ID: 961633759

View in Genome Browser
Species Human (GRCh38)
Location 3:128320124-128320146
Sequence TAGTTGCAACAGAGGTTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 568
Summary {0: 1, 1: 6, 2: 23, 3: 107, 4: 431}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961633754_961633759 24 Left 961633754 3:128320077-128320099 CCTGCCACCTGTTTTGATAAATA 0: 1
1: 8
2: 66
3: 281
4: 735
Right 961633759 3:128320124-128320146 TAGTTGCAACAGAGGTTGTGTGG 0: 1
1: 6
2: 23
3: 107
4: 431
961633755_961633759 20 Left 961633755 3:128320081-128320103 CCACCTGTTTTGATAAATAAAGC 0: 1
1: 1
2: 42
3: 256
4: 681
Right 961633759 3:128320124-128320146 TAGTTGCAACAGAGGTTGTGTGG 0: 1
1: 6
2: 23
3: 107
4: 431
961633756_961633759 17 Left 961633756 3:128320084-128320106 CCTGTTTTGATAAATAAAGCACT 0: 1
1: 0
2: 5
3: 28
4: 545
Right 961633759 3:128320124-128320146 TAGTTGCAACAGAGGTTGTGTGG 0: 1
1: 6
2: 23
3: 107
4: 431

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961633759 Original CRISPR TAGTTGCAACAGAGGTTGTG TGG Intronic
901694468 1:10996450-10996472 TAGTTACAGCAGAGATTGTATGG - Intergenic
902269842 1:15295795-15295817 TAGTTGCAACACAGACTGTATGG - Intronic
902509209 1:16956530-16956552 TAGTTGCAACAGAGACTGTGTGG - Intronic
903281381 1:22252005-22252027 TACTTGCAACAGAGACTGTCTGG + Intergenic
903343018 1:22666352-22666374 TACTTGCAACAGATGCTGTATGG - Intergenic
904741459 1:32679505-32679527 TAGTTGTAACACAGATTGTGTGG + Intronic
905030599 1:34881344-34881366 TAGCTGCAAGGGAGGCTGTGGGG - Intronic
905281897 1:36854652-36854674 TAGTTGCAGCAGAGACTGTGTGG + Intronic
906742245 1:48193740-48193762 TAGGTGCTAGAGAGGTAGTGGGG + Intergenic
906996041 1:50795387-50795409 TAGTTAGAACCAAGGTTGTGTGG - Intronic
907593474 1:55698349-55698371 TAGTTGCAACAGAGACTCTGTGG - Intergenic
908228707 1:62082618-62082640 TAACTGCAATAGCGGTTGTGTGG - Intronic
908406984 1:63824256-63824278 TAGTTGCAACAGAGTCTATATGG - Intronic
908649586 1:66317324-66317346 TTGGTGCAGCAGAGGTGGTGAGG - Intronic
908800253 1:67872572-67872594 TAGTGGCAATAGAGGCAGTGGGG - Intergenic
909132890 1:71761231-71761253 TAGTTGCAACAGAGACTATATGG - Intronic
909259403 1:73468051-73468073 TAGTTTCAACAGAACTTGTCAGG + Intergenic
909418155 1:75430890-75430912 AAGTTACAAGAGAGGTGGTGGGG - Intronic
909714184 1:78687519-78687541 TAGTTGCAACAGAGGCTACCTGG - Intergenic
909937578 1:81570915-81570937 TAGTTGCAACAGGGATTCTCTGG - Intronic
910464789 1:87486910-87486932 TCCTTGGAACAGAGGTCGTGAGG + Intergenic
910513220 1:88029261-88029283 TAGTTGCGACAGAGACTGTATGG - Intergenic
911519871 1:98916520-98916542 TAGTTGCTGCAAAGGTTGTAAGG - Intronic
912415243 1:109503958-109503980 GAGTTGTAACAGAGACTGTGTGG + Intergenic
913362490 1:117997677-117997699 TAGCTGCAACAGAGAATGTATGG - Intronic
913438908 1:118876594-118876616 AAGTTGAAACAGAGGTTGAGGGG - Intergenic
914229021 1:145747691-145747713 TAGTTGTAACAGCTGTGGTGTGG - Intronic
915527375 1:156484327-156484349 TAGTTACAACAGAGACTGTATGG - Intronic
915838120 1:159194241-159194263 TAGTTGACACAGAGGCTGTATGG - Intronic
915993142 1:160537800-160537822 TAGTTGCAAAGGAGATTGTATGG - Intergenic
916481412 1:165217992-165218014 TAGCTGCAACAGAGACTGTGAGG - Intronic
917633389 1:176912250-176912272 TAGTTGCAACAGAGACTGCATGG - Intronic
917641488 1:176987245-176987267 TAGTTGCAACAGAGACTGTTTGG - Intronic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
917830279 1:178875818-178875840 TAGAGGCAACAGTGGTTGTCTGG + Intronic
918104981 1:181409170-181409192 TAGTTGCAACAGAGATTGTGTGG + Intergenic
919978302 1:202627109-202627131 GGGTTGCTGCAGAGGTTGTGCGG + Intronic
920164162 1:204023850-204023872 TATTTGCAACAGAGACTGTATGG - Intergenic
920518013 1:206600873-206600895 CAGTTGCAACAGAGATGGTGTGG + Intronic
