ID: 961632126

View in Genome Browser
Species Human (GRCh38)
Location 3:128308746-128308768
Sequence CAGGACTCCCTGGGAACACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 246}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961632113_961632126 6 Left 961632113 3:128308717-128308739 CCTGCCCCTCCTCACACCTATGG 0: 1
1: 0
2: 1
3: 41
4: 490
Right 961632126 3:128308746-128308768 CAGGACTCCCTGGGAACACAAGG 0: 1
1: 0
2: 0
3: 21
4: 246
961632111_961632126 16 Left 961632111 3:128308707-128308729 CCCTTCTGTTCCTGCCCCTCCTC 0: 1
1: 2
2: 10
3: 196
4: 1591
Right 961632126 3:128308746-128308768 CAGGACTCCCTGGGAACACAAGG 0: 1
1: 0
2: 0
3: 21
4: 246
961632118_961632126 -3 Left 961632118 3:128308726-128308748 CCTCACACCTATGGCAGCCCCAG 0: 1
1: 0
2: 6
3: 32
4: 261
Right 961632126 3:128308746-128308768 CAGGACTCCCTGGGAACACAAGG 0: 1
1: 0
2: 0
3: 21
4: 246
961632115_961632126 2 Left 961632115 3:128308721-128308743 CCCCTCCTCACACCTATGGCAGC 0: 1
1: 0
2: 1
3: 30
4: 346
Right 961632126 3:128308746-128308768 CAGGACTCCCTGGGAACACAAGG 0: 1
1: 0
2: 0
3: 21
4: 246
961632120_961632126 -10 Left 961632120 3:128308733-128308755 CCTATGGCAGCCCCAGGACTCCC 0: 1
1: 0
2: 5
3: 46
4: 319
Right 961632126 3:128308746-128308768 CAGGACTCCCTGGGAACACAAGG 0: 1
1: 0
2: 0
3: 21
4: 246
961632116_961632126 1 Left 961632116 3:128308722-128308744 CCCTCCTCACACCTATGGCAGCC 0: 1
1: 0
2: 2
3: 22
4: 237
Right 961632126 3:128308746-128308768 CAGGACTCCCTGGGAACACAAGG 0: 1
1: 0
2: 0
3: 21
4: 246
961632112_961632126 15 Left 961632112 3:128308708-128308730 CCTTCTGTTCCTGCCCCTCCTCA 0: 1
1: 0
2: 12
3: 152
4: 1337
Right 961632126 3:128308746-128308768 CAGGACTCCCTGGGAACACAAGG 0: 1
1: 0
2: 0
3: 21
4: 246
961632117_961632126 0 Left 961632117 3:128308723-128308745 CCTCCTCACACCTATGGCAGCCC 0: 1
1: 0
2: 6
3: 31
4: 196
Right 961632126 3:128308746-128308768 CAGGACTCCCTGGGAACACAAGG 0: 1
1: 0
2: 0
3: 21
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961632126 Original CRISPR CAGGACTCCCTGGGAACACA AGG Intronic
900342648 1:2195994-2196016 CAGGGCCCCCTGAGACCACACGG - Intronic
900918039 1:5652023-5652045 CAGGATGCCCTGGGAAGAGAAGG - Intergenic
902262323 1:15235948-15235970 CAGAACTTTGTGGGAACACAGGG + Intergenic
902673686 1:17993662-17993684 CAGGGCTCCCTGAGCACAGAGGG + Intergenic
903362067 1:22783100-22783122 CAGGACTCCTAGGGCACACTTGG + Intronic
903926355 1:26833567-26833589 CTGGGCTGCCTGGGAGCACAGGG - Intronic
903998559 1:27323854-27323876 TAGAACTATCTGGGAACACAGGG - Intronic
905518608 1:38580368-38580390 CACGTCCCACTGGGAACACAGGG + Intergenic
908785350 1:67729792-67729814 CAGGAAGCCCTGGGAATCCACGG - Intronic
909594624 1:77392575-77392597 CACAACTCCCTGGGCACACACGG - Intronic
914443371 1:147726649-147726671 CAGGAGTACCAGGCAACACAGGG + Intergenic
915285339 1:154848638-154848660 CAGCCCTCCCTAAGAACACAGGG + Intronic
915335726 1:155140127-155140149 CAGGACTTCCTGGCAGGACAAGG + Exonic
