 TAGCCCAGGCTGGAGGGCAGTGG - Intergenic
1090819365 11:130327287-130327309 TACTAGGGGCTGGGGGGCAGGGG - Intergenic
1090941900 11:131394358-131394380 GGCAAAAGGCTGGGGGGCAGGGG - Intronic
1091249447 11:134129960-134129982 TAACCAAGGCTGGAGTGCAGTGG - Intronic
1091520933 12:1241896-1241918 TCCCCAAGGCTGGAGTGCAGTGG + Intronic
1091568991 12:1668186-1668208 TCACACAGGCTGGAGGGCAGCGG + Intergenic
1091574446 12:1720326-1720348 TTCCATGGACTGGTGGGCAGGGG + Intronic
1091758065 12:3068444-3068466 TTGCAAAGGCTGGAGTGCAGTGG + Intergenic
1092142970 12:6196730-6196752 TCCCCCAGGCTGGAGGGCAGTGG + Intergenic
1092284155 12:7119211-7119233 TCCCAAGGGCTGGGGGGTAGGGG + Intergenic
1092375434 12:7951620-7951642 TACCCTAGGCTGGAGTGCAGTGG - Intergenic
1092409851 12:8244129-8244151 GTCCAAAGGCTGGGGGACAGAGG - Intergenic
1092448711 12:8582309-8582331 TTCCCCAGGCTGGAGGGCAGTGG - Intergenic
1092610260 12:10165221-10165243 TCCCCCAGGCTGGAGGGCAGTGG - Intronic
1092838233 12:12512485-12512507 TACCAGGGGCTGGAGGGCTGGGG - Intronic
1093437018 12:19147774-19147796 TGCCCAAGGCTGGAGTGCAGTGG + Intronic
1093789270 12:23229050-23229072 TACCCCAGGCTGGAGTGCAGTGG + Intergenic
1094535298 12:31316128-31316150 TCCCCAAGGCTGGAGTGCAGTGG - Intronic
1095376316 12:41533212-41533234 TCCCCCAGGCTGGAGGGCAGTGG + Intronic
1095444500 12:42270626-42270648 TTGCAAAGGCTGGAGTGCAGTGG - Intronic
1095584324 12:43834051-43834073 TACCCCAGGCTGGAGTGCAGTGG - Intergenic
1095849852 12:46790415-46790437 CACAAAAGAGTGGTGGGCAGTGG - Intronic
1096014436 12:48256118-48256140 TCACCAAGGCTGGAGGGCAGTGG + Intergenic
1096019046 12:48307000-48307022 TACCAAAGGCTGGAGTGCAGTGG - Intergenic
1096055260 12:48645404-48645426 TCCCCCAGGCTGGTGTGCAGTGG - Intergenic
1096145430 12:49275601-49275623 TCCCTTAGGCTGGAGGGCAGTGG - Intergenic
1096158547 12:49357043-49357065 TTGCACAGGCTGGTGTGCAGTGG + Intronic
1096307204 12:50488153-50488175 TACCCCAGGCTGGAGTGCAGTGG - Intergenic
1096357886 12:50957843-50957865 TGCCCAAGGCTGGAGTGCAGTGG - Intronic
1097152159 12:56987111-56987133 TACCCAGGGCTGCTGGGAAGGGG + Intergenic
1097160670 12:57044426-57044448 TCACACAGGCTGGAGGGCAGTGG + Intronic
1097316647 12:58178382-58178404 TAGCAAAAGCTGGGGGGCAGAGG + Intergenic
1097626803 12:62010823-62010845 GACGAAGGGCTGCTGGGCAGAGG - Intronic
1098032871 12:66272463-66272485 TCGCAAAGGCTGGAGCGCAGTGG + Intergenic
1098254298 12:68600832-68600854 AGCCCAAGGCTGGAGGGCAGTGG - Intergenic
1098268037 12:68743360-68743382 TCCCCAAGGCTGGAGTGCAGTGG - Exonic
1098277381 12:68826607-68826629 TACCCCAGGCTGGAGTGCAGTGG - Intronic
1098340505 12:69445726-69445748 TCACACAGGCTGGAGGGCAGTGG - Intergenic
1098555575 12:71815221-71815243 TGCCCAAGGCTGGAGTGCAGTGG + Intergenic
1098887724 12:75977233-75977255 CACCCAAGGCTGGAGGCCAGTGG + Intergenic
1098905122 12:76154133-76154155 TCACCAAGGCTGGAGGGCAGTGG + Intergenic
1098990148 12:77057090-77057112 TAACCCAGGCTGGAGGGCAGTGG + Intronic
1099020718 12:77400986-77401008 TCCCCAAGGCTGGAGTGCAGTGG + Intergenic
1099431499 12:82591567-82591589 TTGCACAGGCTGGAGGGCAGTGG - Intergenic
1099688406 12:85919690-85919712 TCACACAGGCTGGAGGGCAGTGG + Intergenic
1100041469 12:90323971-90323993 CACTAAAGGGTGCTGGGCAGAGG + Intergenic
1100276888 12:93079736-93079758 TACCAGGGGCTGGGGGGAAGAGG + Intergenic
1100486097 12:95029120-95029142 TGCCCAAGGCTGGAGTGCAGTGG + Intronic
1100582993 12:95953619-95953641 TCACCAAGGCTGGAGGGCAGTGG + Intronic
1101354430 12:103964190-103964212 TAGCCCAGGCTGGAGGGCAGTGG + Intronic
1101476298 12:105051822-105051844 TAGCACAGGCTGGAGTGCAGTGG + Intronic
1101776432 12:107798844-107798866 TACCAGAGGCTTGGGGGCAGGGG + Intergenic
1102039436 12:109791339-109791361 TCACCAAGGCTGGAGGGCAGTGG - Intronic
1102218657 12:111179714-111179736 TACCCCAGGCTGGAGTGCAGTGG + Intronic
1102420155 12:112797008-112797030 TACCCTAGGCTGGAGTGCAGTGG - Intronic
1102473176 12:113171562-113171584 TACCCCAGGCTGGAGTGCAGGGG - Intronic
1102537651 12:113593100-113593122 TGCCCCAGGCTGGAGGGCAGTGG - Intergenic
1102639642 12:114355688-114355710 GACCACAGGCTGGTGGGCCACGG + Exonic
1102860827 12:116335135-116335157 TGCCCCAGGCTGGAGGGCAGTGG + Intergenic
1103105506 12:118221261-118221283 TAGCAAAGGCTGGAGTGAAGAGG + Intronic
1103258660 12:119565291-119565313 TCTCCAAGGCTGGAGGGCAGTGG - Intergenic
1103273061 12:119689340-119689362 TACCCCAGGCTGGAGTGCAGTGG - Intronic
1103691482 12:122778312-122778334 TCCCACAGGCTGGAGTGCAGTGG - Intronic
1103759816 12:123240771-123240793 TACCCCAGGCTGGAGTGCAGTGG + Intronic
1104068264 12:125323556-125323578 CACCCAAGGCTGGAGTGCAGTGG + Intronic
1104101827 12:125619735-125619757 GACCACAGGCTGCTGGACAGGGG + Intronic
1104141233 12:125987999-125988021 TAGCCAAGGCTGGAGTGCAGTGG + Intergenic
1104189616 12:126467368-126467390 TCCCAAGGGGTGGTGGGAAGGGG + Intergenic
1104581649 12:130015298-130015320 TGCCCAAGGCTGGAGTGCAGTGG + Intergenic
1104591607 12:130088468-130088490 CACCAAAGGCCGGTGGGAGGCGG + Intergenic
1104660561 12:130608935-130608957 TACCAGAGGCTGGGGTGCTGGGG - Intronic
1104761912 12:131301814-131301836 TTCCCCAGGCTGGAGGGCAGTGG - Intergenic
1104817863 12:131658970-131658992 TTCCCCAGGCTGGAGGGCAGTGG + Intergenic
1105016724 12:132790292-132790314 TACCCCAGGCTGGAGGGCAGTGG - Intronic
1105203196 13:18195922-18195944 TCTCCAAGGCTGGAGGGCAGTGG + Intergenic
1105309997 13:19198126-19198148 TCCCCCAGGCTGGAGGGCAGTGG - Intergenic
1105334733 13:19456415-19456437 CACCACAGGCTGGAGTGCAGTGG - Intronic
1105365322 13:19758793-19758815 TAGCACAGGCTGGAGTGCAGTGG - Intronic
1105399194 13:20072946-20072968 TCGCACAGGCTGGTGTGCAGTGG + Intronic
1105554402 13:21432367-21432389 TAGCCCAGGCTGGTGTGCAGTGG + Intronic
1105666881 13:22569514-22569536 TACCCCAGGCTGGAGTGCAGTGG + Intergenic
1105860186 13:24402913-24402935 CACCACAGGCTGGAGTGCAGTGG + Intergenic
1106024310 13:25942460-25942482 TACCCTAGGCTGGAGTGCAGTGG + Intronic
1106086340 13:26545643-26545665 TTTCAAAGGCTAGAGGGCAGTGG + Intergenic
1106379980 13:29227217-29227239 TTGCAAAGGCTGGAGTGCAGTGG - Intronic
1106732850 13:32559784-32559806 TGCCCCAGGCTGGAGGGCAGTGG - Intergenic
1106743180 13:32669696-32669718 TATCAAAAGCTGGGGAGCAGGGG + Intronic
1106858745 13:33881747-33881769 CATCAAAGCCTGATGGGCAGAGG - Intronic
1107150525 13:37105586-37105608 TACCAACGGCTGTGGGCCAGAGG + Exonic
1107488832 13:40859988-40860010 CACCACAGGCTGGAGGGCAGTGG - Intergenic
1107488982 13:40861635-40861657 CACCACAGGCTGGAGTGCAGTGG - Intergenic
1107512961 13:41103407-41103429 TACCCCAGGCTGGAGTGCAGTGG + Intergenic
1107735662 13:43396417-43396439 TAGCCCAGGCTGGAGGGCAGTGG + Intronic
1107879997 13:44824542-44824564 TACCCCAGGCTGGAGTGCAGTGG + Intergenic
1107946731 13:45425730-45425752 TCCCCCAGGCTGGAGGGCAGTGG + Intergenic
1108002438 13:45916567-45916589 TAGCCCAGGCTGGAGGGCAGTGG + Intergenic
1108186409 13:47892582-47892604 TCCCAGAGGCAGGAGGGCAGTGG - Intergenic
1108347701 13:49562650-49562672 TCACAAAGGCTGGAGTGCAGTGG + Intronic
1109178539 13:59185303-59185325 TTGCCAAGGCTGGAGGGCAGTGG + Intergenic
1109521138 13:63511950-63511972 CGCCAAGGGCTGGTGGGAAGTGG + Intergenic
1109761356 13:66834195-66834217 TTGCCAAGGCTGGAGGGCAGTGG + Intronic
1109993413 13:70088641-70088663 TACCCCAGGCTGGAGTGCAGTGG - Intronic
1110205876 13:72912522-72912544 TACCAAATGTTGGTGAGAAGTGG + Intronic
1110431175 13:75425794-75425816 TACCAGAGGCTGGAGTGTAGAGG + Intronic
1111026904 13:82539106-82539128 TCCCCCAGGCTGGTGTGCAGTGG + Intergenic
1111256326 13:85673975-85673997 TACCAGAGGCTGGTGGAGAAGGG + Intergenic
1111499372 13:89095438-89095460 TACCCCAGGCTGGAGTGCAGTGG - Intergenic
1111502364 13:89138579-89138601 TACCCCAGGCTGGAGTGCAGTGG + Intergenic
1111518946 13:89374305-89374327 TAGCCCAGGCTGGAGGGCAGTGG + Intergenic
1111659064 13:91186767-91186789 TACCCCAGGCTGGAGCGCAGTGG - Intergenic
1111851072 13:93575249-93575271 TACCCCAGGCTGGAGTGCAGTGG - Intronic
1111923034 13:94432367-94432389 TGCCAGAGGCTGGTGGGAGGAGG + Intergenic
1111925829 13:94462458-94462480 TCACTAAGGCTGGAGGGCAGTGG - Intronic
1112012556 13:95304093-95304115 TAGCCCAGGCTGGAGGGCAGTGG - Intergenic
1112175737 13:97022050-97022072 TGCCACAGGCTGGAGGGCAGTGG + Intergenic
1112483940 13:99802746-99802768 GACCCAAGGATGCTGGGCAGAGG - Intronic
1112867385 13:103922308-103922330 TTCCCCAGGCTGGAGGGCAGTGG + Intergenic
1113004350 13:105681658-105681680 TTCCCCAGGCTGGAGGGCAGTGG + Intergenic
1113665344 13:112137168-112137190 TAGCAGACGCTGGAGGGCAGAGG + Intergenic
1113760039 13:112840580-112840602 GAGCAAAGGCTGGAGGGCATGGG - Intronic
1114242986 14:20886508-20886530 TATCCCAGGCTGGAGGGCAGTGG + Intergenic
1114486489 14:23065545-23065567 TACCCTAGGCTGGAGTGCAGTGG - Intronic
1114509685 14:23248147-23248169 TCACAAAGGCTGGAGTGCAGTGG + Intronic
1114619830 14:24088843-24088865 TCCCCCAGGCTGGAGGGCAGTGG + Intronic
1114918902 14:27301482-27301504 TAGCACAGGCTGGAGTGCAGTGG - Intergenic
1115218950 14:31040189-31040211 TCCCCAAGGCTGGAGTGCAGTGG + Intronic
1115573253 14:34686877-34686899 TCCCCCAGGCTGGAGGGCAGTGG + Intergenic
1115596877 14:34917820-34917842 CACCCAAGGCTGGAGTGCAGTGG - Intergenic
1115853896 14:37609374-37609396 TCACCCAGGCTGGTGGGCAGTGG - Intronic
1115998729 14:39220077-39220099 TACCCCAGGCTGGAGTGCAGTGG - Intergenic
1116131235 14:40857244-40857266 TACCAAAGGGTGATGTGCTGGGG + Intergenic
1116233307 14:42246295-42246317 CACCCCAGGCTGGAGGGCAGTGG + Intergenic
1116791937 14:49348437-49348459 TTCCCCAGGCTGGGGGGCAGTGG - Intergenic
1116881953 14:50179422-50179444 TACCCAAGGCTGGAGTGCAGTGG + Intronic
1116883579 14:50196137-50196159 TACCAGAGGCTGAAGGGAAGGGG + Intronic
1117102985 14:52369432-52369454 TTCTAGTGGCTGGTGGGCAGTGG + Intergenic
1117445057 14:55796286-55796308 TGCCACAGGCTGCGGGGCAGAGG + Intergenic
1117505781 14:56401471-56401493 TGCCAAAGGCAGGAGTGCAGTGG - Intergenic
1117617713 14:57550745-57550767 TACCAGAGCCTGTTGGGGAGTGG - Intergenic
1117676989 14:58165458-58165480 TCACCAAGGCTGGAGGGCAGTGG - Intronic
1117835459 14:59800438-59800460 TCCCCCAGGCTGGAGGGCAGTGG + Intronic
1118397808 14:65352531-65352553 TCCCCAAGGCTGGAGTGCAGTGG - Intergenic
1118571474 14:67199713-67199735 TACCACAGGATTGGGGGCAGAGG - Intronic
1118802161 14:69200667-69200689 TCGCAAAGGCTGGAGTGCAGTGG - Intronic
1118853549 14:69603716-69603738 GACCTAAGGTTGGAGGGCAGAGG + Intergenic
1119251428 14:73158363-73158385 GAGCAAAGGCTGGAGTGCAGTGG + Intronic
1119275854 14:73354786-73354808 TAGCACAGGCTGGAGTGCAGTGG - Intronic
1119579906 14:75768604-75768626 TACTAAAGGAAGGTGGGAAGAGG + Intronic
1120087298 14:80287759-80287781 TTGCAAAGGCTGGAGTGCAGTGG - Intronic
1120138866 14:80904322-80904344 TACCAGAGGGTGGCGGGGAGAGG + Intronic
1120301147 14:82708632-82708654 TAGGAAAGGGTGGTGGGAAGGGG + Intergenic
1121565214 14:94904258-94904280 GCCCAAAGGCTGGGGGGCAAGGG + Intergenic
1121653777 14:95579755-95579777 TCCCCAAGGCTGGAGAGCAGTGG - Intergenic
1121733034 14:96199532-96199554 TCCCCCAGGCTGGAGGGCAGTGG - Intergenic
1121800710 14:96771829-96771851 TCACCAAGGCTGGTGTGCAGTGG - Intergenic