920536889 1:206743199-206743221 GAGATTCAAAAGAGGTTGTGTGG + Intergenic
921527817 1:216239852-216239874 TAGATGAGACAAAGGTTGTGGGG + Intronic
922898323 1:229117651-229117673 TTGTTGTGACAGAGGCTGTGTGG - Intergenic
923142286 1:231170799-231170821 TGGTTGCAACAGAGATGATGTGG + Intronic
923485139 1:234422570-234422592 TGGTTGCCACAGAGGCTGGGAGG + Intronic
923565333 1:235072217-235072239 TGGTAGCAAGAGAGGATGTGAGG - Intergenic
923733283 1:236575454-236575476 TAGCTGCAACAGAGACTGTGTGG + Intronic
923893935 1:238248162-238248184 TAGTTGCAACAGAGACTCTGTGG + Intergenic
923995262 1:239486570-239486592 TAGTTGCAAGAGAGGTCATATGG - Intronic
924353309 1:243141294-243141316 TAGTTGAGACAGAGATTGTATGG - Intronic
1063485021 10:6411668-6411690 TAGTTGCAACACAGACTGTATGG + Intergenic
1064149338 10:12849659-12849681 GAGCTGGAACAGAGGCTGTGCGG + Intergenic
1065344133 10:24732867-24732889 TAGTTGCAACAGAGGTCGCGTGG - Intergenic
1065468514 10:26051860-26051882 TATTTGTAACACAGGTTGTGTGG + Intronic
1066316758 10:34255087-34255109 TGGTTGCAACAGAATTTGTGGGG - Intronic
1069048051 10:63763760-63763782 TAGTTGCAACAGAGACTATATGG - Intergenic
1069716993 10:70527542-70527564 TAGTTGCAACAGGCGCTGTATGG + Intronic
1070084568 10:73224208-73224230 TAGTTGCAACAGAGACTGGATGG - Intronic
1070379498 10:75867851-75867873 TAGTTGCAACAGAGACTATATGG - Intronic
1070514278 10:77189204-77189226 TAGTTGCAAGAAAGGTTTTTTGG - Intronic
1070732830 10:78843146-78843168 TAGTTGCAACAAAGAACGTGTGG + Intergenic
1070976513 10:80609785-80609807 TGGTGGCTACAGAGGCTGTGAGG - Intronic
1071365351 10:84893796-84893818 TAGTTGCAGCAGAGATTATATGG - Intergenic
1071728795 10:88227098-88227120 TAGTTGCAAGAGAGGTCATATGG + Intergenic
1071922311 10:90364636-90364658 TAGTTGCAACAGAGATTATATGG - Intergenic
1071993481 10:91124261-91124283 TAGTTGTGACAGAGACTGTGTGG - Intergenic
1072449048 10:95524662-95524684 TAGTTACAACAGAGAATGTATGG + Intronic
1072809962 10:98453838-98453860 TAATTGAAGCAAAGGTTGTGGGG + Intergenic
1072925141 10:99610676-99610698 TGGTGGCAACAGAGGTTGGCAGG + Exonic
1073202073 10:101743659-101743681 TAGTTGCAACAGAGACTGTATGG - Intergenic
1073736223 10:106350062-106350084 TAGTTGCAACAGAGACTGAATGG - Intergenic
1074142133 10:110682417-110682439 TAGTTGCAACAGAGAACATGTGG - Intronic
1074309546 10:112310440-112310462 TAGTTGCAACAAAGATTCTATGG + Intergenic
1074379579 10:112968178-112968200 TAGTTGCAACAGAGACTGAGCGG - Intronic
1074388406 10:113035878-113035900 TAGTTATGACAGAGATTGTGTGG + Intronic
1075339009 10:121630503-121630525 TATTTGTAACAGAGACTGTGTGG - Intergenic
1077649270 11:3955192-3955214 AAGTTGGAACAGTGGTTGTGTGG + Intronic
1078382325 11:10855376-10855398 TAGTTGCAACAGAGACTATATGG - Intronic
1078732205 11:13985099-13985121 TTGTTAAAACACAGGTTGTGAGG - Intronic
1080101421 11:28464353-28464375 TAGTTGAAACAGAGACTGTATGG - Intergenic
1080333628 11:31171276-31171298 TAGTTGCAACAGAAATTGTATGG - Intronic
1080336655 11:31205279-31205301 TAGTTGAAACAGAGGCTGTATGG + Intronic
1080996552 11:37609060-37609082 TAGTTGCAACTGAGAAGGTGTGG - Intergenic
1081481261 11:43491454-43491476 TAGGTGCACCAGAGGCTGTCTGG - Intronic
1081673565 11:44955299-44955321 GTGTAGCAACAGAGGTGGTGGGG - Intergenic
1082039911 11:47676343-47676365 GAGTAGCAGCAGTGGTTGTGGGG - Intronic
1083189268 11:61037597-61037619 CAGTTGCAACAAAGACTGTGTGG - Intergenic
1086473539 11:87144356-87144378 TAGTTGCAACAGAGACTGTATGG - Intronic
1087419529 11:97903999-97904021 TAGTGGCATCACAGGTTGTATGG - Intergenic
1088480301 11:110290735-110290757 TGGTTTCAACAGAGACTGTGTGG - Intronic
1088740387 11:112762313-112762335 TGATTGGAACAGAGGCTGTGAGG + Intergenic
1090700097 11:129286564-129286586 AAGTTGCACCAGAGGATTTGGGG - Intergenic
1091126443 11:133103453-133103475 GAGTTGCAGCAGAGTTAGTGAGG + Intronic