920543615 1:206797755-206797777 CAGGACTCCCTGGGACATGATGG + Intergenic
920843733 1:209576453-209576475 AAGGACTCAATGGGATCACAGGG - Intergenic
920981207 1:210837277-210837299 CAGGGAGCTCTGGGAACACAGGG - Intronic
923348658 1:233081903-233081925 CAGGCCTCTCTGGCCACACAGGG + Intronic
924074648 1:240320742-240320764 CAGGAATCCCTGGGCATCCACGG - Intronic
924804542 1:247352024-247352046 CAGGACTCCATGTAAAAACAGGG - Intergenic
1063062698 10:2574154-2574176 CAGGAATGCCAGGGAAGACAGGG - Intergenic
1063119782 10:3097256-3097278 AAGGACTCACTGGTAACAGACGG - Intronic
1066048951 10:31618133-31618155 CAGGTTTCTCTGGGAACCCAGGG + Intergenic
1067068906 10:43118698-43118720 CGGCACTCCCTGGGCCCACAGGG + Intronic
1068591331 10:58855901-58855923 CAGGATTCCCAAGGAACACCAGG + Intergenic
1069635551 10:69922766-69922788 CAGGGCTCCCTGGGCCCCCAGGG + Exonic
1070890957 10:79941961-79941983 GTGGAGTCCCTGGAAACACAGGG - Exonic
1071331480 10:84565202-84565224 AAGGACCCCCTGGTAACAAAAGG - Intergenic
1072504105 10:96046954-96046976 AAAGACTCCCTGGAAACACCTGG - Intronic
1073327677 10:102651776-102651798 CAGGACACTCTGGGAACATCAGG - Intronic
1076899196 10:133328800-133328822 CAGGCTCCCCTGGGAACAAAGGG - Intronic
1076978613 11:193472-193494 CAGCATTCCCTGGGATCACCAGG - Intronic
1077948401 11:6927200-6927222 CAGGAATGACTGGGAAAACAAGG - Intronic
1078098432 11:8314333-8314355 CACCAGTCCCTGGGCACACATGG + Intergenic
1079155089 11:17938722-17938744 CAGGACATCCTTGGAACATATGG + Intronic
1080644611 11:34179350-34179372 CAAGAGTCCCTGGGACCTCAGGG + Intronic
1081260559 11:40954932-40954954 CAGACAACCCTGGGAACACAAGG + Intronic
1081297719 11:41411863-41411885 CAGGACTCCATTGCATCACAAGG - Intronic
1081736568 11:45408598-45408620 CAGGATTCCCTGGAAGCTCAGGG + Intergenic
1082913025 11:58398288-58398310 CAGCACTCCCTCAAAACACAGGG + Intergenic
1083595964 11:63918361-63918383 CAGGAGTCCCCGGGAACAAGCGG - Intergenic
1083630072 11:64090841-64090863 CAGGGCTCCCTGGGAGTGCAGGG - Intronic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1088436322 11:109817058-109817080 CAGGACTTCCTGGGAAGGAAAGG + Intergenic
1088684780 11:112275411-112275433 CTGAGCTCCCTGGGCACACATGG - Intergenic
1089604856 11:119635898-119635920 CAGCCCTCCCTGGGGGCACAAGG - Intronic
1091727069 12:2853773-2853795 CCGGCCACCCTGGGAACTCACGG - Intronic
1094012085 12:25820539-25820561 CAGGTCTCCAGGAGAACACATGG + Intergenic
1094484254 12:30911858-30911880 CAGGCCTGCCTGGGAGCAGATGG - Intergenic
1095981467 12:47976993-47977015 GAGGAATCCCCGGAAACACAGGG + Intronic
1096496882 12:52043799-52043821 CAGGGCTCCCTGAGACCACCAGG + Intronic
1096687840 12:53300453-53300475 AGGGACTCCCTGGGAACCAAAGG - Intronic
1097904402 12:64905147-64905169 ATGGATTCCCTGGGAACCCATGG - Intergenic
1098122509 12:67256789-67256811 CAGGGCCCCTTGGGAACGCATGG - Intergenic
1098939977 12:76523036-76523058 CAGGACTAGCTGGGGAAACAGGG - Intronic
1101904459 12:108814544-108814566 CGGGATTCCCTGGGCACAGAAGG + Intronic
1104079097 12:125414769-125414791 CAGGTCGCCCTGGGAGAACATGG + Intronic