1121873151 14:97427535-97427557 TACAAAAGCATGGTGGGCAGTGG - Intergenic
1121911950 14:97799746-97799768 TACCAGAGGCTGGAGGGCAGGGG + Intergenic
1122073253 14:99219079-99219101 TGCCCAAGGCTGGAGTGCAGTGG + Intronic
1122307519 14:100775374-100775396 TACCAACATCTGGTGAGCAGAGG + Intergenic
1122508933 14:102250342-102250364 TGCCAAAGGCTGGGGGGGAGTGG + Intronic
1122547416 14:102531658-102531680 TTGCCAAGGCTGGAGGGCAGTGG + Intergenic
1122567367 14:102669988-102670010 TACCCCAGGCTGGAGTGCAGTGG + Intronic
1122614543 14:103008039-103008061 GATCAAAGCCTGCTGGGCAGTGG + Intronic
1122730899 14:103796915-103796937 TCCCACAGGCTGGAGTGCAGTGG - Intronic
1202870104 14_GL000225v1_random:154763-154785 TCCCACAGGCTGGAGTGCAGTGG - Intergenic
1123459087 15:20452095-20452117 TACCAGGGGCTGGAGAGCAGGGG + Intergenic
1123508210 15:20967471-20967493 TAACTAAGGCTGGAGGGAAGAGG + Intergenic
1123565430 15:21541218-21541240 TAACTAAGGCTGGAGGGAAGAGG + Intergenic
1123601694 15:21978507-21978529 TAACTAAGGCTGGAGGGAAGAGG + Intergenic
1123658974 15:22548323-22548345 TACCAGGGGCTGGAGAGCAGGGG - Intergenic
1123671012 15:22657171-22657193 TAGCCAAGGCTGGAGTGCAGTGG - Intergenic
1124265325 15:28227939-28227961 TACCAGGGGCTGGAGGGCAGAGG + Intronic
1124312839 15:28642815-28642837 TACCAGGGGCTGGAGAGCAGGGG - Intergenic
1124485370 15:30109892-30109914 TCACATAGGCTGGAGGGCAGTGG - Intergenic
1124518207 15:30387373-30387395 TCACATAGGCTGGAGGGCAGTGG + Intronic
1124540446 15:30578880-30578902 TCACATAGGCTGGAGGGCAGTGG - Intergenic
1124758207 15:32428703-32428725 TCACATAGGCTGGAGGGCAGTGG + Intergenic
1124799809 15:32821490-32821512 CACCCCAGGCTGGAGGGCAGTGG + Intronic
1124953029 15:34340906-34340928 TACCCCAGGCTGGAGTGCAGTGG - Intergenic
1124993538 15:34699602-34699624 TCACACAGGCTGGAGGGCAGTGG - Intergenic
1125692623 15:41608733-41608755 TCGCCCAGGCTGGTGGGCAGTGG + Intergenic
1125830558 15:42714100-42714122 TCCCCCAGGCTGGAGGGCAGTGG + Intronic
1125855111 15:42941000-42941022 TCACACAGGCTGGAGGGCAGTGG + Intergenic
1126652312 15:50936898-50936920 TAGCAAAGGCTAGAGTGCAGTGG - Intronic
1127104934 15:55603532-55603554 TCCCCAAGGCTGGAGTGCAGTGG - Intergenic
1127455248 15:59150971-59150993 TACCCAAGACTGGGGGGTAGTGG + Intronic
1127549538 15:60023316-60023338 TTGCCAAGGCTGGAGGGCAGTGG - Intronic
1127589920 15:60412594-60412616 TCCCCCAGGCTGGAGGGCAGTGG + Intergenic
1128161419 15:65425150-65425172 TCCCCCAGGCTGGAGGGCAGTGG + Intergenic
1128201276 15:65810495-65810517 TTGCCCAGGCTGGTGGGCAGTGG + Intronic
1128201283 15:65810525-65810547 TCGCCCAGGCTGGTGGGCAGTGG + Intronic
1128430794 15:67591412-67591434 TAGCCCAGGCTGGTGTGCAGTGG + Intronic
1128967858 15:72078450-72078472 TCCCACAGGCTGGAGTGCAGTGG - Intronic
1128973740 15:72132693-72132715 TCCCCCAGGCTGGAGGGCAGTGG + Intronic
1129026425 15:72578854-72578876 TCCCCAAGGCTGGAGTGCAGTGG + Intronic
1129305766 15:74660368-74660390 TCCCCAAGGCTGGAGTGCAGTGG - Intronic
1129365395 15:75050941-75050963 TCCCCAAGGCTGGAGTGCAGTGG + Intronic
1129436918 15:75548996-75549018 TAACCAAGGCTGGAGTGCAGTGG + Intronic
1130088840 15:80802321-80802343 CATCAACGGCTGCTGGGCAGGGG + Intronic
1130343157 15:83016305-83016327 TTGCCAAGGCTGGAGGGCAGTGG - Intergenic
1130519205 15:84649507-84649529 TAGCCCAGGCTGGAGGGCAGTGG + Intronic
1130570599 15:85039919-85039941 TACCAGAGGCTGGAGGGTAGGGG + Intronic
1131096735 15:89660156-89660178 TCCCACAGGCTGGAGTGCAGTGG - Intergenic
1131142633 15:89989987-89990009 TTGCACAGGCTGGAGGGCAGTGG + Intergenic
1131208895 15:90475973-90475995 TACCCCAGGCTGGAGTGCAGTGG + Intronic
1131627868 15:94143001-94143023 TACCCCAGGCTGGAGTGCAGTGG - Intergenic
1132023045 15:98381353-98381375 CACCAATAACTGGTGGGCAGTGG + Intergenic
1132152116 15:99469522-99469544 AACCAAGGGTTGGGGGGCAGGGG - Intergenic
1132324246 15:100953953-100953975 TCCCCCAGGCTGGAGGGCAGTGG + Intronic
1202973802 15_KI270727v1_random:268308-268330 TAACTAAGGCTGGAGGGAAGAGG + Intergenic
1132593657 16:738127-738149 TGCCACAGGGTGCTGGGCAGAGG + Intronic
1132601112 16:773446-773468 TGCCAAAGGCTGGAGAGCAGTGG + Intronic
1132821827 16:1876917-1876939 TCACAAAGGCTGGAGTGCAGTGG + Intronic
1132871101 16:2116110-2116132 TACCATGACCTGGTGGGCAGGGG + Exonic
1133350834 16:5098912-5098934 GTCCAAAGGCTGGGGGACAGAGG - Intergenic
1133407145 16:5533856-5533878 TCCCAAAGAGAGGTGGGCAGGGG + Intergenic
1134149011 16:11791030-11791052 TACCCCAGGCTGGAGTGCAGTGG - Intronic
1134156534 16:11848562-11848584 TACCCAAGGCTGCAGTGCAGTGG + Intronic
1134223202 16:12371336-12371358 TCCCTCAGGCTGGAGGGCAGTGG + Intronic
1134419580 16:14072643-14072665 TAGCCCAGGCTGGAGGGCAGTGG - Intronic
1134521433 16:14920784-14920806 TACCATGACCTGGTGGGCAGGGG - Intronic
1134605607 16:15568869-15568891 TAACACAGCCTGATGGGCAGGGG - Intronic
1134709104 16:16319435-16319457 TACCATGACCTGGTGGGCAGGGG - Intergenic
1134716313 16:16359464-16359486 TACCATGACCTGGTGGGCAGGGG - Intergenic
1134786141 16:16945579-16945601 TATCCCAGGCTGGAGGGCAGTGG + Intergenic
1134950501 16:18349210-18349232 TACCATGACCTGGTGGGCAGGGG + Intergenic
1134958437 16:18392695-18392717 TACCATGACCTGGTGGGCAGGGG + Intergenic
1135003242 16:18795054-18795076 TCACAAAGGCTGGAGTGCAGTGG + Intronic
1135035900 16:19076632-19076654 TCCCCAAGGCTGGAGTGCAGTGG + Intronic
1135163359 16:20116810-20116832 TAGCCCAGGCTGGAGGGCAGTGG + Intergenic
1135423394 16:22319436-22319458 TCCCACAGGCTGGAGTGCAGTGG + Intronic
1135594946 16:23734740-23734762 TCCCACAGGCTGGAGTGCAGTGG + Intergenic
1135641352 16:24122497-24122519 TCACCCAGGCTGGTGGGCAGTGG + Intronic
1136016797 16:27405825-27405847 TTCCCCAGGCTGGGGGGCAGGGG + Intronic
1136173028 16:28499612-28499634 TTCTAAAGGGTGGGGGGCAGGGG + Exonic
1136178641 16:28535967-28535989 TCCCAAAGGCTGGAAGGCTGAGG + Intronic
1136360580 16:29776767-29776789 TCCCTCAGGCTGGAGGGCAGTGG - Intergenic
1136388532 16:29946307-29946329 TGACAAATGTTGGTGGGCAGGGG - Intronic
1136390021 16:29958136-29958158 TCACCCAGGCTGGTGGGCAGTGG - Intronic
1136421965 16:30140314-30140336 TACCGGAGGCTGGAGTGCAGTGG + Intergenic
1136448615 16:30339415-30339437 TAGCCAAGGCTGGAGTGCAGTGG - Intergenic
1136493382 16:30625583-30625605 TACCCTAGGCTGGAGTGCAGTGG - Intergenic
1136590016 16:31212905-31212927 TACCCCAGGCTGGAGTGCAGTGG + Intergenic
1136903270 16:34063810-34063832 TCACAAAGGCTGGAGTGCAGTGG - Intergenic
1137267115 16:46878183-46878205 TACCAAGGGCTGGGGGGAGGCGG - Intergenic
1137403482 16:48172045-48172067 TACCAAGGGCTGGTGGGGAGGGG - Intronic
1137670546 16:50275885-50275907 TACCCAAGGGTGGTGGGCGGGGG - Intronic
1138176134 16:54899910-54899932 TCCCCAAGGCTGGAGTGCAGTGG - Intergenic
1138629461 16:58281880-58281902 TCCCCAAGGCTGGAGTGCAGTGG + Exonic
1138666288 16:58571927-58571949 TCCCCCAGGCTGGTGTGCAGTGG - Intronic
1139115755 16:63949497-63949519 TCACAAAGGCTGGAGTGCAGAGG - Intergenic
1139368968 16:66453396-66453418 TTCAAAAGGCTGGAGTGCAGTGG + Intronic
1139497013 16:67327049-67327071 TACCTGAGGCTGGGGGGCGGGGG + Intronic
1139599163 16:67976286-67976308 TGACTAGGGCTGGTGGGCAGCGG - Intronic
1139628392 16:68210429-68210451 TCACCAAGGCTGGTGTGCAGTGG - Intronic
1139650497 16:68359816-68359838 TCTTAAAGGCAGGTGGGCAGAGG + Exonic
1139859598 16:70010282-70010304 TCCCCAAGGCTGGAGTGCAGTGG + Intergenic
1139892341 16:70261556-70261578 TAGCCAAGGCTGGAGTGCAGTGG - Intronic
1140021978 16:71247376-71247398 TACCCCAGGCTGGAGTGCAGAGG - Intergenic
1140583629 16:76260871-76260893 TACCAGAGGCTGGTTACCAGAGG - Intergenic
1140699435 16:77567553-77567575 TCCCTAAGGCTGGAGTGCAGTGG + Intergenic
1140804996 16:78525223-78525245 TCCCCCAGGCTGGTGTGCAGTGG + Intronic
1141093033 16:81143433-81143455 TCCCACAGGCTGGAGTGCAGTGG + Intergenic
1141223132 16:82090355-82090377 TTCGAAAGGCTGGAGTGCAGTGG + Intronic
1141588980 16:85054960-85054982 TTACAAAGGCTGGAGTGCAGTGG + Intronic
1141600842 16:85125323-85125345 TGCCTGAGGCTGGGGGGCAGGGG + Intergenic
1141974638 16:87507405-87507427 TTCCACAGGGTGGTGGGCCGAGG + Intergenic
1142097598 16:88250915-88250937 TCCCACAGGCTGGAGTGCAGCGG + Intergenic
1142333651 16:89472557-89472579 TCCCCCAGGCTGGAGGGCAGTGG + Intronic
1142357723 16:89610965-89610987 TTGCCAAGGCTGGAGGGCAGTGG + Intergenic
1142376913 16:89711277-89711299 TGCCCAAGGCCGGTGCGCAGGGG + Intronic
1142413627 16:89929000-89929022 TCCCACAGGCTGGTGTGCAGTGG + Intronic
1142423531 16:89988102-89988124 TCACCCAGGCTGGTGGGCAGTGG - Intergenic
1142558206 17:793892-793914 TCCCAAAGGCTGGTGCAGAGAGG + Intergenic
1142659624 17:1418893-1418915 TGCCCCAGGCTGGAGGGCAGTGG - Intergenic
1143120752 17:4605199-4605221 TACCCCAGGCTGGAGTGCAGTGG + Intronic
1143388208 17:6544490-6544512 TTCCCCAGGCTGGAGGGCAGTGG - Intronic
1143810378 17:9466928-9466950 TCCCCCAGGCTGGAGGGCAGTGG + Intronic
1143899437 17:10162826-10162848 TACCAGGGGCTGGCGGGGAGAGG + Intronic
1144037790 17:11382975-11382997 CACCTAAGGCTGGAGTGCAGTGG + Intronic
1144042302 17:11422721-11422743 TACCCCAGGCTGGAGTGCAGTGG - Intronic
1144295829 17:13874079-13874101 TACCACAGGCTGGGGGGCATAGG - Intergenic
1144311917 17:14021782-14021804 TACCAGGGGCTGGGAGGCAGGGG - Intergenic
1144332842 17:14239537-14239559 TACCAGGGGCTGGGAGGCAGGGG + Intergenic
1144479920 17:15620919-15620941 TCCCCCAGGCTGGAGGGCAGTGG + Intronic
1144543609 17:16170799-16170821 TACCCCAGGCTGGAGTGCAGTGG - Intronic
1144704390 17:17357657-17357679 TCGCAAAGGCTGGAGTGCAGTGG + Intergenic
1144717534 17:17444930-17444952 TTCCCCAGGCTGGAGGGCAGTGG - Intergenic
1144782498 17:17815061-17815083 TCCCACAGGCTGGTGGGGAGAGG + Intronic
1144918381 17:18742823-18742845 TCCCCCAGGCTGGAGGGCAGTGG - Intergenic
1145096600 17:20034135-20034157 CACCCAAGGCTGGAGTGCAGTGG + Intronic
1145177523 17:20713837-20713859 TACCCCAGGCTGGAGTGCAGTGG + Intergenic
1145187873 17:20811325-20811347 TCCCCAAGGCTGGAGTGCAGTGG - Intergenic
1145214377 17:21041556-21041578 TACCCCAGGCTGGAGTGCAGTGG - Intronic
1145220297 17:21083102-21083124 TTGCAAAGGCTGGAGTGCAGTGG + Intergenic
1145844901 17:28030184-28030206 TCACACAGGCTGGAGGGCAGTGG + Intergenic
1145958140 17:28869180-28869202 TTCCACAGGCTGGAGTGCAGTGG + Intergenic
1145994033 17:29095504-29095526 GGCCAAAGGCTGGTGCCCAGAGG - Intronic
1146095421 17:29925667-29925689 TAGCACAGGCTGGAGTGCAGTGG - Intronic
1146121801 17:30202050-30202072 TACCCCAGGCTGGAGTGCAGTGG - Intronic
1146173135 17:30648096-30648118 TCACACAGGCTGGTGTGCAGTGG - Intergenic
1146251096 17:31345081-31345103 TCACAAAGGCTGGAGTGCAGTGG - Intronic
1146346595 17:32064129-32064151 TCACACAGGCTGGTGTGCAGTGG - Intergenic
1146431516 17:32800530-32800552 TACCAGAGGCTGGAGACCAGGGG + Intronic
1146501736 17:33370487-33370509 AAGCAAAGGCTGGAGGGGAGGGG + Intronic
1146774774 17:35604145-35604167 TTCCTCAGGCTGGTGTGCAGTGG + Intronic
1146816947 17:35950006-35950028 TCTGAAAGGCAGGTGGGCAGAGG + Intergenic
1146913789 17:36665217-36665239 TGACAGAGGCAGGTGGGCAGGGG + Intergenic
1147117985 17:38316707-38316729 TAGCCCAGGCTGGAGGGCAGTGG + Intronic
1147177270 17:38663675-38663697 CACCACAGGCTGGAGTGCAGTGG + Intergenic
1147211834 17:38876398-38876420 TACCCCAGGCTGGAGTGCAGTGG + Intronic