1091680124 12:2521220-2521242 TGGTAGGAACAGAGGCTGTGTGG + Intronic
1091869650 12:3877858-3877880 TAGCAGCAACAGAGTTTGAGAGG - Intergenic
1092217220 12:6691966-6691988 TAGTTGAAACAGAGACTGTGGGG - Intergenic
1092575389 12:9776952-9776974 TAGTGACAACACAGGTTATGAGG - Intergenic
1092582618 12:9861932-9861954 TAGTTGCAGCAGAGACTGTATGG + Intronic
1092768587 12:11875894-11875916 TAGTTACAACAGAGATTGCATGG + Intronic
1093006060 12:14052207-14052229 TAGTAGCAACAGAGATTGCATGG - Intergenic
1093526271 12:20106526-20106548 TAGGTGCAACTGAAATTGTGTGG - Intergenic
1093707985 12:22296346-22296368 AAGTTGCAATGGAGGGTGTGGGG + Intronic
1094163229 12:27414242-27414264 TTGTTGAAACTGAGGTTTTGAGG - Intronic
1094687331 12:32730582-32730604 TAGTTGCAGCAGAGACTGTATGG + Intronic
1095398573 12:41789304-41789326 GGGTTACAACAGAGATTGTGAGG - Intergenic
1095600268 12:44005200-44005222 TATTTGCAACAGAGGTCTTCAGG - Intronic
1096006274 12:48174909-48174931 TAGTTGCAACAGAGACCGTATGG + Intronic
1096925623 12:55141711-55141733 TAGATGCCAGAGAGGTTGTGGGG + Intergenic
1097118849 12:56717788-56717810 GAGTTGCAGCTGGGGTTGTGGGG + Intronic
1097118875 12:56717857-56717879 GAGTTGCAGCTGGGGTTGTGGGG + Intronic
1097118900 12:56717926-56717948 GAGTTGCAGCTGGGGTTGTGGGG + Intronic
1097118924 12:56717995-56718017 GAGTTGCAGCTGGGGTTGTGGGG + Intronic
1097118948 12:56718064-56718086 GAGTTGCAGCTGGGGTTGTGGGG + Intronic
1097119048 12:56718340-56718362 GAGTTGCAGCTGGGGTTGTGGGG + Intronic
1098370567 12:69755867-69755889 TAGTTGCAACAGAGACTGCATGG - Intronic
1098584516 12:72140263-72140285 GAGTTGAAATAGGGGTTGTGGGG - Intronic
1098608678 12:72427093-72427115 TAGTTGCCACAGAGACTGTATGG - Intronic
1099896253 12:88651108-88651130 TAGTTGTAACAGAGGCTATGGGG + Intergenic
1100055307 12:90502361-90502383 TAGTTGCTACAGAGATTATAGGG + Intergenic
1100870703 12:98907472-98907494 TGATTGCAGCAGTGGTTGTGGGG - Intronic
1101883198 12:108639833-108639855 TAGCTGCAACAGAGATCGTATGG - Intergenic
1101936938 12:109065928-109065950 TAGTTGCAACAGAGACCATGTGG + Intronic
1102733818 12:115139323-115139345 TAGTTGCAACAGAGACTTTATGG + Intergenic
1102814832 12:115857229-115857251 TACTTCCTAAAGAGGTTGTGAGG - Intergenic
1102954414 12:117050271-117050293 TAGCTGCAACAGAGACTGCGTGG + Intronic
1103057047 12:117829692-117829714 TAGTTGCAACAGAGACCGTGTGG - Intronic
1103625740 12:122218088-122218110 TAGTTTCAACAGAGGCTGTAAGG - Intronic
1103861734 12:124020822-124020844 GAGTTGCAACAGAGATTGAATGG + Intronic
1103890280 12:124233308-124233330 TAGTTGCATCAGAGATTGTCTGG + Intronic
1103912118 12:124357678-124357700 TCCTTGCAACAGAGATTGTCTGG + Intronic
1104278981 12:127356475-127356497 TATTTGCAACAGAGATTCTATGG - Intergenic
1104733851 12:131123990-131124012 TAGTTGCAACAAAGACTGCGTGG + Intronic
1105989759 13:25607184-25607206 TAATTTTAACACAGGTTGTGGGG - Intronic
1106354758 13:28970491-28970513 TAGTTACAACAGGGACTGTGTGG + Intronic
1107042543 13:35964947-35964969 TAGTTGCAACAGAGATCATATGG + Intronic
1110191990 13:72740650-72740672 TGGTTCCAACAGAGGTTGTGTGG - Intronic
1110246962 13:73336986-73337008 TAATTGCAGCAGAGGTTATGTGG + Intergenic
1110370483 13:74734590-74734612 TAGTTGCCACAGAGACTATGTGG + Intergenic
1110696321 13:78495330-78495352 TAGTTGCAAAAGAAACTGTGTGG - Intergenic
1111202123 13:84951760-84951782 TAGTTGCAACTGAGGAGCTGAGG + Intergenic
1112081170 13:95972787-95972809 TAATTGCAACAGAGACTGTATGG - Intronic
1113063229 13:106347374-106347396 CAGTTGTAACAGAGCTTGTCAGG + Intergenic
1113363131 13:109650004-109650026 TAGTTGCAACAGAGATTATATGG + Intergenic
1114325108 14:21581182-21581204 TAGCTGCAACAGAGACTGTATGG - Intergenic
1115828247 14:37301780-37301802 TAGTTGCCACAGAGTTGGGGAGG - Intronic