1105448255 13:20475688-20475710 CAGGAGGCCTTGGGAACAGAGGG + Intronic
1107992967 13:45834542-45834564 CAGTTCTCCCTGGGAGCTCAGGG + Intronic
1109554638 13:63955869-63955891 CATGAATCCCAGGCAACACAGGG - Intergenic
1112362743 13:98731621-98731643 GATGAAGCCCTGGGAACACAGGG - Intronic
1113120187 13:106917412-106917434 AGGGACTCCCTGGGAACGCTTGG + Intergenic
1113902912 13:113806492-113806514 CCCTGCTCCCTGGGAACACAAGG + Intronic
1115816391 14:37168777-37168799 GAGGACACCAGGGGAACACAAGG + Intronic
1117006332 14:51424943-51424965 CAGCAGTTCCTGTGAACACATGG + Intergenic
1119764642 14:77180889-77180911 GAGGAAGCCCTGTGAACACAAGG - Intronic
1123924735 15:25096829-25096851 CAAGACTGCCTGCGAAAACATGG - Intergenic
1124460142 15:29882388-29882410 AAGGACTTCCTGGCAACACTTGG + Intronic
1128372406 15:67049924-67049946 AAGGAATCCCTGTGACCACAGGG - Intergenic
1128555844 15:68631145-68631167 CAGTGCTCCCAGGGAACACCTGG + Intronic
1129424340 15:75453537-75453559 CACGACTTCCCGTGAACACAGGG + Intronic
1129948474 15:79562875-79562897 CAGGAATCCCAGGGAACATAAGG - Intergenic
1133324753 16:4936162-4936184 CAGGCCGCCCTGGGAACCCGCGG + Intronic
1135188413 16:20334702-20334724 CAGCACACCCTGGGACCTCAGGG + Intronic
1136366246 16:29810548-29810570 CACAAGTCCCTGGGAAGACAGGG - Exonic
1136540819 16:30926827-30926849 CAAGACCCCCTGGGAACACTAGG - Intronic
1137446730 16:48536524-48536546 CAGGGCTCCCTGGGGACTCGGGG + Intergenic
1140091887 16:71845886-71845908 CAGGACTCCCCGGGAAGGGAGGG - Intergenic
1141732640 16:85833299-85833321 CAGCTCACCCTGGGGACACATGG + Intergenic
1142466044 17:137963-137985 CAGCATTCCCTGGGATCACCAGG - Intronic
1142805729 17:2370168-2370190 CAGGACTCCCTCAGCACACACGG + Intronic
1142887190 17:2920212-2920234 AAGGACAGCCTAGGAACACAGGG - Intronic
1144684836 17:17219129-17219151 CTGTACTCTCTGGCAACACAGGG + Exonic
1145066046 17:19762119-19762141 CAGCAGTCCTTGGGAACAGAGGG - Intergenic
1145759795 17:27419668-27419690 CTGGGCTCCCTAGGAGCACAGGG + Intergenic
1146749958 17:35369322-35369344 CAGTACTCCCTGTGAACCCGTGG + Intronic
1146856920 17:36262831-36262853 CTGGGCTCCCTAGGAGCACAGGG - Intronic
1146863697 17:36325544-36325566 CTGGGCTCCCTAGGAGCACAGGG + Intronic
1146872830 17:36386741-36386763 CTGGGCTCCCTAGGAGCACAGGG - Intronic
1146880188 17:36437827-36437849 CTGGGCTCCCTAGGAGCACAGGG - Intronic
1147066558 17:37926132-37926154 CTGGGCTCCCTAGGAGCACAGGG + Intronic
1147075713 17:37987366-37987388 CTGGGCTCCCTAGGAGCACAGGG - Intronic
1147078090 17:38005693-38005715 CTGGGCTCCCTAGGAGCACAGGG + Intronic
1147087238 17:38066912-38066934 CTGGGCTCCCTAGGAGCACAGGG - Intronic
1147094026 17:38129628-38129650 CTGGGCTCCCTAGGAGCACAGGG + Intergenic
1147103183 17:38190875-38190897 CTGGGCTCCCTAGGAGCACAGGG - Intergenic
1147217203 17:38907876-38907898 CAGGACCGCCTGGGAGCAGATGG + Intronic
1147447680 17:40484706-40484728 AAGGACTTCCTGGGGACAAAAGG - Intronic
1148779655 17:50114150-50114172 CAGGACTCCGTGGGCACCCTGGG + Intronic