1147231971 17:39026203-39026225 CACCCAAGGCTGGAGTGCAGTGG - Intergenic
1147454058 17:40524137-40524159 TAATGAAGGCTGGTGGGCATGGG - Intergenic
1147457683 17:40548600-40548622 TCACAGAGGCTGGGGGGCAGAGG - Intergenic
1147785858 17:42978365-42978387 TAGCACAGGCTGGAGTGCAGTGG - Intronic
1147815742 17:43208925-43208947 TTCCCCAGGCTGGTGTGCAGTGG - Intronic
1147822516 17:43250066-43250088 CACCCAAGGCTGGAGTGCAGTGG + Intergenic
1147856772 17:43486834-43486856 TCACTAAGGCTGGAGGGCAGTGG - Intronic
1147931979 17:43987419-43987441 TACAAAAGGCATCTGGGCAGGGG + Intronic
1148219821 17:45853443-45853465 TCACCAAGGCTGGTGTGCAGTGG + Intergenic
1148539255 17:48466800-48466822 TTGCAAAGGCTGGAGTGCAGTGG - Intergenic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1148997142 17:51720745-51720767 TACCAGAGGTTGGTGGAGAGAGG + Intronic
1149309594 17:55381346-55381368 TCCCCAAGGCTGGAGTGCAGTGG + Intergenic
1149522810 17:57330945-57330967 TACCCCAGGCTGGAGTGCAGTGG + Intronic
1149528530 17:57376958-57376980 TCCCCCAGGCTGGAGGGCAGTGG + Intronic
1149759215 17:59214448-59214470 TTGCACAGGCTGGAGGGCAGTGG + Intronic
1149818207 17:59747853-59747875 TAACACAGGCTGGAGTGCAGTGG - Intronic
1149893153 17:60408056-60408078 TACCCCAGGCTGGAGTGCAGTGG - Intronic
1150049060 17:61941033-61941055 TCACCAAGGCTGGAGGGCAGCGG + Intergenic
1150079069 17:62220390-62220412 TCCCCAAGGCTGGAGTGCAGTGG + Intergenic
1150146603 17:62774477-62774499 CACCAGAGCCTGGTGGGCAGTGG + Intronic
1151368896 17:73635023-73635045 TACCCCAGGCTGGAGTGCAGTGG + Intronic
1151390017 17:73780260-73780282 TCCCTCAGGCTGGTGTGCAGTGG - Intergenic
1151463946 17:74272624-74272646 CACTAAAGGCAGGTGGGTAGTGG + Intergenic
1151528699 17:74689989-74690011 TCCCTGAGGCTGGTGTGCAGTGG + Intronic
1151641433 17:75398306-75398328 TAGCAAAGGCTGGAGGGCAGTGG + Intronic
1151649975 17:75461137-75461159 TGCCCAAGGCTGGAGTGCAGTGG + Intronic
1151656274 17:75497639-75497661 AAACAAAGGCTGGACGGCAGTGG - Intronic
1151824306 17:76515180-76515202 TAGCCCAGGCTGGTGTGCAGTGG - Intergenic
1151871011 17:76836723-76836745 TACCCCAGGCTGGAGTGCAGTGG - Intergenic
1151913892 17:77103479-77103501 CACCCCAGGCTGGAGGGCAGTGG + Intronic
1152238458 17:79150161-79150183 GACAAGAGGGTGGTGGGCAGCGG + Intronic
1152402185 17:80073733-80073755 TCCCCCAGGCTGGAGGGCAGTGG + Intronic
1152432854 17:80259425-80259447 TACCCCAGGCTGGAGTGCAGTGG - Intergenic
1152469813 17:80484566-80484588 TCCCACAGGCTGGAGTGCAGTGG + Intergenic
1152765048 17:82132076-82132098 CACCCAAGGCTGGAGTGCAGTGG - Intronic
1152865622 17:82721125-82721147 TCCCCCAGGCTGGAGGGCAGTGG + Intronic
1153039636 18:799843-799865 TAGCCCAGGCTGGAGGGCAGTGG - Intronic
1153346844 18:4035305-4035327 TCCCTAAGGCTGGAGTGCAGTGG - Intronic
1154035107 18:10793217-10793239 TATCCCAGGCTGGAGGGCAGTGG - Intronic
1154224176 18:12486890-12486912 TTGCCAAGGCTGGAGGGCAGTGG + Intronic
1154469019 18:14680090-14680112 TAGCTGAGGCTGGAGGGCAGTGG - Intergenic
1154526815 18:15299315-15299337 TAACCAAGGCTGGGGTGCAGTGG - Intergenic
1155312621 18:24538901-24538923 TACTAAAGGCTGTGGAGCAGAGG + Intergenic
1155952497 18:31928480-31928502 ACCCTAAGGCTGGTGTGCAGTGG - Intronic
1156978115 18:43250390-43250412 TGCCAGAGGCTGGTGGGAGGAGG - Intergenic
1157366151 18:47065923-47065945 TAGCCCAGGCTGGAGGGCAGTGG - Intronic
1157669124 18:49513467-49513489 TAGCACAGGCTGGAGTGCAGTGG + Intergenic
1157700429 18:49758670-49758692 TAGCCCAGGCTGGAGGGCAGTGG + Intergenic
1157775236 18:50389433-50389455 TCCCACAGGCTGGAGTGCAGTGG + Intronic
1157869002 18:51212159-51212181 CACCCAAGGCTGGAGTGCAGTGG - Intronic
1157924862 18:51752595-51752617 AACCAGAGGCTGGGGGGCTGAGG - Intergenic
1158435443 18:57432469-57432491 AATCAAATGCTGGTGGGGAGGGG + Intergenic
1158585947 18:58735063-58735085 TACCAGAGGCTGGGGGGGGGTGG - Intronic
1158749044 18:60237451-60237473 TGCCGAAGACTGGTGGGAAGGGG - Intergenic
1159044975 18:63361168-63361190 TAACCCAGGCTGGTGTGCAGTGG - Intronic
1159048524 18:63394504-63394526 TAGCCCAGGCTGGAGGGCAGTGG + Intronic
1159167440 18:64721414-64721436 TCACACAGGCTGGTGTGCAGTGG + Intergenic
1159460849 18:68721032-68721054 TCCCACAGGCTGGAGGGCAGGGG - Intronic
1159600758 18:70426661-70426683 TACCCAGAGCTGGTGGGCAAAGG - Intergenic
1159817615 18:73095587-73095609 TCCCAAAGGCTGGAGTGCAGTGG + Intergenic
1159964341 18:74580927-74580949 TCCCCCAGGCTGGAGGGCAGTGG - Intronic
1160208092 18:76853582-76853604 TACCAGAGGCTGGGGGATAGGGG + Intronic
1160592799 18:79953148-79953170 TCCCAAAGGCTGCTGGGCTCAGG - Intergenic
1160729766 19:635931-635953 TGCCCAAGGCTGGAGTGCAGTGG - Intergenic
1160819696 19:1052305-1052327 GACCCAAGGCGGGTGGGCAGTGG + Intronic
1161000229 19:1907145-1907167 TCCCCCAGGCTGGAGGGCAGTGG - Intronic
1161087248 19:2340824-2340846 GTCCCAAGGGTGGTGGGCAGTGG + Intronic
1161247558 19:3262072-3262094 TACCCCAGGCTGGCGTGCAGTGG + Intronic
1161367171 19:3886751-3886773 TCCCACAGGCTGGAGTGCAGTGG + Intronic
1161396821 19:4049013-4049035 TCCCCCAGGCTGGAGGGCAGTGG + Intronic
1161519366 19:4715057-4715079 CTCCAAAGGCTGGAGTGCAGTGG + Intronic
1161523922 19:4741712-4741734 TACCCCAGGCTGGAGTGCAGTGG + Intergenic
1161853242 19:6749809-6749831 TTCCCCAGGCTGGTGTGCAGTGG - Intronic
1162008839 19:7798946-7798968 TCCCCCAGGCTGGAGGGCAGTGG + Intergenic
1162420254 19:10562086-10562108 TCCCTCAGGCTGGAGGGCAGTGG + Intronic
1162499388 19:11042933-11042955 CACCCAAGGCTGGAGTGCAGTGG - Intronic
1162989287 19:14291965-14291987 TCACACAGGCTGGTGTGCAGTGG + Intergenic
1163203382 19:15784108-15784130 TCCCCAAGGCTGGAGTGCAGTGG - Intergenic
1163553427 19:17979019-17979041 TCCCCCAGGCTGGTGTGCAGTGG - Intronic
1163670528 19:18625412-18625434 TCGCCCAGGCTGGTGGGCAGTGG + Intergenic
1163947934 19:20557654-20557676 TCACACAGGCTGGTGTGCAGTGG + Intronic
1164200459 19:23013772-23013794 TCACCAAGGCTGGAGGGCAGTGG + Intergenic
1164373136 19:27658737-27658759 TTCCCCAGGCTGGAGGGCAGTGG - Intergenic
1165237606 19:34435356-34435378 TAGCCCAGGCTGGAGGGCAGTGG - Intronic
1165238360 19:34442193-34442215 TCCCCAAGGCTAGTGTGCAGTGG - Intronic
1165244395 19:34489892-34489914 TCCCACAGGCTGGAGTGCAGTGG - Intronic
1165289349 19:34870525-34870547 CAGCAATGGCTGGAGGGCAGTGG - Intergenic
1165429549 19:35764799-35764821 ACCCAAAGGCTGCTGGGAAGGGG - Intronic
1165430638 19:35769942-35769964 TCCCCCAGGCTGGAGGGCAGTGG + Intronic
1165722981 19:38092897-38092919 TTCCCCAGGCTGGAGGGCAGTGG + Intronic
1165796768 19:38524229-38524251 TACCAAAGCATCGTGGGCTGAGG + Intronic
1165836806 19:38762432-38762454 CGCCAAAGGCTGGAGTGCAGTGG - Intronic
1165854849 19:38873563-38873585 TTGCCAAGGCTGGAGGGCAGTGG + Intronic
1165959732 19:39523964-39523986 TCCCCCAGGCTGGAGGGCAGTGG - Intergenic
1166033876 19:40153292-40153314 TTCCACAGGCTGGAGTGCAGTGG + Intergenic
1166114574 19:40645678-40645700 TACCCCAGGCTGGAGTGCAGTGG - Intergenic
1166116002 19:40654942-40654964 TCCCCCAGGCTGGTGTGCAGGGG + Intergenic
1166232008 19:41430170-41430192 TCGCCAAGGCTGGTGTGCAGTGG + Intronic
1166667709 19:44691065-44691087 TCCCACAGGCTGGAGGGCAGTGG - Intergenic
1166710238 19:44932200-44932222 TACCCCAGGCTGGAGTGCAGGGG + Intergenic
1166738750 19:45101676-45101698 TCACATAGGCTGGAGGGCAGTGG - Intronic
1166761912 19:45230062-45230084 TCCCCCAGGCTGGTGTGCAGTGG + Intronic
1166818058 19:45558762-45558784 TCCCCAAGGCTGGAGTGCAGTGG + Intronic
1166848888 19:45748115-45748137 TACCCCAGGCTGGAGTGCAGTGG + Intronic
1166915741 19:46195053-46195075 TTCCAGAGGCTGGAGTGCAGTGG + Intergenic
1167031161 19:46961888-46961910 TCACACAGGCTGGAGGGCAGTGG - Intronic
1167116460 19:47491884-47491906 ATCCAAAGGCTGGCTGGCAGGGG + Intronic
1167173596 19:47850032-47850054 TCGCACAGGCTGGAGGGCAGTGG - Intergenic
1167392982 19:49208917-49208939 TCCCACAGGCTGGAGTGCAGTGG - Intronic
1167479996 19:49724162-49724184 TCCCCCAGGCTGGTGTGCAGTGG - Intergenic
1167809318 19:51814847-51814869 TCCCACAGGCTGGAGTGCAGTGG + Intronic
1167909855 19:52692808-52692830 TCCCCCAGGCTGGAGGGCAGTGG - Intergenic
1168587162 19:57602928-57602950 TTCCCCAGGCTGGAGGGCAGTGG + Intronic
1168657353 19:58140450-58140472 TTGCTAAGGCTGGTGTGCAGTGG + Intronic
1168664588 19:58194175-58194197 AAACAAAGGCTGGAGTGCAGTGG - Intronic
1168666004 19:58205382-58205404 TAGCCAAGGCTGGAGTGCAGTGG + Intronic
925529832 2:4846886-4846908 TAGCCAAGGCTGGAGTGCAGTGG - Intergenic
925595818 2:5554896-5554918 TACCCCAGGCTGGAGTGCAGCGG + Intergenic
925596605 2:5561604-5561626 TACCCCAGGCTGGAGTGCAGTGG + Intergenic
925662196 2:6213976-6213998 TCCCCCAGGCTGGAGGGCAGTGG - Intergenic
925925952 2:8670773-8670795 TGCCAATGGCAGGTGGGCTGTGG - Intergenic
926910323 2:17846989-17847011 TCACAAAGGCTGGAGTGCAGTGG + Intergenic
926929853 2:18026433-18026455 TACCAGAGGCTGGAGGGGAAGGG - Intronic
927595293 2:24391470-24391492 TTGCACAGGCTGGAGGGCAGTGG + Intergenic
927767480 2:25825449-25825471 TGCCAGGAGCTGGTGGGCAGGGG - Intronic
927823836 2:26293362-26293384 CACCCAAGGCTGGAGTGCAGTGG + Intergenic
929056219 2:37879107-37879129 TCTCCAAGGCTGGTGTGCAGTGG + Intergenic
929105832 2:38365002-38365024 TACCCCAGGCTGGAGTGCAGTGG - Intronic
929180433 2:39032284-39032306 TACCAGAGGCTGGAGGGTAGGGG - Intronic
929247233 2:39715877-39715899 TAAAAAAGGGTGGTGGGTAGAGG + Intronic
929504410 2:42517218-42517240 TCCCCAAGGCTGGAGTGCAGTGG - Intronic
929691099 2:44074186-44074208 TTGCAAAGGCTGGAGTGCAGTGG - Intergenic
930221036 2:48747127-48747149 TTGCAGAGGCTGGAGGGCAGTGG + Intronic
931032983 2:58204218-58204240 TACACAAGTCTGGTGAGCAGAGG + Exonic
931128552 2:59305033-59305055 TCCCAGAGGCTGGAGTGCAGTGG - Intergenic
931166303 2:59752638-59752660 TACCAGAGGTTGTTGGGGAGGGG + Intergenic
931227673 2:60347832-60347854 TACCGGAGGCTGGTGGTCTGTGG - Intergenic
931521285 2:63099789-63099811 TAGCCCAGGCTGGAGGGCAGTGG - Intergenic
931591998 2:63894661-63894683 TCACACAGGCTGGAGGGCAGTGG - Intronic
931602850 2:64020670-64020692 TACCAAAGACTGGGGGGTAAAGG + Intergenic
931634237 2:64327600-64327622 TTTCAAAGGCTGGGGGCCAGTGG + Intergenic
931772582 2:65510916-65510938 TCCCCCAGGCTGGAGGGCAGTGG + Intergenic
931858231 2:66326604-66326626 TACCAGGGGCTGGTGGGGTGAGG + Intergenic
932541980 2:72664725-72664747 TTCAAAGGGCTGCTGGGCAGGGG - Intronic
932650867 2:73554671-73554693 TACGACAGGCTGGAGTGCAGTGG - Intronic
932690640 2:73910173-73910195 TCACACAGGCTGGAGGGCAGTGG - Intronic
933109086 2:78374184-78374206 TTCCCCAGGCTGGTGTGCAGTGG - Intergenic
933434425 2:82228525-82228547 TCCCCAAGGCTGGAGTGCAGTGG + Intergenic
933532276 2:83525524-83525546 TCACCCAGGCTGGTGGGCAGGGG - Intergenic
933634652 2:84694155-84694177 AGCCAAAGGCTGGTGGCCAGTGG - Intronic
933901515 2:86853743-86853765 TAGCCCAGGCTGGAGGGCAGTGG + Intronic
933979489 2:87538655-87538677 CACCAAAGGCTGGTGGGTGTCGG + Intergenic
934188728 2:89766751-89766773 GACCATGGGGTGGTGGGCAGGGG - Intergenic
934515933 2:94986599-94986621 TTCCAAAGGCTGCTGGGCTCTGG - Intergenic
934520805 2:95019026-95019048 AACCAGAGGCTGGTGGGCAGAGG - Intergenic
934533320 2:95110753-95110775 TCCCCAAGGCTGGAGTGCAGTGG - Intronic