1116040265 14:39677902-39677924 CAGTTGCAACAGAGACTGTATGG - Intergenic
1116120099 14:40711874-40711896 TAGATGCAGGCGAGGTTGTGGGG + Intergenic
1116751014 14:48883612-48883634 TATTTGCATCTGATGTTGTGCGG - Intergenic
1117754962 14:58965148-58965170 TAGTTGCAACAGAGACCTTGTGG + Intergenic
1117904252 14:60567828-60567850 TAGTTGAAACAGAGATTGTATGG - Intergenic
1118158820 14:63268469-63268491 TAGTTGCAGAAGATGTTGTATGG - Intronic
1118767493 14:68919773-68919795 TAGTTGCTACAGAGCTTATATGG - Intronic
1118837765 14:69488581-69488603 GAGTGGCAACATAGGGTGTGGGG + Intronic
1119012096 14:71004165-71004187 TTGTTGCAACAGAGGTTATCTGG + Intronic
1119588958 14:75867106-75867128 TAGTTGCAACAGAGATGCTATGG - Intronic
1119637265 14:76284609-76284631 TAGTTGCAACAGAGATCATATGG - Intergenic
1119676276 14:76557746-76557768 TAGTTGTAACAGAGATCATGTGG - Intergenic
1120032184 14:79654439-79654461 TAGCTGCAACAGAGATCATGTGG - Intronic
1120271107 14:82314185-82314207 TAGTTGCAACAGAGACTGTTTGG + Intergenic
1120298926 14:82680801-82680823 TAGTTGCAACAGAGACTGTGTGG - Intergenic
1120545952 14:85811561-85811583 TGGTTGTGGCAGAGGTTGTGGGG + Intergenic
1120722364 14:87902967-87902989 TAGCTGCAACACAGATTGTATGG + Intronic
1120900539 14:89571614-89571636 TAGTTGCAACAGAGGTGGTGTGG - Intronic
1121458963 14:94058844-94058866 TAGTTGCCATAGAGACTGTGTGG - Intronic
1121517470 14:94562231-94562253 TAGTGGCAGCAGAGACTGTGTGG + Intronic
1121836204 14:97094644-97094666 CAGTTGCAACAGAGATTGTATGG + Intergenic
1122680531 14:103458118-103458140 TAGTTGCGACAGAGACAGTGTGG - Intronic
1122936491 14:104959974-104959996 GAGTTGCAACAGAGATCATGTGG - Intronic
1123906258 15:24924529-24924551 TACTTTCAACTGAGGTTATGTGG - Intronic
1124493932 15:30175047-30175069 GGGTTGCTGCAGAGGTTGTGCGG + Intergenic
1124749637 15:32363599-32363621 GGGTTGCTGCAGAGGTTGTGCGG - Intergenic
1125120338 15:36150358-36150380 TAATTTCAACAGAGTTTTTGTGG - Intergenic
1126293708 15:47112504-47112526 TAGTTGCAACAGAGACTGTATGG - Intergenic
1126435960 15:48637884-48637906 TAGTTGCAACAGAGACAGTATGG - Intronic
1127213311 15:56798254-56798276 TAGTTGTAACAGAGATTGCATGG - Intronic
1128117946 15:65123944-65123966 TAGTTGCAACAGAGACTGTATGG - Intronic
1129181271 15:73878215-73878237 TAGTTGCAACAGAGACTGCGTGG - Intronic
1129496863 15:75991199-75991221 TAGTTGCAACAGAGACTGTATGG - Intronic
1130067932 15:80620535-80620557 TAGTTGCATCAGAGACTGTGTGG - Intergenic
1130802858 15:87284333-87284355 TAGTTCCAACAGTTTTTGTGTGG - Intergenic
1131757149 15:95577406-95577428 TAGTTGTGACAGACGTTGTAAGG - Intergenic
1131792404 15:95979571-95979593 TAGTTGCAACAGAGACCCTGTGG + Intergenic
1132034261 15:98467704-98467726 TAGTTGCAACAGAGACTTTATGG - Intronic
1133121062 16:3608329-3608351 TAGTTGTGACAGAGTCTGTGTGG + Intronic
1133418152 16:5622721-5622743 TAGTTGCAAGGGAGACTGTGTGG + Intergenic
1134518531 16:14906451-14906473 TAGTTGCACCAGAGATCGTGTGG + Intronic
1134555399 16:15159766-15159788 TAGTTGCACCAGAGATCGTGTGG - Intergenic
1134633410 16:15773749-15773771 TAGTTGCAACAGAGGCCATCTGG + Intronic
1134706202 16:16305104-16305126 TAGTTGCACCAGAGATCGTGTGG + Intergenic
1134847673 16:17454420-17454442 TAGTTGCAACAAAGACTGTATGG - Intronic
1134853524 16:17501077-17501099 TAGTTGCAGCAGAGATGGTATGG - Intergenic
1134961338 16:18407006-18407028 TAGTTGCACCAGAGATCGTGTGG - Intergenic
1134965638 16:18489609-18489631 TAGTTGCACCAGAGATCGTGTGG - Intronic
1135145646 16:19960442-19960464 TAGTTGCAGCAGAGACTGTATGG + Intergenic
1135258045 16:20957262-20957284 TAGTTGCAGCAGAGATCATGTGG - Intronic
1135502564 16:23009684-23009706 TAGTTGCAACAGAGACTGTGTGG - Intergenic
1135852623 16:25978360-25978382 TAGTTACAACAGAGACTGTAGGG - Intronic
1136001952 16:27301426-27301448 TAGTTGCAACAGAGACCTTGTGG - Intergenic