1149847759 17:60017344-60017366 CTGGGCTCCCTAGGAGCACAGGG - Intergenic
1151335101 17:73435105-73435127 CAGCCCTGCCTGGGAACCCAGGG + Intronic
1151472186 17:74325449-74325471 CAGGAGGCCCTGGGAAAACTTGG - Intergenic
1151472197 17:74325488-74325510 TTGCACTCCCAGGGAACACAGGG - Intergenic
1155252815 18:23967950-23967972 CAGGACTCCCTGGTGAAATAAGG - Intergenic
1155807396 18:30189171-30189193 CAGGACCCTCTGACAACACATGG + Intergenic
1156989674 18:43393817-43393839 CAAGGCTCACTGGGAACAGAAGG + Intergenic
1157197637 18:45632364-45632386 CAGGACTCCATGGGTACAACGGG + Exonic
1157322871 18:46647532-46647554 CAGTGCACTCTGGGAACACATGG + Intronic
1158247424 18:55447364-55447386 AACAACACCCTGGGAACACATGG + Intronic
1160076645 18:75683554-75683576 AAGGAGACCCAGGGAACACATGG + Intergenic
1161162581 19:2769344-2769366 CAGGAGGCCCTGGGAGCACGCGG - Intronic
1161795437 19:6383630-6383652 CAGGACTCCCTGAAACCACACGG + Intronic
1164776225 19:30855695-30855717 CCTCATTCCCTGGGAACACAAGG + Intergenic
1165675642 19:37719967-37719989 CCGGCCTCCTTGGTAACACATGG + Intergenic
1165724689 19:38104509-38104531 CAGGCCTCCCTGGGCTCACCTGG + Intronic
1165740417 19:38202000-38202022 GAGGTTTCCCTGGGAACACCCGG + Intronic
1166197011 19:41213644-41213666 CAGGAGATCCTGGGAACAGAAGG - Intergenic
1168120563 19:54250641-54250663 CAGGACATCCTGGGAACTCTGGG - Exonic
925898690 2:8493259-8493281 CAGGACTGCTGGGGCACACAGGG + Intergenic
926012814 2:9422502-9422524 CAGGCCTTCCTGGGATCTCAAGG + Exonic
926092089 2:10057838-10057860 CAGGACGCCCTGGGAACAGGGGG - Exonic
927374799 2:22401337-22401359 TAGGACTCCTTGTGAAGACAGGG - Intergenic
929305937 2:40361683-40361705 CTGCAGTCACTGGGAACACACGG + Intronic
930709618 2:54537950-54537972 CAGCTCTCCCTGGAACCACATGG + Intronic
931746286 2:65294341-65294363 CAGGGCTGCCGGGGCACACAGGG - Intergenic
932408183 2:71528210-71528232 CAGGACTGCCTGGAGACAGATGG + Intronic
932735044 2:74248478-74248500 CATCACTCCCTGGGGGCACAAGG + Exonic
932817695 2:74874885-74874907 CAGGAGGCCCTGGGACCCCAGGG - Intronic
933351319 2:81155727-81155749 CAGTAGTCCCTCTGAACACAGGG + Intergenic
934020736 2:87948852-87948874 CACCACTCCCTGTGAAAACATGG - Intergenic
934517903 2:95000197-95000219 CAGCAATCCCTGGGAACCTATGG - Intergenic
934528999 2:95073591-95073613 CAGCTCTCACTGGGAACTCAAGG + Intergenic
935859751 2:107316246-107316268 CTGGCCTCAATGGGAACACAAGG + Intergenic
936730218 2:115374017-115374039 CAGGCCTCTCTTGCAACACATGG + Intronic
937869056 2:126774762-126774784 CCGGGCTCCCTGGTGACACATGG + Intergenic
937912177 2:127081066-127081088 CAGGACTCCCTGTACCCACAGGG - Intronic
942312592 2:174669244-174669266 CAGGAATGCATGGGAACATAAGG - Intronic
942496481 2:176545474-176545496 CGGAACCCCTTGGGAACACAAGG - Intergenic
943642947 2:190378975-190378997 CTGGACTTCCTCCGAACACAGGG - Intergenic
943657606 2:190526214-190526236 CAGGACTCCCGTGGAATGCAGGG + Intronic
946232755 2:218302766-218302788 CAGGAGACCCTGAGAACACGTGG + Intronic