935258757 2:101336375-101336397 TAGCCCAGGCTGGAGGGCAGTGG - Intergenic
935779032 2:106495497-106495519 TAGCCCAGGCTGGAGGGCAGTGG - Intergenic
935805545 2:106744132-106744154 TCCCCCAGGCTGGAGGGCAGTGG + Intergenic
936272007 2:111056158-111056180 TCACACAGGCTGGAGGGCAGTGG - Intronic
936314334 2:111412136-111412158 CACCAAAGGCTGGTGGGTGTCGG - Intergenic
936448493 2:112615746-112615768 TGCCCAAGGCTGGAGTGCAGTGG + Intergenic
936659716 2:114529116-114529138 TACCAAAGCCTGGCAGGTAGGGG - Intronic
936696340 2:114954118-114954140 TAGCCCAGGCTGGAGGGCAGTGG + Intronic
936838694 2:116741748-116741770 TAGCCAAGGCTGGAGTGCAGTGG + Intergenic
936955959 2:118022602-118022624 TACCCCAGGCTGGAGGGCAGTGG + Intergenic
936978072 2:118238870-118238892 TGTCAAAGGCTGGAGTGCAGTGG + Intergenic
937156659 2:119724785-119724807 TGCCATAGCCTGATGGGCAGGGG + Intergenic
937190020 2:120086159-120086181 TCACAAAGGCTGGAGTGCAGTGG - Intronic
937608282 2:123827304-123827326 TACCCCAGGCTGGAGTGCAGTGG - Intergenic
938247129 2:129786445-129786467 TAGAAAAGGGTGGTGGCCAGAGG + Intergenic
938253899 2:129838305-129838327 TACCAGCGGCTGGTGGTCTGGGG + Intergenic
938294384 2:130168382-130168404 TACCCCAGGCTGGAGTGCAGTGG - Intronic
938848817 2:135239231-135239253 TACCAGAGGCTGGAGGGGAAGGG + Intronic
938889695 2:135691948-135691970 TAGCCCAGGCTGGAGGGCAGTGG + Intronic
938894833 2:135739711-135739733 TCGCCCAGGCTGGTGGGCAGTGG + Intergenic
939304129 2:140387974-140387996 TCCCACAGGCTGGAGTGCAGTGG + Intronic
939347352 2:140983115-140983137 TACCAAAGGCCTGGGGGAAGAGG - Intronic
939383288 2:141464450-141464472 TACCCCAGGCTGGAGTGCAGTGG + Intronic
939511948 2:143117883-143117905 TACCAAAGGCTGGGGAGTGGAGG + Intronic
940443201 2:153744320-153744342 TACCAAATGCTGGTGAGGAGTGG - Intergenic
940445156 2:153768824-153768846 TCACAAAGGCTGGAGTGCAGTGG - Intergenic
940647222 2:156404345-156404367 TTGCAAAGGCTGGAGTGCAGTGG - Intergenic
940877445 2:158912282-158912304 TAACTCAGGCTGGAGGGCAGTGG + Intergenic
940879732 2:158934908-158934930 TCCCCCAGGCTGGTGTGCAGTGG + Intergenic
941062857 2:160867788-160867810 TACCAAATGCTGATGGGGATTGG + Intergenic
941651990 2:168101945-168101967 TGCCTAGGGCTGGTGGGTAGGGG - Intronic
941825970 2:169897536-169897558 TACCCCAGGCTGGAGTGCAGTGG + Intronic
942114979 2:172720152-172720174 TCCCCCAGGCTGGTGTGCAGTGG + Intergenic
942443242 2:176058258-176058280 TACCAAAGGCAGGTCAGCAAAGG + Intergenic
942502823 2:176609891-176609913 TCCCCCAGGCTGGAGGGCAGTGG + Intergenic
942899648 2:181099050-181099072 TACCTCAGGCTGGAGTGCAGTGG - Intergenic
942910517 2:181237795-181237817 TCACAAAGGCTGGAGTGCAGTGG - Intergenic
943221362 2:185110981-185111003 TTCCCAAGGCTGAAGGGCAGTGG - Intergenic
943569016 2:189550302-189550324 TAGCCCAGGCTGGAGGGCAGTGG - Intergenic
944157279 2:196620666-196620688 TTGCCAAGGCTGGAGGGCAGTGG - Intergenic
944626753 2:201577715-201577737 TACCAGAGGCTGGGGAGTAGGGG + Intronic
944679198 2:202061491-202061513 TGCCCAAGGCTGGAGTGCAGTGG - Intergenic
945237323 2:207643442-207643464 TAACACAGGCTGGAGCGCAGTGG + Intergenic
945429232 2:209745580-209745602 TCCCCGAGGCTGGAGGGCAGTGG + Intergenic
945635571 2:212345224-212345246 TCCCCCAGGCTGGAGGGCAGTGG - Intronic
946002705 2:216496099-216496121 TTCCCCAGGCTGGTGTGCAGTGG - Intergenic
946009279 2:216552007-216552029 TCCCACAGGCTGGAGTGCAGTGG - Intronic
946032271 2:216714627-216714649 TACCCAGGGCTGGGGGGCTGGGG - Intergenic
947001185 2:225458309-225458331 TCACCCAGGCTGGTGGGCAGTGG - Intronic
947075647 2:226341637-226341659 TCACCCAGGCTGGTGGGCAGTGG - Intergenic
947373979 2:229476355-229476377 TACCTAAGGCTGAGAGGCAGGGG - Intronic
947426648 2:229989599-229989621 TAGCCAAGGCTGGAGTGCAGTGG + Intronic
947485619 2:230546018-230546040 TAGCCCAGGCTGGAGGGCAGTGG + Intergenic
947517226 2:230816231-230816253 TCACAAAGGCTGGAGTGCAGTGG - Intronic
947671298 2:231937864-231937886 TAGCACAGGCTGGAGTGCAGTGG + Intergenic
947676304 2:231983847-231983869 TTGCCAAGGCTGGAGGGCAGTGG - Intronic
947870298 2:233432617-233432639 TCCCCCAGGCTGGTGTGCAGTGG - Intronic
948125631 2:235563007-235563029 TGCCCCAGGCTGGTGTGCAGCGG - Intronic
948195954 2:236096459-236096481 TCCCCAAGGCTGGAGTGCAGTGG - Intronic
948270010 2:236667027-236667049 TAGCACAGGCTGGAGTGCAGCGG + Intergenic
948400897 2:237684434-237684456 TAGCCTAGGCTGGTGTGCAGTGG - Intronic
948592839 2:239062396-239062418 CATCAAAGGCTGCCGGGCAGAGG + Intronic
948743801 2:240070423-240070445 TCCCACAGGCTGGAGTGCAGTGG + Intergenic
1168756455 20:321782-321804 TCCCACAGGCTGGGGTGCAGTGG + Intergenic
1168909639 20:1437320-1437342 TTGCACAGGCTGGAGGGCAGTGG - Intergenic
1168920236 20:1527394-1527416 TCCCACAGGCTGGAGTGCAGTGG - Intergenic
1169099591 20:2935150-2935172 TACTAGAGGTTGGTGGGTAGGGG - Intronic
1169579357 20:7001673-7001695 TCCCCCAGGCTGGAGGGCAGTGG + Intergenic
1169809907 20:9599027-9599049 TACCAGGGGCTGGAGGGAAGGGG - Intronic
1170471360 20:16671195-16671217 TTGCACAGGCTGGAGGGCAGTGG - Intergenic
1170682410 20:18538287-18538309 TACCCCAGGCTGGAGTGCAGTGG + Intronic
1171204076 20:23265792-23265814 TCACCCAGGCTGGTGGGCAGTGG + Intergenic
1172234095 20:33358124-33358146 TCCCCCAGGCTGGAGGGCAGTGG + Intergenic
1172307440 20:33891093-33891115 CACCTAAGGCTGGAGTGCAGTGG + Intergenic
1172334539 20:34103744-34103766 TCGCCAAGGCTGGAGGGCAGTGG + Intronic
1172427819 20:34867663-34867685 TCGCCCAGGCTGGTGGGCAGTGG - Intronic
1173364459 20:42372321-42372343 TCACCAAGGCTGGAGGGCAGTGG + Intronic
1173812087 20:45962193-45962215 GACAAAAGGATGGTGGGCTGGGG + Intronic
1173874922 20:46364315-46364337 TCCCAGAGGCTGGGGGGCCGGGG - Intronic
1173908809 20:46648863-46648885 TAACACAGGCTGGAGTGCAGTGG - Intronic
1173973540 20:47170605-47170627 TACCCCAGGCTGGAGTGCAGTGG - Intronic
1174006190 20:47412658-47412680 TTGCATAGGCTGGAGGGCAGTGG - Intergenic
1174027663 20:47592080-47592102 TACCCCAGGCTGGAGTGCAGTGG + Intronic
1174143504 20:48433964-48433986 AAACAAAGGGTGGTGGGCGGGGG - Intergenic
1174427547 20:50443426-50443448 TATCACAGGCTGGAGTGCAGTGG + Intergenic
1174433840 20:50491163-50491185 TTGCCAAGGCTGGAGGGCAGTGG - Intergenic
1174646782 20:52093178-52093200 TCCCCAAGGCTGGAGTGCAGTGG + Intronic
1174817338 20:53698003-53698025 TCCCTAAGGCTGGAGTGCAGTGG - Intergenic
1174824811 20:53759500-53759522 TCGCACAGGCTGGAGGGCAGTGG + Intergenic
1175142438 20:56870941-56870963 TTCCCTAGGCTGGAGGGCAGTGG - Intergenic
1175885860 20:62290454-62290476 TTCCCCAGGCTGGAGGGCAGTGG + Intronic
1175887305 20:62299553-62299575 TCCCATAGGCTGGAGTGCAGTGG - Intergenic
1176225609 20:63996887-63996909 TAACCCAGGCTGGTGTGCAGAGG - Intronic
1176524671 21:7857205-7857227 TCGCCAAGGCTGGAGGGCAGTGG + Intergenic
1176805502 21:13477581-13477603 TAGCTGAGGCTGGAGGGCAGTGG + Intergenic
1177230488 21:18314316-18314338 TAACAAAGGCTGGAGTGCAATGG + Intronic
1178063861 21:28881669-28881691 TTCCACAGGCTGGAGTGCAGTGG + Intronic
1178291188 21:31369943-31369965 TACCCCAGGCTGGAGTGCAGTGG - Intronic
1178658691 21:34487218-34487240 TCGCCAAGGCTGGAGGGCAGTGG + Intergenic
1178711511 21:34921301-34921323 TACCAGAGGCTGTGGGGGAGGGG - Intronic
1178845807 21:36173078-36173100 TCCCCAAGGCTGGAGTGCAGTGG - Intronic
1178947848 21:36962751-36962773 CACCCAAGGCTGGAGTGCAGTGG - Intronic
1178950805 21:36983873-36983895 TATCACAGGCTGGAGTGCAGTGG + Intronic
1178993645 21:37377157-37377179 TCCCCAAGGCTGGAGTGCAGTGG + Intronic
1179151841 21:38815898-38815920 TCCCACAGGCTGGAGTGCAGTGG - Intronic
1179211436 21:39327862-39327884 TAGCAAAGGCCGGAGTGCAGTGG - Intergenic
1179238113 21:39565241-39565263 TCCCCAAGGCTGGAGTGCAGTGG + Intronic
1179673961 21:42969241-42969263 TACCCCAGGCTGGAGTGCAGTGG + Intergenic
1179838876 21:44057337-44057359 CACCAAGGGCTGGCGTGCAGTGG + Intronic
1179839311 21:44060638-44060660 TCCCCCAGGCTGGAGGGCAGTGG + Intronic
1179875924 21:44267370-44267392 CACCATGGGCTGGAGGGCAGAGG - Intergenic
1179977773 21:44879654-44879676 TCACCAAGGCTGGAGGGCAGTGG - Intergenic
1180603585 22:17037850-17037872 TCTCCAAGGCTGGAGGGCAGTGG + Intergenic
1180685911 22:17666719-17666741 TAGCACAGGCTGGAGTGCAGTGG + Intronic
1180764023 22:18233013-18233035 TCCCCAAGGCTGGAGTGCAGTGG + Intergenic
1180771620 22:18391529-18391551 TCCCCAAGGCTGGAGTGCAGTGG - Intergenic
1180802998 22:18641143-18641165 TCCCCAAGGCTGGAGTGCAGTGG - Intergenic
1181183706 22:21086094-21086116 TTGCACAGGCTGGAGGGCAGTGG - Intergenic
1181218717 22:21354117-21354139 TCCCCAAGGCTGGAGTGCAGTGG + Intergenic
1181280624 22:21717334-21717356 TACCCAAGGCTGGAGTGCAGTGG - Intronic
1181349157 22:22243206-22243228 CTGCACAGGCTGGTGGGCAGTGG - Intergenic
1181476755 22:23172908-23172930 TACCCCAGGCTGGAGTGCAGTGG - Intergenic
1181824364 22:25502533-25502555 TCCCCCAGGCTGGTGTGCAGTGG + Intergenic
1181950957 22:26553409-26553431 TCTCAAAGGCTGGAGTGCAGTGG + Intronic
1182417536 22:30231070-30231092 AACCATAGCCTGGTGGGTAGCGG + Intergenic
1182537830 22:31019103-31019125 TAGCTAAGGCTGGAGTGCAGTGG + Intergenic
1182751021 22:32642247-32642269 CACCCAAGGCTGGAGTGCAGTGG - Intronic
1182888864 22:33799478-33799500 TTGCACAGGCTGGAGGGCAGTGG + Intronic
1183229049 22:36569577-36569599 TACCCCAGGCTGGAGTGCAGTGG + Intronic
1183323902 22:37181059-37181081 TCCCCAAGGCTGGTGGGACGGGG - Exonic
1183419477 22:37702679-37702701 TAGCACAGGCTGGAGTGCAGTGG + Intronic
1183451765 22:37899962-37899984 TACCAGGGGCTGGTGGGTAGGGG - Intergenic
1183465087 22:37975814-37975836 GACAAGAGTCTGGTGGGCAGTGG + Intronic
1183637518 22:39073431-39073453 TCCCACAGGCTGGAGTGCAGTGG - Intronic
1183835799 22:40452021-40452043 TAGCCAAGGCTGGAGTGCAGTGG + Intronic
1183888612 22:40906379-40906401 TCCCACAGGCTGGAGTGCAGTGG - Intronic
1183896571 22:40974281-40974303 TCCCCAAGGCTGGAGTGCAGTGG + Intergenic
1183932021 22:41240770-41240792 TCTCAGAGGCTGGCGGGCAGGGG - Intronic
1183955492 22:41378206-41378228 TCCCACAGGCTGGAGTGCAGTGG + Intronic
1184108474 22:42382093-42382115 TAGCCCAGGCTGGTGTGCAGTGG + Exonic
1184163950 22:42716548-42716570 AACCAAGGCCTGCTGGGCAGCGG + Intronic
1184206813 22:43009907-43009929 CACCCAAGGCTGGAGTGCAGTGG + Intronic
1185230017 22:49674509-49674531 TTGCGAAGGCTGGAGGGCAGTGG - Intergenic
1185230110 22:49675210-49675232 TAGCCAAGGCTGGAGTGCAGTGG - Intergenic
1185236112 22:49714265-49714287 TATCAAGGGCTGGTGGGAATCGG + Intergenic
1185350066 22:50330673-50330695 TGCCCAAGGCTGGAGTGCAGTGG - Intergenic
1203233458 22_KI270731v1_random:132520-132542 TCCCCAAGGCTGGAGTGCAGTGG - Intergenic
949192289 3:1264869-1264891 TACCAGAGGCTGGGGGAGAGGGG - Intronic
950161251 3:10762986-10763008 ACCCAAAGGCTGGTGGGAGGGGG - Intergenic
950335522 3:12189760-12189782 TCGCAAAGGCTGGAGTGCAGTGG - Intronic
950377899 3:12586873-12586895 TCCCCAAGGCTGGAGTGCAGTGG + Intronic
950387792 3:12673632-12673654 TCCCCAAGGCTGGAGTGCAGTGG - Intergenic
950735026 3:15000175-15000197 TAACAGAGGCTGAGGGGCAGGGG - Intronic
950780533 3:15387850-15387872 TCCCAAAGGCTGGAGTGCAATGG + Intronic
951988844 3:28652837-28652859 TATCAAGGGCTGGTGGGTGGGGG - Intergenic
952233876 3:31458863-31458885 TCCCCCAGGCTGGAGGGCAGTGG - Intergenic