1136158299 16:28400587-28400609 TATTTGCAACAAAGGTTCTTTGG + Intronic
1136204788 16:28714696-28714718 TATTTGCAACAAAGGTTCTTTGG - Intronic
1136458751 16:30397187-30397209 TAAGTGCACCAGAGGTTGAGAGG + Intronic
1137645455 16:50069526-50069548 TGGTTGTTACAGAGCTTGTGGGG + Intronic
1138307788 16:55994041-55994063 TAGTTGCAACAGAGATCATATGG - Intergenic
1140060087 16:71561536-71561558 TAGTTCTAACAGAGTTTTTGTGG + Intronic
1140236455 16:73163517-73163539 TAGTTGCAACAGAGACAGTATGG + Intergenic
1140262205 16:73390199-73390221 GAGATGCTACAGAGGTGGTGGGG - Intergenic
1141044711 16:80705700-80705722 TAGTTGCAACAGAGACCATGTGG - Intronic
1141062834 16:80890220-80890242 TAGCTGCAACAGAAATTATGTGG + Intergenic
1141230937 16:82167097-82167119 TAGTTGTAACAGAGACTGTCTGG + Intronic
1144359882 17:14481946-14481968 TAGTTACATCAGAGACTGTGTGG + Intergenic
1144815995 17:18035643-18035665 TAGTTGGAACAGATATTGTATGG - Intronic
1145052291 17:19672185-19672207 TAGTTGCAACAGAGGCTGAATGG + Intronic
1146414481 17:32619402-32619424 TAGGTGGGACAGAGTTTGTGTGG - Intronic
1147639859 17:41989918-41989940 TAGTTGCAACAGAGACCCTGTGG + Intronic
1148165028 17:45477556-45477578 TAGTTACAACAGAGGTTGTGTGG - Intronic
1149449144 17:56736154-56736176 TAGTTGCAGCAGAGACTGTACGG - Intergenic
1149899242 17:60458570-60458592 TAGTTGCAGCAGAGAATGTGTGG - Intronic
1150396258 17:64824281-64824303 TAGTTACAACAGAGGTTGTGTGG - Intergenic
1151371899 17:73652750-73652772 TAGTTGTAACAGAGACTGTATGG + Intergenic
1151401968 17:73861627-73861649 TGGTTGCAACAGAGACTGTTTGG - Intergenic
1152240134 17:79156698-79156720 GAGTTGCAGCAGAGGCTGTGTGG + Intronic
1152943619 17:83186050-83186072 GTGTTGCAACAGATGTGGTGGGG - Intergenic
1153087653 18:1306743-1306765 TAGTTGCAACAGAGACTTTATGG - Intergenic
1153429270 18:4998069-4998091 TAGTTACAACAGAGATTGTGTGG - Intergenic
1154032595 18:10766636-10766658 TAGTTGCAACTGGGGTTCTCTGG - Intronic
1155441316 18:25865450-25865472 TAGTTGCAACAGAGATGGTGCGG + Intergenic
1156053337 18:32966403-32966425 TGGTTGCAACAGAGACTGTATGG + Intronic
1157473118 18:48004898-48004920 TAGTTGCAACAGAAACTGTATGG + Intergenic
1157799402 18:50606690-50606712 TAGTTGCAAAAGAGACTGTATGG - Intronic
1158214889 18:55089847-55089869 TAGTTGCGACAGAGACTGTATGG + Intergenic
1158256952 18:55562156-55562178 TATTTGCAACAGAGAGTCTGTGG + Intronic
1158887471 18:61841883-61841905 CAGTTGTAACAGATGCTGTGTGG - Intronic
1160492884 18:79352582-79352604 CTGTTGAAACAGAGGTTTTGAGG - Intronic
1161091165 19:2360666-2360688 TAGATGCGGCAGGGGTTGTGTGG + Intergenic
1161554646 19:4933856-4933878 TAGTTGCAACAGAGACTATGCGG + Intronic
1162256040 19:9490569-9490591 TATTTGTAACAGAGACTGTGTGG - Intronic
1162680738 19:12338993-12339015 TGCCTGCAACAGAGGTAGTGGGG - Intergenic
1162991643 19:14306729-14306751 TAGTTGCAACAGAGAATGTCTGG + Intergenic
1163412678 19:17165957-17165979 TAGTTGCAACAGACATTGTCTGG + Intronic
1164702001 19:30292021-30292043 TAGTTGAGACAGAGACTGTGTGG + Intronic
1165662903 19:37597779-37597801 TAGTTGCAATGGAGATTGTATGG - Intronic
1166540361 19:43601250-43601272 TAGTTGCAACAGAGATTTTAAGG + Intronic
925510436 2:4619711-4619733 TAGTTGAATGAGAGGTTGTCAGG - Intergenic
926444636 2:12927295-12927317 TAGTTACACCAGAGATCGTGTGG + Intergenic
926604305 2:14881779-14881801 TAGTTACAACAGAGCCTGTATGG + Intergenic
926631022 2:15136381-15136403 GAGTTGCAACAGAGACCGTGTGG - Intergenic
927832747 2:26367561-26367583 TAGTTGCAACAAAGACTGTATGG + Intronic
928079635 2:28298686-28298708 TAGTTGCAACAGAGACTGGATGG + Intronic
928852189 2:35761824-35761846 AAGGAGCAACAGAGGTTGAGAGG + Intergenic
929850847 2:45589038-45589060 TAGTGGAAACAGAGCTTGAGGGG - Intronic
930155173 2:48099289-48099311 GAGTATCAACAGAGGTTGAGTGG + Intergenic
930417377 2:51105575-51105597 TAGAAACAACAGAGGTTGAGTGG - Intergenic