947147574 2:227082328-227082350 CAGGACTACCTTGGAAGGCAGGG - Intronic
947712020 2:232321793-232321815 CAGGCCCCCCTGGAAACAAAGGG - Intronic
948717839 2:239876773-239876795 CAGGACTCCCTGGGTTGAGAAGG + Intergenic
949045315 2:241870107-241870129 CAGGGGTCCCGGGGAAGACATGG + Intronic
1169080702 20:2796435-2796457 CAGGCTCCCCTGGGGACACATGG + Exonic
1171302128 20:24072464-24072486 TAGGACTCGCTGGAGACACAGGG + Intergenic
1173162720 20:40664317-40664339 CAGGGCTCTCTGGGAAGAGATGG - Intergenic
1175285238 20:57833380-57833402 CAGGCCTCCTTAGGAACAGAAGG - Intergenic
1178002499 21:28177862-28177884 CAAGTCTCCCTGGATACACAAGG - Intergenic
1179565462 21:42245107-42245129 CAGGCAGCCCAGGGAACACAAGG - Intronic
1180728061 22:17961035-17961057 CAGGAGCCCCTGGTAACACACGG - Intronic
1181712230 22:24697769-24697791 CAGGGCCCGCTGGGAACACGGGG + Intergenic
1182300272 22:29333251-29333273 TAGGACTCCCTGGGGACCCCTGG - Intronic
1182618367 22:31603882-31603904 CAGGACTCACAGGCAACATATGG + Intronic
1183672409 22:39280614-39280636 CAGGATACCCAGAGAACACAAGG + Intergenic
1184848303 22:47102468-47102490 CAGCACTCAGTGGGAAAACAGGG - Intronic
950314211 3:11986341-11986363 CAGGCCTTCCTTGGACCACATGG + Intergenic
950544229 3:13629310-13629332 CAGGACCCCTGGGGAACACCTGG + Intronic
950834174 3:15903476-15903498 CTGGACCCTGTGGGAACACAAGG + Intergenic
951071795 3:18337636-18337658 CACCACTCCCTGGGGACACTGGG + Intronic
952790722 3:37198503-37198525 CATGTCTCCCTGAGACCACATGG - Intergenic
952906658 3:38143623-38143645 CAGGAGTCCCTGAGGGCACAGGG - Intergenic
953922455 3:46961515-46961537 ATGGACTCCCAGGGAAGACAAGG - Intronic
954424907 3:50438193-50438215 CAGGAATTCCTGGGAACAAGGGG - Intronic
954433958 3:50486142-50486164 CAGCACTGGCTGGGCACACAGGG - Intronic
955784075 3:62517730-62517752 CAGCACTGGCTGGCAACACAGGG - Intronic
958021070 3:87996308-87996330 CAGGACTCTCTGGGTACAGAGGG - Intergenic
958026610 3:88058195-88058217 CATGACTTCCTGGCACCACAGGG - Intronic
959467002 3:106700664-106700686 TAGGATTCCCTTGGAATACATGG + Intergenic
961372426 3:126439840-126439862 CGGGCCTCCCTTGGAATACAGGG - Intronic
961535180 3:127566273-127566295 CTGGACTCCATGGCAACACAAGG + Intergenic
961632126 3:128308746-128308768 CAGGACTCCCTGGGAACACAAGG + Intronic
961738493 3:129017243-129017265 CAAGTCTCTCTGGGAGCACAAGG + Intronic
961823236 3:129585942-129585964 CAGGACTCACTGGGTACTCCTGG + Exonic
962121412 3:132564644-132564666 CAGAGCTCTCTGGGAAAACATGG - Intronic
963985523 3:151589458-151589480 CTGGTCTCCCTGGCCACACAAGG - Intergenic
966732708 3:183163708-183163730 GCAGACTCCCTGGGAAGACATGG - Intronic
967427868 3:189348223-189348245 CGGGAATCCCTGGGAACAACTGG + Intergenic
967964772 3:194952328-194952350 GAGGACACCCAGGGGACACAGGG - Intergenic
968489829 4:883972-883994 AGGGACTCACTGGGCACACAGGG + Intronic
968699009 4:2046051-2046073 CAGGGCCCACAGGGAACACAGGG - Intergenic
969464385 4:7346835-7346857 TAAGACACCCTGGGAACTCATGG - Intronic
969517969 4:7659094-7659116 CAAGACTCCCTGGGAACTCCTGG - Intronic