952777634 3:37061443-37061465 CACCCAAGGCTGGAGTGCAGTGG + Intronic
952920660 3:38281934-38281956 TGACCAAGGCTGGTTGGCAGGGG + Intergenic
953107565 3:39899709-39899731 TATCAAATGTTGGTGGGAAGTGG - Intronic
953281701 3:41564496-41564518 TACCCTAGGCTGGAGTGCAGTGG + Intronic
953290833 3:41660253-41660275 TGCCACAGGCTGGTGTGCAATGG - Intronic
953752800 3:45622205-45622227 TACCCAGGGCTGGAGGACAGCGG - Intronic
953874170 3:46655830-46655852 TGCCCAAGGCTGGAGTGCAGTGG - Intergenic
953891075 3:46751967-46751989 TCCCCCAGGCTGGAGGGCAGTGG + Intronic
954017144 3:47703339-47703361 GAATAAAGGCTGGAGGGCAGTGG - Intronic
954252196 3:49376601-49376623 TCCCCCAGGCTGGTGTGCAGTGG - Intronic
954281552 3:49583006-49583028 TTCCCAAGGCTGGAGTGCAGTGG + Intronic
954404756 3:50339403-50339425 TCGCCAAGGCTGGAGGGCAGTGG + Intronic
954470917 3:50694228-50694250 TCCCCCAGGCTGGTGTGCAGTGG - Intronic
954499320 3:50995934-50995956 TACCCCAGGCTGGGGTGCAGTGG + Intronic
954555265 3:51512719-51512741 CACCAAAGGCTAGGGTGCAGTGG + Intergenic
954709277 3:52497039-52497061 TAGCCCAGGCTGGAGGGCAGTGG + Intronic
955273325 3:57523341-57523363 TCACCAAGGCTGGAGGGCAGTGG - Intronic
955486179 3:59437262-59437284 TGCCCAAGGCTGGAGTGCAGTGG + Intergenic
955678967 3:61480371-61480393 TAGCACAGGCTGGAGTGCAGTGG - Intergenic
955767271 3:62358274-62358296 TCCCACAGGCTGGAGTGCAGTGG + Intergenic
956131555 3:66058456-66058478 TAACACAGGCTGGAGTGCAGTGG + Intergenic
956662078 3:71608869-71608891 TACCAAAGGCTGGGGGTGAGGGG + Intergenic
956811082 3:72864602-72864624 TCCCCCAGGCTGGAGGGCAGTGG + Intergenic
957055094 3:75436255-75436277 GTCCAAAGGCTGGAGGACAGAGG - Intergenic
957365730 3:79221014-79221036 TACCAAATGCTTTTGGGAAGTGG + Intronic
957556031 3:81765593-81765615 TTCCTAGGGCTGGAGGGCAGGGG + Intergenic
957777687 3:84775221-84775243 TAGCCCAGGCTGGAGGGCAGTGG - Intergenic
957891338 3:86363212-86363234 TCACTAAGGCTGGAGGGCAGTGG + Intergenic
958065566 3:88541323-88541345 TGCCCAAGGCTGGAGTGCAGTGG + Intergenic
958270747 3:91496262-91496284 AAGCAAAGGCAGGTGGGCAGGGG + Intergenic
958895245 3:99822004-99822026 TAGCACAGGCTGGAGTGCAGTGG - Intronic
958908895 3:99971298-99971320 TCACCCAGGCTGGTGGGCAGTGG - Intronic
959384264 3:105682544-105682566 TTGCAAAGGCTGGAGTGCAGTGG + Intronic
959489175 3:106967098-106967120 TACCTAAGCCTGGGAGGCAGAGG - Intergenic
959722421 3:109507633-109507655 CACCCAAGGCTGGAGTGCAGTGG + Intergenic
959925150 3:111912934-111912956 TCCCAAAGGCTGGAGTGCAGTGG - Intronic
960792253 3:121445821-121445843 TCACCCAGGCTGGTGGGCAGTGG - Intronic
960884229 3:122377805-122377827 TCACCAAGGCTGGAGGGCAGTGG - Intronic
960935688 3:122900022-122900044 TCCCACAGGCTGGAGTGCAGTGG - Intergenic
961014751 3:123458968-123458990 TGCCCAAGGCTGGAGTGCAGTGG - Intergenic
961026762 3:123565088-123565110 TACCAGGTGCTGTTGGGCAGTGG - Intronic
961422074 3:126814489-126814511 AACCTTAGGCTGGTGGGGAGTGG - Intronic
961631041 3:128298732-128298754 TACCAAAGGCTGGTGGGCAGGGG - Intronic
961678017 3:128579601-128579623 TAGCTCAGGCTGGAGGGCAGTGG - Intergenic
961694772 3:128696966-128696988 TACCCCAGGCTGGAGTGCAGTGG - Intergenic
961888767 3:130112658-130112680 CTCCAAAGGCTGGGGGACAGAGG - Intronic
962093598 3:132270649-132270671 TCCCCCAGGCTGGAGGGCAGTGG - Intronic
962135703 3:132729846-132729868 TACCAGAGGCTGGTGGTGAGGGG - Intergenic
962282825 3:134065238-134065260 TTCCCCAGGCTGGAGGGCAGTGG - Intergenic
962384518 3:134922047-134922069 TCCCAGAGGGTGGTGGGCATGGG + Intronic
962418371 3:135204538-135204560 TCACACAGGCTGGAGGGCAGTGG + Intronic
962560680 3:136603229-136603251 TACCCCAGGCTGGAGTGCAGTGG + Intronic
962687222 3:137859252-137859274 TCACACAGGCTGGTGTGCAGTGG + Intergenic
962892116 3:139681086-139681108 TAGCCCAGGCTGGAGGGCAGTGG + Intergenic
962906546 3:139808724-139808746 TCACACAGGCTGGAGGGCAGTGG - Intergenic
963360749 3:144269299-144269321 TTCCTTAGGCTGGAGGGCAGTGG - Intergenic
963482922 3:145899620-145899642 TACCAAGGGCTGGTGGAAAGGGG - Intergenic
964058158 3:152487473-152487495 CACCCAAGGCTGGAGTGCAGTGG + Intergenic
964210925 3:154227333-154227355 TCCCACAGGCTGGAGTGCAGTGG + Intronic
964279399 3:155046648-155046670 TAGCCCAGGCTGGAGGGCAGTGG - Intronic
964400810 3:156296511-156296533 TAGCGCAGGCTGGAGGGCAGTGG + Intronic
965357802 3:167698494-167698516 TATCATAGGCTGGAGTGCAGTGG - Intronic
965544884 3:169905009-169905031 TACCAGGGCCTGGTGGGGAGAGG + Intergenic
965714969 3:171593337-171593359 TGCCAGAGGCTGGAGGGTAGGGG - Intergenic
965786164 3:172337722-172337744 TCACACAGGCTGGAGGGCAGTGG + Intronic
966172617 3:177099325-177099347 TACCCCAGGCTGGAGTGCAGTGG - Intronic
966174288 3:177119009-177119031 TACCCCAGGCTGGAGTGCAGTGG + Intronic
966762982 3:183433393-183433415 TCACATAGGCTGGAGGGCAGTGG - Intergenic
966890622 3:184405088-184405110 TCGCCAAGGCTGGTGTGCAGTGG - Intronic
966972185 3:185054277-185054299 TACCCCAGGCTGGAGTGCAGTGG - Intergenic
967417366 3:189233908-189233930 TACCCCAGGCTGGAGTGCAGTGG + Intronic
967724771 3:192851335-192851357 TGCCAAGGGCTGTTGGGGAGTGG + Intronic
967769759 3:193321589-193321611 TCCCCAAGGCTGGAGTGCAGTGG - Intronic
968036341 3:195551313-195551335 TTGCCAAGGCTGGAGGGCAGTGG - Intergenic
968174332 3:196536341-196536363 TAGCCTAGGCTGGTGTGCAGTGG + Intergenic
968212708 3:196862194-196862216 TCCCCCAGGCTGGAGGGCAGTGG + Intergenic
968395647 4:234161-234183 TCACAAAGGCTGGAGTGCAGTGG - Intergenic
968677725 4:1893589-1893611 TACCCCAGGCTGGAGTGCAGTGG + Intronic
968878652 4:3287527-3287549 TCCCAAAGGCCAGCGGGCAGGGG - Intergenic
968997910 4:3956565-3956587 GTCCAAAGGCTGGGGGACAGAGG - Intergenic
969044512 4:4327188-4327210 TCCCCCAGGCTGGAGGGCAGTGG + Intergenic
969685177 4:8667905-8667927 TTGCCAAGGCTGGTGTGCAGTGG + Intergenic
969756090 4:9152090-9152112 GTCCAAAGGCTGGGGGACAGAGG + Intergenic
969816413 4:9691255-9691277 GTCCAAAGGCTGGAGGACAGAGG + Intergenic
970300100 4:14671968-14671990 TAGCAGGGGCTGGGGGGCAGGGG + Intergenic
970318341 4:14851246-14851268 TACCCCAGGCTGGAGTGCAGTGG + Intergenic
970742975 4:19259598-19259620 TTCCCCAGGCTGGTGGACAGTGG - Intergenic
970959318 4:21854578-21854600 TATCAAAGTCTGGTAGACAGAGG - Intronic
971372750 4:26031394-26031416 TAGCCTAGGCTGGAGGGCAGTGG - Intergenic
971388343 4:26161913-26161935 TACCAGAGACTGGTTAGCAGAGG - Intergenic
972191278 4:36594052-36594074 TAGCACAGGCTGGAGTGCAGTGG - Intergenic
972276454 4:37562638-37562660 TAGAAAAGGCTTGTGGGCAAAGG - Intronic
972563651 4:40250445-40250467 TCCCCCAGGCTGGAGGGCAGTGG - Intergenic
972772286 4:42208751-42208773 TCGCCAAGGCTGGAGGGCAGTGG + Intergenic
972893098 4:43584185-43584207 TTCCAAAGGCTGGGGGTGAGAGG + Intergenic
973150718 4:46884228-46884250 TAGCACAGGCTGGAGTGCAGTGG + Intronic
973690870 4:53429950-53429972 TACCAGAGGCTGGGGGCCACGGG - Intronic
973723924 4:53753214-53753236 TACCAAATGTTGGTGAGCATGGG - Intronic
974017656 4:56663523-56663545 TCCCACAGGCTGGTGTGCAGTGG + Intronic
974051056 4:56942602-56942624 TTGCCAAGGCTGGAGGGCAGTGG + Intergenic
974890703 4:67878884-67878906 TCCCCAAGGCTGGAGTGCAGTGG - Intronic
975341019 4:73240583-73240605 TTGCATAGGCTGGAGGGCAGTGG - Intronic
975666192 4:76737572-76737594 TACCAAATGCTGGTGAGGATGGG - Intronic
976423726 4:84875226-84875248 TACCCCAGGCTGGAGTGCAGTGG - Intronic
976617314 4:87091361-87091383 TACCCCAGGCTGGAGTGCAGTGG - Intronic
976927969 4:90525679-90525701 CATCAAAGGCTGGAGTGCAGTGG + Intronic
977053290 4:92157221-92157243 TACCAGAGACTGGTGGTTAGGGG + Intergenic
977256430 4:94745874-94745896 TACCAAAGGCTGGCAGGTGGGGG + Intergenic
977293585 4:95189324-95189346 TAGCACAGGCTGGAGTGCAGTGG + Intronic
977340396 4:95750470-95750492 TCACCAAGGCTGGAGGGCAGTGG + Intergenic
977346427 4:95822391-95822413 TAGCCCAGGCTGGTGTGCAGTGG + Intergenic
977865064 4:102015690-102015712 TGCCAAAGGCTGGAGGAAAGGGG - Intronic
977958630 4:103059025-103059047 TAACACAGGCTGGAGTGCAGTGG - Intronic
978500836 4:109408420-109408442 TACCCCAGGCTGGAGCGCAGTGG - Intergenic
978703154 4:111673696-111673718 TACCAGAGGCTGGGGGATAGGGG + Intergenic
978844923 4:113262011-113262033 TACCCCAGGCTGGAGTGCAGTGG - Intronic
979299320 4:119068368-119068390 TACCGCAGTCTGGAGGGCAGTGG - Intergenic
980055087 4:128071459-128071481 TCGCCAAGGCTGGAGGGCAGTGG + Intronic
980096114 4:128492614-128492636 TTTCAAAGGCAGGTGGGAAGCGG - Intergenic
980126560 4:128780009-128780031 TCACCAAGGCTGGTGTGCAGTGG - Intergenic
980690643 4:136292350-136292372 TCACAAAGGCTGGAGTGCAGTGG + Intergenic
980912389 4:139005550-139005572 TAACAAGTGCTGGTGAGCAGGGG + Intergenic
980951397 4:139382062-139382084 TGCTAAAGACTAGTGGGCAGGGG - Intronic
980961362 4:139479657-139479679 TCCCACAGGCTGGAGTGCAGTGG - Intergenic
980962862 4:139493577-139493599 TGCCTAAGGCTGGAGTGCAGTGG + Intergenic
981002108 4:139837878-139837900 TAGCACAGGCTGGAGTGCAGTGG - Intronic
981016052 4:139975565-139975587 TACCTAAGGGAGGAGGGCAGTGG - Intronic
981096928 4:140791694-140791716 TCACCAAGGCTGGAGGGCAGTGG + Intergenic
981313458 4:143318510-143318532 TAGCCCAGGCTGGAGGGCAGTGG - Intergenic
981682732 4:147419174-147419196 TCACCAAGGCTGGAGGGCAGTGG + Intergenic
981719741 4:147789327-147789349 TCACCAAGGCTGGTGTGCAGTGG + Intronic
982093730 4:151901520-151901542 TACCAGAGGCTGGGGGAGAGGGG - Intergenic
982104102 4:151996875-151996897 TCCCCCAGGCTGGTGTGCAGTGG - Intergenic
982342234 4:154312507-154312529 TTCCCCAGGCTGGAGGGCAGTGG - Intronic
983102236 4:163639016-163639038 TCCCAGAGACTGGAGGGCAGTGG + Intronic
983138821 4:164122617-164122639 CAGAAAAGACTGGTGGGCAGTGG - Intronic
983165470 4:164471350-164471372 TACCAAAGGCTGGGAAGTAGTGG - Intergenic
983348052 4:166551893-166551915 TAGCCTAGGCTGGAGGGCAGTGG - Intergenic
983820032 4:172181754-172181776 TAACCAAGGCTGGAGTGCAGTGG + Intronic
984077216 4:175197727-175197749 TCCCCAAGGCTGGAGTGCAGTGG - Intergenic
984484110 4:180345026-180345048 TGCGAAAGGCAGGTGGGCAGAGG + Intergenic
984521578 4:180808416-180808438 TCCCAAAGGCTCTTGGGCAAAGG - Intergenic
985223488 4:187732995-187733017 TACCAAAGGCAGGGGAGCATCGG + Intergenic
985337502 4:188912724-188912746 TAACCCAGGCTGGAGGGCAGTGG + Intergenic
1202750579 4_GL000008v2_random:2085-2107 TCACAAAGGCTGGAGTGCAGTGG - Intergenic
985527254 5:412758-412780 TTGCATAGGCTGGAGGGCAGTGG + Intronic
985640784 5:1062664-1062686 TACCCAGGGCTGGGGGGCTGGGG + Intronic
985771013 5:1810809-1810831 TACCAGGGGCTGGGGGGCCGGGG - Intronic
985890716 5:2713387-2713409 TAGCCCAGGCTGGAGGGCAGTGG - Intergenic
986113704 5:4748495-4748517 CACCAAAGGCTGGAGTGCAGTGG - Intergenic
986147799 5:5095533-5095555 TCTCACAGGCTGGAGGGCAGTGG - Intergenic
986248828 5:6036934-6036956 TAGCCCAGGCTGGAGGGCAGTGG + Intergenic
986611514 5:9572606-9572628 TAGCCCAGGCTGGAGGGCAGTGG - Intergenic
987319236 5:16752320-16752342 TTCCACAGGCTGGAGTGCAGTGG + Intronic
987426410 5:17778223-17778245 TAGCCCAGGCTGGAGGGCAGTGG + Intergenic
987734683 5:21825111-21825133 TCCCCCAGGCTGGTGTGCAGTGG - Intronic
987940802 5:24533285-24533307 TGCCACAGGCTGGAGTGCAGTGG - Intronic
988180379 5:27783802-27783824 TCCCCCAGGCTGGTGTGCAGTGG - Intergenic