930940084 2:57001716-57001738 TAGTTGCAACAGAGACTATATGG + Intergenic
931171734 2:59810522-59810544 TAGCTGCAACAGAGATTGGATGG + Intergenic
931765629 2:65453640-65453662 TAGTTGCAACAGAGATTGTGTGG + Intergenic
931999514 2:67871783-67871805 CAGTTCCAACAGATTTTGTGGGG + Intergenic
932012969 2:67996866-67996888 TAGTTGTAGCAGAGTCTGTGTGG - Intergenic
932160592 2:69455918-69455940 TAGTTGCAACAGAGACCATGTGG - Intergenic
932547889 2:72734517-72734539 TAGTTACAACAGAGATTGTATGG - Intronic
932802860 2:74757705-74757727 TGGTTGCAACAGAGATGGTATGG - Intergenic
933177195 2:79188537-79188559 GAGAGGCAACAAAGGTTGTGAGG + Intronic
935379640 2:102438638-102438660 TAGATGCAACAGATGTTGCAAGG - Intronic
935395918 2:102608910-102608932 TATTTGAAACATAAGTTGTGTGG + Intergenic
935609431 2:105005655-105005677 TAGTTGCAACAGAGGCCGTATGG - Intergenic
936859566 2:117001227-117001249 TATTTCCAACAGAGGTACTGGGG + Intergenic
938623310 2:133080548-133080570 TAGTTGCAACAGAGACCGTCTGG + Intronic
938649173 2:133363383-133363405 TAGTTGCAAAAGAGATCATGTGG + Intronic
938679248 2:133672626-133672648 TAGTTGCAACAGAGACTCTATGG - Intergenic
939082517 2:137679765-137679787 TAGTTGCAATAGAGATTGTTTGG - Intergenic
939082521 2:137679833-137679855 TAGTTGCGATAGAGATTGTATGG + Intergenic
939204966 2:139089827-139089849 TAGTTGCCACAGAGACAGTGTGG + Intergenic
940085759 2:149856670-149856692 TAGTAGCAACAAAGGTGGGGAGG + Intergenic
940280349 2:151982242-151982264 TAGTTGCAAGGGAGGCTGTGAGG - Intronic
940448129 2:153802895-153802917 TAGTGGCAACAGAGGAAGAGAGG + Intergenic
940899846 2:159116575-159116597 TAGTCGCAACAGGGACTGTGTGG - Intronic
941166570 2:162089444-162089466 TGATTGCAGCAGAGGTTGTGGGG - Intergenic
942256362 2:174103439-174103461 TAGCTACAACAGAGACTGTGTGG + Intronic
942649553 2:178152270-178152292 TAGTTGCAACAGAAGTTGTACGG + Intergenic
943616428 2:190097590-190097612 AAGTTGCAGCAGAGTTTGAGAGG - Intronic
943855395 2:192783760-192783782 TAGTTGCAACAGAGATTTTATGG + Intergenic
944752730 2:202727751-202727773 TAGTTGAAACAGAGACTGTCTGG + Intronic
944944701 2:204670241-204670263 CAGCTGCAACAGAGGTCATGTGG - Intronic
945253778 2:207787182-207787204 TGGTTGCAACAGAGATGGTGTGG - Intergenic
946466912 2:219920127-219920149 TAGTTGCAATAGAGACTGTATGG + Intergenic
947181451 2:227415034-227415056 TAGTTACAACAGAAGCTGTATGG + Intergenic
947578719 2:231297467-231297489 TGGTTGGAACAGAGACTGTGTGG - Intronic
948726994 2:239940150-239940172 TATTTGTAACAGAGGCTGTATGG - Intronic
1169615530 20:7439470-7439492 TAGTAGAAAGAGAGGGTGTGTGG + Intergenic
1169776158 20:9255726-9255748 TAGCTGCAACAGAGATGGTATGG - Intronic
1170477805 20:16733620-16733642 TAGTTGCAACACAGATTATCTGG - Intronic
1170552275 20:17488424-17488446 TAGTTACAGCAGAGGCTGTGTGG + Intergenic
1170834656 20:19873478-19873500 TAGTTGCAACAGAGACTACGTGG - Intergenic
1172300992 20:33850160-33850182 TATTTGCAACAGAGACTGTCTGG + Intronic
1173217459 20:41098944-41098966 TAGTTGCAAAAGAGACTGTGTGG + Intronic
1173392353 20:42646419-42646441 TTATTGCAACAGAGGTCGTCTGG + Intronic
1173525040 20:43725512-43725534 TAGTTGCAACACAGACTGTGTGG + Intergenic
1173899414 20:46576218-46576240 TAGTGACAACAGAGACTGTGTGG - Intronic
1174669911 20:52297549-52297571 TAGTTGCAACAGAGAATGTGTGG + Intergenic
1174681354 20:52411860-52411882 TATTTGTAACAGAGACTGTGTGG + Intergenic
1174729976 20:52906559-52906581 TAGTTGCAACAGAGACTGTATGG - Intergenic
1174839590 20:53889033-53889055 TAGTGGCAACAGGGGCTGTATGG + Intergenic
1175669705 20:60891423-60891445 TAGTTGCTATAGAGGTTGAATGG - Intergenic
1176119766 20:63449008-63449030 TAGTTCCAGCAGAGATTCTGGGG - Intronic
1177107654 21:16979835-16979857 TAGTTGCAACAGAGACTGTTTGG + Intergenic
1177718421 21:24871271-24871293 CAGCTGCAACAGAGACTGTGTGG + Intergenic