969607113 4:8207829-8207851 CAGGGCTCCCTGGAAACACGGGG - Intronic
970614051 4:17751381-17751403 CAGCACTTCCAGGCAACACATGG - Intronic
975657107 4:76652656-76652678 CTGGTCTCCCTGGGATCATAAGG - Intronic
977560440 4:98527749-98527771 CAGGGCTCCCTGGAAAAGCATGG + Intronic
982238129 4:153271765-153271787 CATGTGTCCCTGGGCACACATGG + Intronic
985445184 4:190017782-190017804 CGAGACCCCCTGGGAATACAGGG + Intergenic
986279471 5:6311670-6311692 CAGGAGGCCCTGGGAACCCGAGG + Intergenic
987093455 5:14527505-14527527 CACGACTGCCTTGGAACACCAGG - Intronic
991583852 5:68182909-68182931 CAGAAAGCCCTGGGACCACAGGG - Intergenic
992086755 5:73284496-73284518 CAACACTCTCTGGGAACACTGGG + Intergenic
993193413 5:84707233-84707255 CAGCAGTCCCTAGGGACACATGG + Intergenic
996757477 5:126949808-126949830 CAGGAATTCCTGGGAACTCAGGG + Intronic
998509106 5:142696594-142696616 CAGGTCTTCCTGGAAACAGAAGG + Intronic
999282391 5:150374253-150374275 CAGCACCCCCTGGGAAGGCAGGG + Exonic
999282492 5:150374696-150374718 CAGCGCCCCCTGGGAAGACAGGG + Exonic
999282910 5:150376502-150376524 CAGTACTCCCTGGGAAGACGGGG + Exonic
1000535237 5:162470763-162470785 CAGGACTCTCTAGGGACACTGGG + Intergenic
1002540532 5:179903520-179903542 CAGTACCCCGGGGGAACACAGGG + Intronic
1005693731 6:28332170-28332192 GAGGACTGGCTGGGAACACAGGG - Intronic
1006947044 6:37791577-37791599 CAGGACTGCCTGTGCACAGATGG - Intergenic
1007749859 6:44065268-44065290 CAGGGCTCCCTGAGGACAGAGGG - Intergenic
1007951818 6:45879538-45879560 CAGGACAGCCTGGGAACACTTGG - Intergenic
1008034797 6:46734883-46734905 CAGGACAGGCAGGGAACACATGG - Intronic
1008338117 6:50331212-50331234 AAGGGCTCACTGGGAGCACAAGG + Intergenic
1011178409 6:84589997-84590019 CAGTAATCTCTGGGAACAAAGGG - Intergenic
1011739143 6:90342101-90342123 CAGGAATCCCTGTGAACCCCAGG - Intergenic
1015620864 6:135130283-135130305 CAGCACTCCCTGAGAATACTAGG - Intergenic
1015655880 6:135518621-135518643 CAGAAGTCCCTGGAAACAGAAGG + Intergenic
1019425841 7:976144-976166 CAGGACACCATGGGAACGTAGGG - Intergenic
1019516942 7:1444344-1444366 CTGCACTCCCTTGGAACCCAAGG - Intronic
1019639577 7:2096268-2096290 GAGTTCTCCCTGGGATCACAGGG - Intronic
1022505847 7:30908293-30908315 TAGGGCTCACTGGGACCACAGGG + Intergenic
1023332056 7:39128744-39128766 CCAGACTGCCTGAGAACACATGG - Intronic
1023352321 7:39333058-39333080 AAGCACCCCCTGGGAACTCATGG + Intronic
1023806118 7:43874316-43874338 CAGGACCCCTTGTGAGCACACGG + Intronic
1026767813 7:73171595-73171617 CAGTCCTCCCTGGGACTACAGGG + Intergenic
1027044279 7:74981303-74981325 CAGTCCTCCCTGGGACTACAGGG + Intronic
1027079362 7:75221055-75221077 CAGTCCTCCCTGGGACTACAGGG - Intergenic
1027797091 7:82709358-82709380 TAGGAGTCCCTGGGAATACACGG - Intergenic
1028143013 7:87292076-87292098 CTGGACACCCTGTGATCACAGGG + Intergenic
1028883487 7:95906518-95906540 AAGGACTCACTGTGAGCACATGG - Intronic
1029449522 7:100633115-100633137 CAGCTCTCCCTGGGGACACGAGG + Exonic
1029494071 7:100887897-100887919 CAGGAGTCCCTGGGTAGTCAAGG - Intronic