988228256 5:28442523-28442545 TGCCACAGGCTGGAGTGCAGTGG - Intergenic
988554362 5:32223569-32223591 TTGCCAAGGCTGGTGTGCAGTGG - Intergenic
988573586 5:32396702-32396724 TAGCCAAGGCTGGAGTGCAGTGG - Intronic
988613908 5:32754898-32754920 TAGCCCAGGCTGGAGGGCAGTGG + Intronic
989567572 5:42916353-42916375 TAGCCCAGGCTGGTGTGCAGTGG + Intergenic
989620303 5:43377450-43377472 TCACACAGGCTGGAGGGCAGTGG - Intronic
989791446 5:45407557-45407579 TTCCACAGGCTGGAGTGCAGTGG + Intronic
989800761 5:45535556-45535578 TTCCCTAGGCTGGAGGGCAGTGG - Intronic
989955706 5:50357335-50357357 TAGCACAGGCTGGAGGGCAGTGG + Intergenic
990150225 5:52809543-52809565 TACCCCAGGCTGGAGTGCAGTGG + Intronic
990203533 5:53404757-53404779 TAGCCAAGGCTGGAGTGCAGTGG + Intergenic
990375245 5:55163544-55163566 TCCCCCAGGCTGGAGGGCAGTGG + Intronic
990398771 5:55414687-55414709 TACCAAGGCCTGGAGTGCAGTGG + Intronic
991059424 5:62357121-62357143 TCACCCAGGCTGGTGGGCAGAGG + Intronic
991771644 5:70046451-70046473 TCTCACAGGCTGGTGTGCAGTGG + Intergenic
991774306 5:70069743-70069765 TACCCCAGGCTGGAGTGCAGTGG + Intronic
991850935 5:70921858-70921880 TCTCACAGGCTGGTGTGCAGTGG + Intergenic
991853601 5:70945166-70945188 TACCCCAGGCTGGAGTGCAGTGG + Intronic
992122329 5:73607975-73607997 TACCCCAGGCTGGAGTGCAGTGG + Intergenic
992681001 5:79153152-79153174 TAGCCCAGGCTGGTGTGCAGTGG + Intronic
992820844 5:80494550-80494572 TAACACAGGCTGGAGGGCAGTGG + Intronic
992838205 5:80660835-80660857 TAGCACAGGCTGGAGTGCAGTGG + Intronic
993112917 5:83681548-83681570 TCACAAAGGCTGGAGTGCAGTGG + Intronic
993553696 5:89308192-89308214 TACCAGAGGCTGGGGAGTAGGGG + Intergenic
993554903 5:89324236-89324258 TACCAGAGGCTTGTTGGGAGAGG - Intergenic
993813979 5:92517887-92517909 TAGCACAGGCTGGAGTGCAGGGG + Intergenic
993814194 5:92520661-92520683 TACCAGAGGCTGGAGAGCAGAGG - Intergenic
993913639 5:93714002-93714024 TACTAAAGGCTGGAGGCCACAGG - Intronic
993924136 5:93844402-93844424 TACCCCAGGCTGGAGTGCAGTGG - Intronic
993989095 5:94634315-94634337 TACCAAAGGCTGGATGGAGGTGG - Intronic
994204830 5:97023070-97023092 TACCAGGGGCTGGTGGGGAGAGG - Intronic
994939446 5:106302567-106302589 TCACCCAGGCTGGTGGGCAGTGG - Intergenic
995042088 5:107600524-107600546 TCCCCAAGGCTGGAGTGCAGTGG + Intronic
995729018 5:115216177-115216199 TCACACAGGCTGGAGGGCAGTGG + Intronic
995962262 5:117856624-117856646 TACCTAAGACTGGTGGGCATGGG - Intergenic
995993974 5:118277394-118277416 TAACTAAGGCTGGAGTGCAGTGG + Intergenic
996265011 5:121529282-121529304 TTGCATAGGCTGGAGGGCAGTGG + Intergenic
996374272 5:122787478-122787500 TCCCCCAGGCTGGTGTGCAGTGG - Intronic
996491219 5:124100044-124100066 AATCAAAAGCTGGTAGGCAGTGG + Intergenic
996629333 5:125608617-125608639 TAGCACAGGCTGGAGTGCAGTGG + Intergenic
996892441 5:128438028-128438050 TACTACAGGCTGGAGTGCAGTGG + Intronic
996965290 5:129300917-129300939 TAGCCCAGGCTGGAGGGCAGTGG + Intergenic
997086103 5:130801470-130801492 TGCCAGAGGCTGGTGGGTTGGGG + Intergenic
997111112 5:131075688-131075710 TACCCAAGGCTGAAGTGCAGTGG - Intergenic
997126444 5:131232151-131232173 TAGCCCAGGCTGGAGGGCAGTGG + Intergenic
997185711 5:131879957-131879979 TTCCCCAGGCTGGAGGGCAGTGG + Intronic
997519018 5:134510558-134510580 TCACACAGGCTGGAGGGCAGTGG + Intergenic
997565553 5:134883385-134883407 TAGCACAGGCTGGAGTGCAGTGG - Intronic
997943669 5:138180713-138180735 TCCCCCAGGCTGGTGTGCAGTGG + Intronic
997950007 5:138234902-138234924 TCCCCAAGGCTGGAGTGCAGTGG - Intergenic
997958510 5:138299454-138299476 TCCCCCAGGCTGGAGGGCAGTGG - Intronic
998119995 5:139568302-139568324 TTGCAAAGGCTGGAGTGCAGTGG - Intronic
998438081 5:142130992-142131014 TGCCCCAGGCTGGAGGGCAGTGG + Intronic
998877679 5:146617212-146617234 TACCAGAGGTTGGGGGGCAGGGG + Intronic
999027254 5:148248317-148248339 TAGCACAGGCTGGAGTGCAGTGG + Intergenic
999158179 5:149473387-149473409 TCGCGAAGGCTGGAGGGCAGTGG - Intergenic
999287294 5:150401831-150401853 GGCCAAAGGCTGGAGGGGAGAGG + Intronic
999294559 5:150450517-150450539 TAGCCAAGGCTGGAGTGCAGTGG + Intergenic
1000002856 5:157156321-157156343 TTTCACAGGCTGGTGTGCAGTGG + Intronic
1000039583 5:157475170-157475192 TCCCCCAGGCTGGAGGGCAGTGG + Intronic
1000454708 5:161435664-161435686 TAGTACAGGATGGTGGGCAGAGG + Intronic
1000540519 5:162533346-162533368 TACCCCAGGCTGGAGTGCAGTGG - Intergenic
1000592616 5:163176784-163176806 TCCCCCAGGCTGGAGGGCAGTGG + Intergenic
1000774098 5:165395690-165395712 TAGCCCAGGCTGGAGGGCAGTGG + Intergenic
1001334462 5:170785813-170785835 AGCCAAGGGCTGGTGGGAAGAGG + Intronic
1001477408 5:172060365-172060387 TAGCCAAGGCTGGAGTGCAGTGG - Intronic
1001585611 5:172832214-172832236 TCGCACAGGCTGGAGGGCAGTGG + Intergenic
1001625428 5:173128818-173128840 TACCCCAGGCTGGAGTGCAGTGG + Intronic
1002042186 5:176522544-176522566 TACCCCAGGCTGGAGTGCAGTGG + Intergenic
1002048742 5:176557053-176557075 TGCCCAAGGCTGGAGTGCAGTGG + Intronic
1002113497 5:176938148-176938170 TAGCCCAGGCTGGAGGGCAGTGG - Intronic
1002146751 5:177189995-177190017 TAGCACAGGCTGGAGTGCAGTGG + Intronic
1002320619 5:178373454-178373476 TGCCCAAGGCTGGAGTGCAGTGG + Intronic
1002379464 5:178815962-178815984 TCCCCAAGGCTGGAGTGCAGCGG + Intergenic
1002398324 5:178975239-178975261 TACCCCAGGCTGGAGTGCAGTGG - Intergenic
1002497560 5:179625450-179625472 TAGCCCAGGCTGGAGGGCAGTGG - Intronic
1002997395 6:2299544-2299566 TCACCAAGGCTGGAGGGCAGTGG - Intergenic
1003081133 6:3022667-3022689 CACCCAAGGCTGGAGTGCAGTGG - Intergenic
1003570338 6:7252382-7252404 TCCCCCAGGCTGGAGGGCAGAGG - Intergenic
1003656197 6:8011907-8011929 TAACCAAGGCTGGAGTGCAGTGG + Intronic
1003670948 6:8158968-8158990 TAGCACAGGCTGGAGTGCAGTGG + Intergenic
1003823646 6:9928021-9928043 TAGCCCAGGCTGGTGTGCAGTGG - Intronic
1004001010 6:11597343-11597365 TACCAGGGGCTGGGGGGCAGGGG - Intergenic
1004048193 6:12046898-12046920 TAGCACAGGCTGGAGTGCAGTGG + Intronic
1004696094 6:18034238-18034260 TACCCCAGGCTGGAGTGCAGTGG - Intergenic
1004696740 6:18041093-18041115 TAGCCCAGGCTGGAGGGCAGTGG - Intergenic
1004707766 6:18140642-18140664 TCACACAGGCTGGAGGGCAGTGG - Intronic
1004735122 6:18398147-18398169 TACCAGGGGCTGGTGGGAGGGGG - Intronic
1004793115 6:19051030-19051052 TGGGAAGGGCTGGTGGGCAGGGG - Intergenic
1005037647 6:21571607-21571629 TCACCAAGGCTGGAGGGCAGTGG + Intergenic
1005330128 6:24741710-24741732 TAGCCCAGGCTGGAGGGCAGTGG - Intergenic
1005649210 6:27871297-27871319 TAGCCCAGGCTGGAGGGCAGTGG + Intergenic
1005691951 6:28315180-28315202 TTCCAAAGACTGGTGAGAAGCGG - Intergenic
1005745479 6:28833104-28833126 TCCCCAAGGCTGGAGTGCAGTGG - Intergenic
1005938184 6:30540358-30540380 TACCAGAGGCTGGGGGTCTGGGG + Intergenic
1005949886 6:30624130-30624152 CACCCAAGGCTGGAGTGCAGTGG + Intronic
1005993669 6:30919156-30919178 TCACCAAGGCTGGAGGGCAGTGG + Intronic
1006039213 6:31239806-31239828 TATCACAGGCTGGAGTGCAGTGG - Intergenic
1006252136 6:32796773-32796795 TCCCACAGGCTGGAGTGCAGTGG - Intergenic
1006762582 6:36476467-36476489 TCACCAAGGCTGGAGGGCAGTGG + Intronic
1006768755 6:36533024-36533046 TTGCACAGGCTGGAGGGCAGTGG - Intronic
1006774200 6:36579203-36579225 TACCCCAGGCTGGAGTGCAGTGG - Intergenic
1006788872 6:36685945-36685967 TGCCAGAGGCTGGGGGGCAGGGG - Exonic
1006886423 6:37385872-37385894 TGAAAAAGGCTGGTGTGCAGTGG + Intronic
1007154311 6:39727126-39727148 TACCCCAGGCTGGAGTGCAGTGG + Intergenic
1007429072 6:41766090-41766112 TAGCCCAGGCTGGAGGGCAGTGG - Intergenic
1007452986 6:41954209-41954231 TACCCCAGGCTGGAGTGCAGCGG - Intronic
1007536699 6:42597555-42597577 CGCCCAAGGCTGGAGGGCAGTGG - Intronic
1007545885 6:42694231-42694253 TCCCACAGGCTGGAGTGCAGTGG + Intergenic
1007569444 6:42879039-42879061 TCGCCCAGGCTGGTGGGCAGTGG + Intergenic
1007591756 6:43025581-43025603 TCCCACAGGCTGTAGGGCAGTGG - Intronic
1007798379 6:44369830-44369852 TCCCCAAGGCTGGAGTGCAGTGG - Intronic
1008218572 6:48825944-48825966 TACCTAAGGCTGGTGGGAAATGG + Intergenic
1008984397 6:57525063-57525085 AAGCAAAGGCAGGTGGGCAGGGG - Intronic
1009058735 6:58371828-58371850 TCACAAAGGCTGGAGTGCAGTGG - Intergenic
1009172449 6:60417962-60417984 AAGCAAAGGCAGGTGGGCAGGGG - Intergenic
1009232101 6:61075289-61075311 TCACAAAGGCTGGAGTGCAGTGG + Intergenic
1009424089 6:63495496-63495518 TAGCACAGGCTGGAGTGCAGTGG + Intergenic
1010064266 6:71662844-71662866 GACCAAAAGCTGGTGGGGAAGGG + Intergenic
1010488278 6:76442836-76442858 TACCAGAGGCTGGTGGATGGGGG - Intergenic
1010632214 6:78211413-78211435 TGCCAAGGGCTGGAGGGGAGAGG - Intergenic
1010960714 6:82142643-82142665 TCACAAAGGCTGGAGTGCAGTGG - Intergenic
1011136337 6:84104826-84104848 TAGCCCAGGCTGGAGGGCAGTGG - Intergenic
1011301974 6:85885239-85885261 TGCCAGAGGCTGGAGGGTAGAGG + Intergenic
1011467876 6:87677035-87677057 CACCCAAGGCTGGAGTGCAGTGG - Intronic
1011617037 6:89206653-89206675 TGCCCAAGGCTGGAGTGCAGTGG + Intronic
1011669214 6:89665999-89666021 TCCCCAAGGCTGGAGTGCAGTGG - Intronic
1011680644 6:89780024-89780046 TCCCCAAGGCTGGAGTGCAGTGG - Intronic
1012119380 6:95345200-95345222 TCCCACAGGCTGGAGTGCAGTGG + Intergenic
1012175584 6:96078458-96078480 TCCCACAGGCTGGAGTGCAGTGG + Intronic
1012454283 6:99387409-99387431 TACCCTAGGCTGGAGTGCAGCGG - Intronic
1012470243 6:99564383-99564405 TACCCCAGGCTGGAGTGCAGTGG - Intronic
1012494186 6:99816233-99816255 TAGCCAAGGCTGGAGTGCAGTGG + Intergenic
1012748210 6:103122205-103122227 TATCAAAGGATGGAGGGTAGGGG + Intergenic
1012973009 6:105751721-105751743 TACCAGAGGATAGTGGGGAGGGG - Intergenic
1013058306 6:106606378-106606400 TAACCCAGGCTGGAGGGCAGTGG - Intronic
1013133492 6:107257495-107257517 TACCCCAGGCTGGAGTGCAGTGG - Intronic
1013177933 6:107693180-107693202 TCCCACAGGCTGGAGTGCAGTGG + Intergenic
1013287392 6:108693168-108693190 TCCCCCAGGCTGGAGGGCAGTGG + Intergenic
1013506225 6:110803117-110803139 TAGCCCAGGCTGGAGGGCAGTGG + Intronic
1013520853 6:110932081-110932103 TAGCCCAGGCTGGTGTGCAGTGG + Intergenic
1013538339 6:111083933-111083955 TCCCCGAGGCTGGAGGGCAGTGG - Intergenic
1014187229 6:118448487-118448509 TACCTCAGGCTGGAGTGCAGTGG - Intergenic
1014792996 6:125695817-125695839 TACCAAAGGCTGGGGTGGGGAGG + Intergenic
1015273959 6:131365491-131365513 TCCCCCAGGCTGGGGGGCAGTGG - Intergenic
1015519802 6:134118776-134118798 TAGCCCAGGCTGGAGGGCAGTGG - Intergenic
1015533784 6:134246630-134246652 TACCCCAGGCTGGAGTGCAGTGG + Intronic
1015543687 6:134341362-134341384 TCCCACAGGCTGGAGTGCAGTGG + Intergenic
1015724558 6:136287098-136287120 TCGCCAAGGCTGGTGTGCAGTGG - Intronic
1016108638 6:140193672-140193694 TTCCCAAGGCTGGAGTGCAGTGG + Intergenic
1016473107 6:144396359-144396381 TACCAGGGGCTGGTGGGTATGGG + Intronic
1016581179 6:145630573-145630595 TCCCAGAGGCTGGTGTGCAGTGG - Intronic
1016795509 6:148113250-148113272 CACCCAAGGCTGGAGTGCAGTGG + Intergenic
1016933953 6:149435421-149435443 TTGCCAAGGCTGGAGGGCAGTGG + Intergenic
1017578584 6:155834778-155834800 TCCCCCAGGCTGGAGGGCAGTGG + Intergenic
1017588171 6:155949135-155949157 TCACCAAGGCTGGAGGGCAGTGG + Intergenic
1017641252 6:156496550-156496572 TCCCCAAGGCTGGAGTGCAGTGG + Intergenic