1178074915 21:29006036-29006058 TAGTTGCAACAGAGGCTGAAAGG + Exonic
1178374811 21:32057986-32058008 TAGTTGCAACAGAGACTGCATGG + Intergenic
1178681730 21:34678077-34678099 TAGATGCAACAGAGACTCTGTGG + Intronic
1182010027 22:26992975-26992997 TAGTTGCAACAGAGACCTTGTGG + Intergenic
1182130475 22:27846641-27846663 TAGTTGCAACAGAGACTGTATGG + Intergenic
1182577870 22:31285370-31285392 TAGATACCACATAGGTTGTGAGG - Intronic
1183013347 22:34965792-34965814 TAGTTACAACAGAGAATGTATGG + Intergenic
1183028173 22:35082070-35082092 TCATTGCAACAGAGACTGTGTGG - Intronic
1183073071 22:35409754-35409776 TAGTGGCAACAGAGTATGTAGGG + Intronic
1183252669 22:36741430-36741452 TAGCTGCGACAGAGACTGTGTGG + Intergenic
1183341063 22:37282033-37282055 GAGTTGGAAGAGAGCTTGTGGGG + Intronic
949830291 3:8207412-8207434 TAGTTGCCACAGAGATTGTTTGG - Intergenic
949869640 3:8577106-8577128 TAGTTGCAATAGAGCTCATGTGG - Intergenic
950160281 3:10755457-10755479 CTGTGGCTACAGAGGTTGTGAGG + Intergenic
950192041 3:10983852-10983874 TAGTTGCAACAGAGATCTTACGG + Intergenic
950739571 3:15039534-15039556 GAGTTGGAACAGATGCTGTGTGG + Intronic
950744810 3:15079151-15079173 TAGCAGCAACAGAGACTGTGTGG - Intronic
951634592 3:24759274-24759296 TAGTTGCAACAGAGTACATGTGG + Intergenic
951730547 3:25806217-25806239 TAGTTGCAACAGATACTGTGTGG + Intergenic
951925719 3:27906862-27906884 TAATTGCAACAGAGACTCTGTGG - Intergenic
951983584 3:28592873-28592895 TAGTTGAGACAGAGACTGTGTGG - Intergenic
951993771 3:28704399-28704421 TAGTTGCAGCAGGGGTTGAGGGG + Intergenic
952020807 3:29017370-29017392 TAGTTGTGACAGAGACTGTGTGG - Intergenic
952337085 3:32413152-32413174 GAGTTGCAATAAAGATTGTGTGG + Intronic
952660904 3:35845464-35845486 TAGTTGCAACAGAAATGGTATGG - Intergenic
952671157 3:35970982-35971004 TAGTTGCAGAAGAGACTGTGTGG - Intergenic
953664913 3:44918502-44918524 TAGTGGCCTCAGAGGATGTGTGG - Intronic
954954106 3:54503949-54503971 TAGTTGCAACAGAGACTCTATGG - Intronic
955591715 3:60543136-60543158 TAATTGCAACAGACATTGTGTGG - Intronic
955746587 3:62146730-62146752 TAGTTGCAACAGAGAATATATGG - Intronic
956062168 3:65358542-65358564 TAGCTGTAACAGAGATGGTGTGG - Intronic
956156014 3:66297745-66297767 TAGTTGTAACAGAGACTGTATGG + Intronic
956210015 3:66792795-66792817 TAGCTGCAACAGGGATTGTATGG + Intergenic
956397041 3:68837116-68837138 TAATTGCAACAGAGGCTGTATGG + Intronic
956617455 3:71186927-71186949 TTGTTGCAACAGAGATTGTGTGG - Intronic
956729940 3:72187248-72187270 TAGTTGCAACAGAGATCATCTGG - Intergenic
956780885 3:72602261-72602283 TAGTTGCAACAGAGACTGTGTGG + Intergenic
958002450 3:87767703-87767725 AAAATACAACAGAGGTTGTGAGG - Intergenic
958135361 3:89482684-89482706 TAGTTCCAACAGAGATCATGAGG + Intergenic
959028252 3:101267297-101267319 TAGTTGCAACAGAGACTATATGG + Intronic
959232103 3:103667518-103667540 TAGTTACATCAGAGACTGTGTGG - Intergenic
959680800 3:109094037-109094059 TAGTTGCAACAGAGACCGTATGG - Intronic
959829833 3:110847629-110847651 TAATTGCAACAGAGATTGAATGG + Intergenic
960009304 3:112816165-112816187 TTGTTGCCACAGAGGTTTTATGG - Intronic
961633759 3:128320124-128320146 TAGTTGCAACAGAGGTTGTGTGG + Intronic
961672571 3:128545395-128545417 GAGTTGCAACAGAGATGGTATGG + Intergenic
961938327 3:130609993-130610015 TAGTTGCCACTGGGGTTGTGGGG + Intronic
961948327 3:130717920-130717942 AAGGTGGAGCAGAGGTTGTGGGG + Intronic
962145805 3:132838747-132838769 TAGTTGCAACAAAGATTATGTGG + Intergenic
962227439 3:133626117-133626139 CAGTTGCAAAAGAGATTGTTTGG - Intronic
962382140 3:134906646-134906668 TAGTTGCAACAGAGATCTTATGG + Intronic
962485076 3:135834432-135834454 TAGTTGCAACAGAGACAGTATGG + Intergenic
962622506 3:137193721-137193743 TATGTCCAACAGAGGTTGAGTGG - Intergenic