1030440171 7:109579429-109579451 ATGGCCTCCCTGGGGACACACGG + Intergenic
1030914900 7:115300673-115300695 CAGAACTCCCTGGGAACTGTAGG - Intergenic
1031098538 7:117449200-117449222 CAGAACTCCCTGGGGACCAATGG + Intergenic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1035363364 7:158328809-158328831 CAGGCCTCCCTGGGATCCCTGGG - Intronic
1035688750 8:1546420-1546442 CATGAGTCCCTGGGAAGTCAGGG - Intronic
1041256086 8:55980643-55980665 CAGGGCTGCCTGGGAAGACATGG - Intronic
1042169120 8:65975321-65975343 CAGGATTCCCATGGAACATAGGG + Intergenic
1047216328 8:122879074-122879096 CAGCACTGCCTCGGAACTCAAGG + Intronic
1048005525 8:130416419-130416441 CAAGACTTTCTGGGCACACACGG + Intronic
1048166058 8:132062391-132062413 CAGGAGTGCCAGGGAACTCAGGG + Intronic
1049337020 8:142092049-142092071 CTGGCCTCCCTGGGCACTCATGG - Intergenic
1049437193 8:142592199-142592221 CTGGATTCTCTGGGAAAACAGGG - Intergenic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1049699697 8:144004614-144004636 CAGGAATCTCTGTGAACATAGGG - Intronic
1049862727 8:144911086-144911108 GAGGAGTCCCTGGGCACACAGGG + Intergenic
1052235492 9:26209203-26209225 CAGGATTGCCTTGGAGCACAAGG + Intergenic
1053007359 9:34612964-34612986 GAGCACTCCCTGAGACCACAAGG + Intergenic
1053013478 9:34648473-34648495 AGGGACTCCTTGGGGACACAGGG - Intronic
1053335119 9:37261552-37261574 CAGGCCACCCTGAGAACACAAGG - Intronic
1056404274 9:86259211-86259233 CAAGCATCCATGGGAACACAGGG + Intronic
1056454901 9:86750945-86750967 CAGGGCTGCCTGGGAACTTAGGG - Intergenic
1057187030 9:93062713-93062735 CCGGACTCCCAGGGGACCCAGGG - Intronic
1059699530 9:116761596-116761618 GAGGAATCCCAGGGAACTCAGGG + Intronic
1060360029 9:122946610-122946632 AAGCTATCCCTGGGAACACAGGG - Intronic
1060886220 9:127154280-127154302 CAGGACACCCTGTGGACACAAGG - Intronic
1061421391 9:130474641-130474663 CAGCATTCCCTGGGCACAGACGG - Intronic
1061736199 9:132661416-132661438 CCTAACTCCCTGGGGACACAGGG + Intronic
1061814726 9:133187896-133187918 CAGGCCTCTCTGGGTACAGACGG - Intergenic
1062014357 9:134283810-134283832 CAGGACACCCGGGAAACACAGGG + Intergenic
1202801570 9_KI270720v1_random:4141-4163 CTGGACTCTCTGGAAACAGAGGG - Intergenic
1186459580 X:9737573-9737595 AATGACTCCCTGGGGGCACAGGG + Intronic
1187863584 X:23704055-23704077 CAAGACTACTTGGGAACACTGGG + Intronic
1192261860 X:69510429-69510451 CAGGACTCCTTGCTAACACTGGG + Intronic
1194891573 X:99385134-99385156 CAGCAGTGCCTGGGAGCACAGGG + Intergenic
1195217811 X:102717414-102717436 CAGGGCTCTTTGGGAACATAAGG - Exonic
1195575212 X:106441557-106441579 CAGAACTGACTGGGAACTCAGGG + Intergenic
1195792064 X:108598754-108598776 CAGGCCTCCCAGGGAATATAGGG + Exonic
1196124415 X:112083230-112083252 CAGGAGTCCCTCGGAGCATATGG + Intergenic
1196735348 X:118976846-118976868 CAGGACACCCTCGGATCCCAGGG - Intronic
1199123788 X:144090275-144090297 CACCACTCCCTGTGAAAACATGG + Intergenic
1201147233 Y:11072015-11072037 CAGCACTCCATGGGAACCCGTGG + Intergenic