1017878300 6:158541943-158541965 TACTAAAGGCTGGAGTGCAGTGG + Intronic
1018351925 6:162969005-162969027 TTCCCCAGGCTGGAGGGCAGTGG - Intronic
1018553231 6:165022879-165022901 CACCCAAGGCTGGAGTGCAGGGG - Intergenic
1018667757 6:166155153-166155175 TTCCCAAGGCTGGAGTGCAGTGG - Intergenic
1018960777 6:168447104-168447126 TCCCATAGGCTGGAGTGCAGTGG + Intronic
1018993182 6:168690203-168690225 TAACCAAGGCTGGAGTGCAGTGG + Intergenic
1019492461 7:1321769-1321791 TCCCAAAGGAGGGTGGTCAGCGG + Intergenic
1019580773 7:1760981-1761003 TCCCCAAGGCTGGAGAGCAGTGG - Intergenic
1019973101 7:4557976-4557998 TCCCCAAGGCTGGAGTGCAGTGG + Intergenic
1020055639 7:5116200-5116222 TTGCCAAGGCTGGAGGGCAGTGG - Intergenic
1020076467 7:5262028-5262050 TCCCACAGGCTGGAGTGCAGTGG - Intergenic
1020256750 7:6506719-6506741 TACCCCAGGCTGGAGTGCAGTGG + Intronic
1020320005 7:6932796-6932818 TTCCCAAGGCTGGAGTGCAGTGG + Intergenic
1020372068 7:7442993-7443015 TCCCACAGGCTGGAGTGCAGTGG - Intronic
1020939907 7:14519254-14519276 TGCCTGAGGCTGGTGGTCAGAGG - Intronic
1021129319 7:16892069-16892091 TACAAACAGCTGGAGGGCAGGGG + Intergenic
1021689307 7:23216705-23216727 TCACCAAGGCTGGAGGGCAGTGG - Intergenic
1021942519 7:25692351-25692373 TGCCAAGGGCTGAGGGGCAGAGG + Intergenic
1022235284 7:28454847-28454869 GACCCAGGGCTGGTGGGCAGTGG + Intronic
1022299146 7:29086250-29086272 TGCCAAGGGCTGGAGTGCAGTGG - Intronic
1022386361 7:29902799-29902821 TGCCACAGGCTGGAGTGCAGTGG - Intronic
1023097227 7:36673495-36673517 TAGCCCAGGCTGGAGGGCAGTGG - Intronic
1023491873 7:40751649-40751671 GACCACAGCATGGTGGGCAGAGG - Intronic
1023589751 7:41768896-41768918 TGCCAAAGGCTGGGGGGCAGGGG - Intergenic
1023611706 7:41978335-41978357 TACCATAAGCTGTTGGGCTGCGG + Intronic
1023781041 7:43655620-43655642 TCTCAAAGGCTGGAGTGCAGTGG - Intronic
1023914336 7:44577294-44577316 TCCCCAAGGCTGGAGTGCAGTGG - Intergenic
1024032738 7:45478018-45478040 TCTCAAAGGCTGGAGTGCAGTGG - Intergenic
1024045660 7:45583985-45584007 TAGCCAAGGCTGGAGTGCAGTGG + Intronic
1024111903 7:46155472-46155494 AACCAGGGGCTGGAGGGCAGGGG - Intergenic
1024317185 7:48032088-48032110 TGCCAGTGGCTGATGGGCAGAGG + Intergenic
1025074285 7:55929096-55929118 TAGCCCAGGCTGGTGTGCAGTGG - Intronic
1025168900 7:56738037-56738059 TCCCCAAGGCTGGTGTACAGTGG - Intergenic
1025203917 7:56980519-56980541 TCCCAATGGCTTGTGGGCAAGGG + Intergenic
1025214460 7:57044152-57044174 TGCCCAAGGCTGGAGTGCAGTGG - Intergenic
1025607257 7:63048198-63048220 CACCAAAGAATGGTGGGGAGGGG - Intergenic
1025657494 7:63532661-63532683 TGCCCAAGGCTGGAGTGCAGTGG + Intergenic
1025668023 7:63596412-63596434 TCCCAATGGCTTGTGGGCAAGGG - Intergenic
1025703489 7:63841860-63841882 TCCCCAAGGCTGGTGTACAGTGG + Intergenic
1026039144 7:66852347-66852369 TAGCCCAGGCTGGAGGGCAGTGG + Intergenic
1026132593 7:67632731-67632753 TATCAGAGGCTGGAGTGCAGGGG + Intergenic
1026144089 7:67730540-67730562 TAACACAGGCTGGAGTGCAGTGG - Intergenic
1026357715 7:69573809-69573831 TCACCAAGGCTGGTGTGCAGTGG - Intergenic
1026392477 7:69915764-69915786 TCACCAAGGCTGGTGTGCAGTGG + Intronic
1026421891 7:70247347-70247369 TGTCAGAGGCTGGTGGGAAGAGG + Intronic
1026559480 7:71436299-71436321 TTGCCAAGGCTGGTGTGCAGTGG - Intronic
1026651465 7:72219263-72219285 TGCCCAAGGCTGGAGTGCAGTGG + Intronic
1026770791 7:73197246-73197268 TACCCAAGACTGGAGTGCAGTGG + Intergenic
1026793012 7:73346921-73346943 TAACAGAGGTGGGTGGGCAGAGG + Intronic
1026908585 7:74079009-74079031 TCACCCAGGCTGGTGGGCAGTGG - Intergenic
1026952691 7:74358089-74358111 TTCCCCAGGCTGGAGGGCAGTGG + Intronic
1026989132 7:74573360-74573382 TTGCCCAGGCTGGTGGGCAGTGG - Intronic
1027011659 7:74750643-74750665 TACCCAAGACTGGAGTGCAGTGG + Intronic
1027076381 7:75195408-75195430 TACCCAAGACTGGAGTGCAGTGG - Intergenic
1027265527 7:76493265-76493287 TTCCCCAGGCTGGTGTGCAGTGG + Intronic
1027316898 7:76991382-76991404 TTCCCCAGGCTGGTGTGCAGTGG + Intergenic
1027702489 7:81485969-81485991 TCCCCAAGGCTGGAGCGCAGTGG + Intergenic
1028180840 7:87722355-87722377 TACCAGAGGCTGGGGGGTAGGGG - Intronic
1028190463 7:87844784-87844806 TACTAAAAGCTGGGGGGCAGTGG + Intronic
1028203518 7:87990700-87990722 TAGCCCAGGCTGGAGGGCAGTGG + Intronic
1028213939 7:88108687-88108709 TCCCACAGGCTGGAGTGCAGTGG - Intronic
1028510246 7:91617627-91617649 TCCCCCAGGCTGGAGGGCAGTGG + Intergenic
1028551211 7:92068324-92068346 TCCCCAAGGCTGGAGTGCAGTGG - Intronic
1028847687 7:95500528-95500550 TCACACAGGCTGGTGTGCAGTGG - Intronic
1028949077 7:96613703-96613725 TACCAGAGGCTGGGTGGGAGTGG - Intronic
1029063214 7:97820524-97820546 TCCCACAGGCTGGAGTGCAGTGG - Intergenic
1029087033 7:98019845-98019867 TCCCACAGGCTGGAGTGCAGTGG + Intergenic
1029097768 7:98102730-98102752 TAGCACAGGCTGGAGTGCAGTGG + Intergenic
1029165179 7:98583742-98583764 TGCCCAAGGCTGGAGGGCATTGG + Intergenic
1029193599 7:98788888-98788910 TCCCCCAGGCTGGAGGGCAGTGG - Intergenic
1029266042 7:99341267-99341289 TACCCCAGGCTGGAGTGCAGTGG - Intronic
1029277620 7:99416758-99416780 TTCCACAGGCTGGAGTGCAGTGG + Exonic
1029307614 7:99631996-99632018 TTCCAAAGGCAGGTGGGGACTGG + Exonic
1029411445 7:100414453-100414475 TCACCAAGGCTGGAGGGCAGTGG + Intronic
1029445578 7:100610818-100610840 TCACACAGGCTGGAGGGCAGTGG - Intergenic
1029484851 7:100833891-100833913 TACCTGAGGCTGGAGTGCAGTGG - Intronic
1029487046 7:100849673-100849695 TGCCCAAGGCTGTAGGGCAGTGG - Intronic
1029559786 7:101294995-101295017 TCCCCCAGGCTGGAGGGCAGTGG + Intergenic
1029628608 7:101736147-101736169 TTGCCCAGGCTGGTGGGCAGTGG - Intergenic
1030029403 7:105354901-105354923 TACCTAGAGCTGGTGGGGAGGGG - Intronic
1030577349 7:111305512-111305534 TACCAGAGGCTGCAGTGCAGTGG + Intronic
1031206218 7:118761104-118761126 GACCACAGGTAGGTGGGCAGTGG + Intergenic
1031259428 7:119499252-119499274 TACCAGAGGCTGGCAGGTAGGGG - Intergenic
1031325440 7:120391073-120391095 TACCAGGGCCTGTTGGGCAGTGG - Intronic
1031389689 7:121198935-121198957 TACCACTCGTTGGTGGGCAGGGG - Intronic
1031401094 7:121327388-121327410 TGCCATAGGCTGGAGTGCAGTGG + Intronic
1031569007 7:123334926-123334948 TTCCACAGGCTGGAGCGCAGTGG - Intergenic
1031750727 7:125569595-125569617 TGACACAGGCTGGAGGGCAGTGG + Intergenic
1031820871 7:126499781-126499803 TACCAGAGGCTGGGGGGAGGTGG + Intronic
1032066758 7:128776944-128776966 TCCCACAGGCTGGAGTGCAGTGG - Intergenic
1032075605 7:128834407-128834429 TGTCAAAGGCTGGGGGCCAGAGG - Intronic
1032340711 7:131070060-131070082 TACCCCAGGCTGGAGTGCAGTGG - Intergenic
1032848790 7:135774720-135774742 TCCCCAAGGCTGGAGTGCAGTGG + Intergenic
1032918477 7:136518481-136518503 TCACCAAGGCTGGAGGGCAGTGG + Intergenic
1033082592 7:138312269-138312291 TCCCTCAGGCTGGAGGGCAGTGG - Intergenic
1033324273 7:140364209-140364231 TACCCCAGGCTGGAGTGCAGTGG - Intronic
1033363069 7:140651558-140651580 TACCCCAGGCTGGAGTGCAGTGG + Intronic
1033794504 7:144831635-144831657 TACCCTAGGCTGGAGTGCAGTGG - Intronic
1034916877 7:155047510-155047532 TCGCCCAGGCTGGTGGGCAGTGG + Intergenic
1035457025 7:159015439-159015461 TCAGAAAGGCTGGTGTGCAGAGG - Intergenic
1035558957 8:590705-590727 TGCCAGAGGCTGGGGGCCAGGGG + Intergenic
1035586672 8:780787-780809 CACCAAAGGCTGGTGCCCTGTGG + Intergenic
1035753460 8:2011784-2011806 TAGCCCAGGCTGGAGGGCAGTGG - Intergenic
1036010620 8:4718015-4718037 TACCCCAGGCTGGAGGGCAGTGG + Intronic
1036176409 8:6542413-6542435 TTCCAAAGCTTGGTGGGCAATGG + Intronic
1036248874 8:7144736-7144758 TATCACAGGCTGGAGTGCAGTGG - Intergenic
1036379337 8:8227395-8227417 GTCCAAAGGCTGGGGGACAGAGG + Intergenic
1036656300 8:10679550-10679572 TACCCAGGGCTGGAGGGCACAGG - Intronic
1036705228 8:11041514-11041536 TCACCAAGGCTGGAGGGCAGTGG - Intronic
1036777676 8:11624828-11624850 CACCAAAGAATGGTGGGGAGGGG + Intergenic
1036790575 8:11715872-11715894 TACCAGGGGCTGGTGTGGAGAGG - Intronic
1036850225 8:12195218-12195240 GTCCAAAGGCTGGGGGACAGAGG - Intergenic
1036871586 8:12437491-12437513 GTCCAAAGGCTGGGGGACAGAGG - Intergenic
1036941158 8:13054007-13054029 CACCCAAGGCTGGAGTGCAGTGG + Intergenic
1036986808 8:13541587-13541609 TCGCCAAGGCTGGTGTGCAGTGG + Intergenic
1037012824 8:13866064-13866086 TCACACAGGCTGGAGGGCAGTGG + Intergenic
1037149301 8:15616535-15616557 TCACACAGGCTGGAGGGCAGTGG - Intronic
1037270192 8:17118568-17118590 TACCAGAGGCTGGAAGGCTGGGG - Intronic
1037785274 8:21899266-21899288 CACCCAAGGCTGGAGTGCAGTGG - Intergenic
1038534971 8:28347298-28347320 TACCCGAGGCAGCTGGGCAGTGG + Exonic
1038649977 8:29393797-29393819 TACCCCAGGCTGGAGTGCAGTGG + Intergenic
1038684680 8:29705498-29705520 TCACACAGGCTGGAGGGCAGTGG - Intergenic
1038748732 8:30277187-30277209 TCCCCAAGGCTGGAGTGCAGTGG + Intergenic
1038789386 8:30655155-30655177 TCCCCCAGGCTGGAGGGCAGTGG - Intronic
1039054593 8:33525377-33525399 TCGCCCAGGCTGGTGGGCAGTGG - Intergenic
1039069726 8:33638742-33638764 TACCAGAGGCTGGGGGGATGGGG - Intergenic
1039368496 8:36959384-36959406 AACCAAAGGCTGGTGACCACTGG - Intergenic
1039652618 8:39358509-39358531 TCCCACAGGCTGGAGTGCAGAGG - Intergenic
1039687910 8:39826681-39826703 TAGCCAAGGCTGGAGTGCAGTGG - Intronic
1039968884 8:42305044-42305066 TACCTCAGGGTGGAGGGCAGGGG - Intronic
1040013657 8:42682765-42682787 TACCCTAGGCTGGAGTGCAGTGG - Intergenic
1040437817 8:47409986-47410008 TCACACAGGCTGGTGTGCAGAGG - Intronic
1040503887 8:48029287-48029309 TTGCCCAGGCTGGTGGGCAGTGG - Intronic
1040914286 8:52553306-52553328 TCACCAAGGCTGGAGGGCAGTGG - Intronic
1041006266 8:53499558-53499580 TCCCACAGGCTGGAGTGCAGTGG + Intergenic
1041320833 8:56610907-56610929 TACCACAGGCTGGTGGGCCTGGG - Intergenic
1041517073 8:58712163-58712185 TGCCTAGGGCTGGTGGGGAGAGG + Intergenic
1041692676 8:60704291-60704313 TGCCCAAGGCTGGTGGACAGTGG + Intronic
1041763795 8:61395285-61395307 TACCAGAGGCTGGGGGAGAGGGG + Intronic
1041920162 8:63173281-63173303 TACCCCAGGCTGGAGTGCAGTGG + Intronic
1042576874 8:70230305-70230327 TGCCAAGGGCTGGAGGGAAGGGG + Intronic
1042809853 8:72812226-72812248 TAGCCCAGGCTGGAGGGCAGTGG - Intronic
1043294051 8:78642409-78642431 TACCAAAGGCTGAGGGGCAGGGG - Intergenic
1043343123 8:79266239-79266261 GACCAATGGCATGTGGGCAGAGG - Intergenic
1043493906 8:80779279-80779301 TCCCCCAGGCTGGTGTGCAGTGG + Intronic
1043891159 8:85654238-85654260 TTCCGAAAGCTGGTGGGCCGGGG + Intergenic
1043892235 8:85661075-85661097 TTCCGAAAGCTGGTGGGCCGGGG + Intergenic
1043893328 8:85716265-85716287 TTCCGAAAGCTGGTGGGCCGGGG - Intergenic
1043896011 8:85737714-85737736 TTCCGAAAGCTGGTGGGCCGGGG - Intergenic
1043896668 8:85744094-85744116 TTCCGAAAGCTGGTGGGCCGGGG + Intergenic
1043898991 8:85762461-85762483 TTCCGAAAGCTGGTGGGCCGGGG + Intergenic
1043900602 8:85774655-85774677 TTCCGAAAGCTGGTGGGCCGGGG + Intergenic
1043902566 8:85789930-85789952 TTCCGAAAGCTGGTGGGCCGGGG + Intergenic
1043904176 8:85802123-85802145 TTCCGAAAGCTGGTGGGCCGGGG + Intergenic
1043905788 8:85814317-85814339 TTCCGAAAGCTGGTGGGCCGGGG + Intergenic
1043907396 8:85826504-85826526 TTCCGAAAGCTGGTGGGCCGGGG + Intergenic
1044027779 8:87195266-87195288 TCACACAGGCTGGAGGGCAGTGG + Intronic
1044237488 8:89848073-89848095 TACCAGAGGCTGGGGTGGAGTGG + Intergenic
1044816260 8:96116490-96116512 TCCCCCAGGCTGGAGGGCAGTGG + Intergenic
1045041268 8:98227032-98227054 TACCTGAGGGTGGTGGACAGAGG - Intronic
1045198494 8:99954113-99954135 TTCCCCAGGCTGGAGGGCAGTGG - Intergenic
1045198751 8:99957140-99957162 TCACCCAGGCTGGTGGGCAGTGG + Intergenic
1045361844 8:101440190-101440212 TGCCCAAGGCTGGAGTGCAGTGG - Intergenic
1045453222 8:102349473-102349495 TAGCCAAGGCTGGAGTGCAGTGG - Intronic
1045762342 8:105625618-105625640 TACCCCAGGCTGGAGTGCAGTGG + Intronic
1046498794 8:115048410-115048432 TCCCACAGGCTGGAGTGCAGTGG + Intergenic
1046945733 8:119972581-119972603 TCACAAAGGCTGGAGTGCAGTGG - Intronic
1047143465 8:122168955-122168977 TCCCAAAGGTTGGAGTGCAGTGG - Intergenic
1047158796 8:122352988-122353010 TCCCCCAGGCTGGTGTGCAGTGG + Intergenic
1047487403 8:125343964-125343986 TTCCCCAGGCTGGTGTGCAGTGG - Intronic
1047499010 8:125428405-125428427 TCCCCAAGGCTGGAGTGCAGTGG + Intergenic
1048119674 8:131564800-131564822 TAGCCTAGGCTGGTGTGCAGTGG - Intergenic
1048203065 8:132392750-132392772 TTCCCAAGGCTGGAGTGCAGTGG - Intronic
1048484981 8:134838980-134839002 TAGCACAGGCTGGAGGGCAGTGG - Intergenic
1049467417 8:142758010-142758032 TATCAAAGGCTGGAGTGCAACGG + Intergenic
1049689942 8:143953969-143953991 AACCACAGGCTGGGGGGGAGGGG - Intronic
1049831417 8:144703775-144703797 TCCCCAAGGCTGGAGTGCAGTGG + Intergenic
1050118449 9:2284234-2284256 TCACACAGGCTGGTGTGCAGTGG + Intergenic
1050159741 9:2705367-2705389 TCACAAAGGCTGGAGTGCAGTGG - Intergenic
1051058775 9:13021220-13021242 TACCAGAGGCTGGTGGGGGGGGG + Intergenic
1051080748 9:13290640-13290662 TAACAATGGTTGGGGGGCAGTGG + Intergenic
1051115315 9:13687413-13687435 TAGCCCAGGCTGGAGGGCAGTGG - Intergenic
1051453404 9:17223715-17223737 TATCAATGGCTGGTGGGTTGAGG - Intronic
1051753738 9:20372435-20372457 TCACAAAGGCTGGAGTGCAGTGG + Intronic
1051778223 9:20659178-20659200 TTCCCTAGGCTGGAGGGCAGTGG - Intronic
1052073525 9:24112394-24112416 TCACCAAGGCTGGTGTGCAGTGG + Intergenic
1052656472 9:31369091-31369113 TGCCAAAGGCTGGAGTGCAATGG - Intergenic
1052906682 9:33841120-33841142 TCCCCCAGGCTGGTGTGCAGTGG + Intronic
1053007487 9:34613711-34613733 TAACAAAGGCAGGTTGGCATAGG + Exonic
1053238934 9:36480589-36480611 TTCCCCAGGCTGGAGGGCAGTGG + Intronic
1053244399 9:36522646-36522668 TCACAAAGGCTGGAGGGCAGTGG - Intergenic
1053550733 9:39076915-39076937 TCGCAAAGGCTGGAGTGCAGTGG - Intronic
1053585838 9:39457712-39457734 TACCAGAGGCTGGGGGTGAGGGG + Intergenic
1053623313 9:39842942-39842964 TTCCCAAGGCTGGAGTGCAGTGG + Intergenic
1053814846 9:41897009-41897031 TCGCAAAGGCTGGAGTGCAGTGG - Intronic
1053844029 9:42218000-42218022 TCCCCCAGGCTGGAGGGCAGTGG + Intergenic
1053881556 9:42600286-42600308 TTCCCAAGGCTGGAGTGCAGTGG - Intergenic
1053890386 9:42686201-42686223 TCCCCAAGGCTGGAGTGCAGTGG - Intergenic
1053891111 9:42694026-42694048 TTCCCAAGGCTGGAGTGCAGTGG + Intergenic
1054220587 9:62407757-62407779 TTCCCAAGGCTGGAGTGCAGTGG - Intergenic
1054230128 9:62501415-62501437 TTCCCAAGGCTGGAGTGCAGTGG + Intergenic
1054580468 9:66907510-66907532 TACCAGAGGCTGGGGGTGAGGGG - Intronic
1054615750 9:67290432-67290454 TCGCAAAGGCTGGAGTGCAGTGG + Intergenic
1055051536 9:71986452-71986474 TACCAAGCGATGGTGGGCTGGGG - Intergenic
1055332577 9:75199178-75199200 AACCATAGTTTGGTGGGCAGGGG + Intergenic
1056029142 9:82533570-82533592 TACCCCAGGCTGGAGTGCAGTGG + Intergenic
1056323054 9:85454919-85454941 TCACAAAGGCTGGAGTGCAGTGG + Intergenic
1056526814 9:87450838-87450860 CACCAAGGGCTGTTGGGGAGTGG - Intergenic
1056636874 9:88338548-88338570 TTCCACAGGCTGGAGTGCAGTGG - Intergenic
1057411082 9:94817038-94817060 TACCCAAGGCTGAAGTGCAGTGG + Intronic
1057524037 9:95783950-95783972 TGGGAAAGGCTGGTGGGAAGGGG + Intergenic
1058360775 9:104143724-104143746 TGCCAAGGGCTGGGGAGCAGGGG - Intergenic
1058736732 9:107900544-107900566 TGCCAAGGGGTGGTGGGCTGAGG + Intergenic
1058919183 9:109597041-109597063 TCACACAGGCTGGAGGGCAGTGG - Intergenic
1059134674 9:111794210-111794232 TGCCTTAGGCTGGTGGGGAGAGG - Intronic
1059174018 9:112152792-112152814 TAACCAAGGCTGGAGTGCAGTGG + Intronic
1059232916 9:112738147-112738169 TCCCACAGGCTGGAGTGCAGTGG + Intergenic
1059275485 9:113093165-113093187 TACTAATGGCTGGTGGGAGGTGG + Intergenic
1059733022 9:117075315-117075337 GATCACAGGCTGCTGGGCAGAGG - Intronic
1060190832 9:121591427-121591449 TGCCCAAGGCTGGAGTGCAGTGG - Intronic
1061068446 9:128293964-128293986 TGCCACAGGCTGGAGTGCAGTGG + Intergenic
1061402616 9:130376623-130376645 TACCAGCGGATGGTGGGCGGGGG - Intronic
1061433535 9:130546335-130546357 TTGCACAGGCTGGAGGGCAGTGG - Intergenic
1061646057 9:132002873-132002895 TACCCCAGGCTGGGGTGCAGTGG - Intronic
1061819379 9:133217651-133217673 CACCCAAGGCAGGTGGGCTGGGG - Intergenic
1062222789 9:135427037-135427059 TCGCCCAGGCTGGTGGGCAGTGG - Intergenic
1062322943 9:135999220-135999242 GGCCAAAGGCTGGAGTGCAGTGG + Intergenic
1062483819 9:136764494-136764516 CACCAGGGGCTGGAGGGCAGGGG - Exonic
1062598243 9:137308674-137308696 TCCCCAAGGCTGGAGTGCAGTGG + Intronic
1062612501 9:137381453-137381475 CACCACAGGCTGCTGGGCAGTGG + Intronic
1062613565 9:137386252-137386274 TCCCCCAGGCTGGAGGGCAGTGG - Intronic
1203733136 Un_GL000216v2:109111-109133 TCCCACAGGCTGGAGTGCAGTGG - Intergenic
1203734351 Un_GL000216v2:121780-121802 TCCCACAGGCTGGAGTGCAGTGG + Intergenic
1185537449 X:873322-873344 TTGCCAAGGCTGGAGGGCAGTGG - Intergenic
1185573617 X:1153189-1153211 TAGCCAAGGCTGGAGTGCAGTGG - Intergenic
1185663101 X:1742634-1742656 CACCCAAGGCTGGAGTGCAGTGG - Intergenic
1185881262 X:3743273-3743295 TAGCACAGGCTGGAGTGCAGTGG - Intergenic
1185993243 X:4915084-4915106 TTCCCCAGGCTGGTGTGCAGTGG - Intergenic
1186303092 X:8221867-8221889 CACCAAAGGTTGTTGAGCAGTGG - Intergenic
1186489910 X:9963361-9963383 TGCCCAAGGCTGGAGTGCAGTGG - Intergenic
1186917304 X:14237298-14237320 TGCCAGAGGCTGGTGGGAAGGGG + Intergenic
1187077981 X:15954785-15954807 AAGCTAAGGATGGTGGGCAGGGG - Intergenic
1187684391 X:21801789-21801811 TACCAGAGGCTGAAGGGAAGGGG + Intergenic
1187720766 X:22148642-22148664 TACCAAAGGCTGGAGGGAGGGGG - Intronic
1187759371 X:22563330-22563352 TGCCAGAGGCTGGGGGGTAGGGG - Intergenic
1187781665 X:22833260-22833282 TCCCCAAGGCTGGAGTGCAGTGG - Intergenic
1187957589 X:24534916-24534938 TCCCCCAGGCTGGTGTGCAGTGG - Intronic
1188349678 X:29112837-29112859 TTCCCCAGGCTGGAGGGCAGTGG + Intronic
1188484596 X:30669220-30669242 TCCCCAAGGCTGGAGTGCAGTGG + Intronic
1188554680 X:31398680-31398702 TTGCCAAGGCTGGAGGGCAGTGG + Intronic
1188639316 X:32479438-32479460 TACCAGAGACTGGGGGGAAGAGG - Intronic
1188656282 X:32700397-32700419 TACCAGGGGCTGTGGGGCAGGGG + Intronic
1189307578 X:39998399-39998421 TCCCACAGGCTGGAGTGCAGTGG + Intergenic
1189347716 X:40254656-40254678 TGCCCAAGGCTGGAGTGCAGTGG + Intergenic
1189439804 X:41025097-41025119 TCACCCAGGCTGGTGGGCAGTGG + Intergenic
1189440854 X:41034700-41034722 TGCCTAAGGCTGGAGTGCAGTGG - Intergenic
1189462571 X:41254107-41254129 TAGCCCAGGCTGGAGGGCAGTGG + Intergenic
1189592187 X:42525204-42525226 TCACAAAGGCTGGAGTGCAGTGG - Intergenic
1189767741 X:44389292-44389314 TCCCACAGGCTGGAGTGCAGTGG - Intergenic
1189793338 X:44624082-44624104 TAGCACAGGCTGGAGTGCAGTGG + Intergenic
1189982501 X:46524968-46524990 TTCCCAAGGCTGGAGTGCAGTGG - Intronic
1190037394 X:47038468-47038490 TAACAAATGCTGGTGAGGAGTGG - Intronic
1190682000 X:52834281-52834303 TTGCCAAGGCTGGAGGGCAGTGG + Intergenic
1190754454 X:53389688-53389710 TATCACGGGCTGGTGTGCAGGGG - Intronic
1190847918 X:54211400-54211422 TTCCCAAGGCTGGAGCGCAGTGG - Intronic
1190968836 X:55329503-55329525 TAGCAAATGCAGGTGGGGAGGGG - Intergenic
1192272517 X:69595543-69595565 TACCAGAGGCTGGTGGTGGGAGG + Intergenic
1192428988 X:71100148-71100170 TACCTGGGGCTGGTGGGCACTGG - Intronic
1192512537 X:71731921-71731943 TTCCAGAGGCTGGGGGGCAGGGG - Intergenic
1192514160 X:71749588-71749610 TTCCAGAGGCTGGGGGGCAGGGG + Intergenic
1192526865 X:71854093-71854115 TTCCAGAGGCTGGGAGGCAGGGG + Intergenic
1192629102 X:72761178-72761200 TGTCACAGGCTGGTGTGCAGTGG + Intergenic
1192652608 X:72959636-72959658 TGTCACAGGCTGGTGTGCAGTGG - Intergenic
1193743782 X:85249869-85249891 TGCCTAGGGCTGGTGGGGAGAGG - Intronic
1193754783 X:85395079-85395101 TACCAAATGCTGGCCAGCAGAGG - Intergenic
1194525492 X:94972120-94972142 TACCAGAGGGTGGAGGGTAGAGG - Intergenic
1194664510 X:96662739-96662761 TAGCACAGGCTGGAGTGCAGTGG - Intergenic
1195326092 X:103759778-103759800 TAACCAAGGCTGGAGTGCAGTGG + Intergenic
1195945723 X:110209079-110209101 TTCCAAAGGCTAGTGGGGACAGG + Intronic
1196821366 X:119703716-119703738 TCCCCAAGGCTGGAGTGCAGTGG + Intergenic
1196838257 X:119833377-119833399 TAACCAAGGCTGGAGTGCAGTGG + Intergenic
1196856847 X:119992180-119992202 TAGCACAGGCTGGAAGGCAGTGG - Intergenic
1198026940 X:132716155-132716177 TACTAAAATCTGCTGGGCAGGGG - Intronic
1198106085 X:133462674-133462696 CACCCAAGGCTGGAGTGCAGTGG + Intergenic
1198554017 X:137773963-137773985 TCCCCAAGGCTGGAGTGCAGTGG + Intergenic
1198590490 X:138175000-138175022 TACCAAAGGCTATTGGGGTGAGG - Intergenic
1198863155 X:141092138-141092160 TACCCCAGGCTGGAGTGCAGTGG - Intergenic
1198899535 X:141495249-141495271 TACCCCAGGCTGGAGTGCAGTGG + Intergenic
1199395840 X:147336455-147336477 TACCCCAGGCTGGAGTGCAGTGG - Intergenic
1199458853 X:148060467-148060489 TCTCCAAGGCTGGAGGGCAGTGG + Intergenic
1199861482 X:151804252-151804274 TACCAGAGGCTGGTGGAGGGTGG - Intergenic
1200111071 X:153741136-153741158 GACCATGGGGTGGTGGGCAGGGG + Intronic
1200335261 X:155344181-155344203 TACTAGAGGCTGGTGGGTTGTGG - Intergenic
1200351207 X:155497040-155497062 TACTAGAGGCTGGTGGGTTGTGG + Intronic
1200822927 Y:7606418-7606440 TACCCAATGCAGGTGGTCAGAGG + Intergenic
1200841218 Y:7783487-7783509 TACCCCAGGCTGGAGTGCAGTGG - Intergenic
1201012426 Y:9560724-9560746 TAGCCAAGGCTGGAGTGCAGTGG - Intergenic
1201097336 Y:10631356-10631378 TCACACAGGCTGGAGGGCAGTGG + Intergenic
1201098189 Y:10649788-10649810 TCACACAGGCTGGAGGGCAGTGG + Intergenic
1201123471 Y:10892312-10892334 TCACAAAGGCTGGAGTGCAGTGG + Intergenic
1201131794 Y:10958063-10958085 TAACAAAAGCTGGAGTGCAGTGG + Intergenic
1201132483 Y:10963578-10963600 TCACAAAGGCTGGAGTGCAGTGG + Intergenic
1201132652 Y:10964898-10964920 TCACAAAGGCTGGAGTGCAGTGG + Intergenic
1201138583 Y:11009411-11009433 TCACAAAGGCTGATGTGCAGTGG + Intergenic
1201141841 Y:11034890-11034912 TAACCCAGGCTGGTGTGCAGTGG + Intergenic
1201142060 Y:11037229-11037251 TGACAAAGGCTGGAGTGCAGTGG + Intergenic
1201404764 Y:13638480-13638502 TAGCCAAGGCTGGAGTGCAGCGG + Intergenic
1201470270 Y:14325596-14325618 TTTCACAGGCTGGTGTGCAGTGG - Intergenic
1201992724 Y:20045336-20045358 TAGCATAGGCTGGAGGACAGTGG + Intergenic
1202237128 Y:22724677-22724699 TACCCAATGCAGGTGGTCAGAGG - Intergenic
1202597076 Y:26551701-26551723 CACCACAGGCTGGAGTGCAGTGG + Intergenic
1202623645 Y:56836015-56836037 TCACAAAGGCTGGAGTGCAGTGG + Intergenic