962900796 3:139759626-139759648 TAGTTGCAACAGATACTGTATGG + Intergenic
963234399 3:142942639-142942661 TAGTTGCAACAGAGATTGTATGG - Intergenic
964166965 3:153719316-153719338 TAGTTGCAACAGAGTCTGTATGG - Intergenic
964391598 3:156203232-156203254 TAGTTGCAATAGAGATTGTATGG + Intronic
964765735 3:160177215-160177237 TAGTTGTGACAGAGGCTGTATGG + Intergenic
965069041 3:163893064-163893086 TGCTTGCAACAGAAGTTGTCTGG - Intergenic
965837665 3:172869083-172869105 GATTTGCAACAGAGCTGGTGGGG + Intergenic
965968727 3:174528040-174528062 TAGTTGCAACAGGTGCCGTGTGG + Intronic
966803267 3:183784723-183784745 GAGTTGCAACAGAGGTCCTACGG + Intronic
966988013 3:185199945-185199967 TAGTTGCAACAGAGACTGTATGG + Intronic
967365918 3:188686380-188686402 GAGTTGCAAGAGAAGCTGTGGGG - Intronic
970403552 4:15740903-15740925 TAGTTGCGACAGAGGTTGCATGG - Intergenic
970403654 4:15741788-15741810 CAGTGGCAACAGAGGTTGCATGG + Intergenic
970889540 4:21027311-21027333 TGGTTGGAACAGAAGCTGTGCGG + Intronic
971154874 4:24070920-24070942 TAGTTGCAACAGAGGCCTTATGG + Intergenic
971268166 4:25112850-25112872 TAGTTGCAACAGAAATGGTACGG + Intergenic
971303706 4:25462696-25462718 TATTTGGAGGAGAGGTTGTGGGG - Intergenic
972369117 4:38405457-38405479 TAGTTGCAACAGACACTGTAAGG - Intergenic
973208562 4:47588515-47588537 TAGTTCCAACAAAGTTTGTCTGG + Intronic
973228320 4:47811867-47811889 TAGTTGCAACAGAGATCATATGG + Intronic
973533664 4:51858869-51858891 TAGTTGCAACAGAGACTGTATGG + Intronic
974006618 4:56563705-56563727 TAGTTGTAACAAAGAGTGTGTGG - Intronic
974011481 4:56611659-56611681 TAGTTGCTGCAGAGGTTGTGAGG - Intergenic
977498058 4:97801993-97802015 TTGTTACAACAGAGGTTGGTTGG + Intronic
978370466 4:108025075-108025097 TACTTGCAACAGAGACTGTATGG - Intronic
978509197 4:109497161-109497183 TAGTTGCAAAAGAGATCATGTGG + Intronic
979248627 4:118539007-118539029 TAGTTGAGACAGAGATTGTATGG + Intergenic
980034693 4:127870535-127870557 AAGTTGGAGCAGAGGTTGAGAGG - Intergenic
980113345 4:128655442-128655464 TAGTTGTAACTGAGATTTTGGGG + Intergenic
980652285 4:135733685-135733707 TATTTGCAACAGAGATTGTGTGG - Intergenic
980754535 4:137140378-137140400 TAGTTACAACAAAGATTGTCTGG - Intergenic
980778969 4:137472144-137472166 TAGTTCCAACAGAGATTATATGG + Intergenic
980965911 4:139521043-139521065 TAGTTGCAACAGATATTATATGG + Intronic
981076082 4:140593749-140593771 TAGTTGCTTCATAGGTTCTGTGG + Intergenic
981582549 4:146264654-146264676 CAGTTGCAGCAGGAGTTGTGAGG - Intronic
982940098 4:161539598-161539620 TAGTTGCCACAGAAATTGTGTGG - Intronic
983501603 4:168505910-168505932 TAGTTGCAACAGAGACTATATGG - Intronic
983770327 4:171541099-171541121 GAGTTGTGACAGAGGCTGTGTGG - Intergenic
984558861 4:181244571-181244593 TGGTTGCAGCAGAGATGGTGTGG - Intergenic
986749358 5:10772704-10772726 TAGTTGCAACAGAGGTGGCATGG + Intergenic
986921221 5:12684543-12684565 TAGTTGTAACAGAGAATGCGTGG + Intergenic
987626482 5:20407229-20407251 AAGTTGAAACATTGGTTGTGTGG - Intronic
987669254 5:20986100-20986122 TAGTTGCAACAGAGGCTACATGG + Intergenic
988162232 5:27533483-27533505 TATTTGCAACAGAAGTTGCTGGG - Intergenic
988480846 5:31629281-31629303 TAGTTGCAACAGAGTCCATGAGG - Intergenic
988731232 5:33975114-33975136 TGGAAGCAGCAGAGGTTGTGTGG - Intronic
989034535 5:37156196-37156218 TAGGTTCCACAGTGGTTGTGAGG - Intronic
989085106 5:37667692-37667714 CAGTTGCAACAGAGTCTGTATGG + Intronic
989954884 5:50346837-50346859 TAGTTGCAACAGAGATAATATGG - Intergenic
990151039 5:52817907-52817929 TAGTCACTACAGAGCTTGTGTGG - Intronic
990291963 5:54361206-54361228 TAGTTGCAACAAAGTTTATCTGG + Intergenic
990388228 5:55290026-55290048 TAGTTGTAACAGAGGCTGTATGG + Intronic
991343747 5:65640498-65640520 TAGTTGAAACGGAGATTGTATGG + Intronic
991564626 5:67991821-67991843 TGGTTGCAACAGAAGTGGTATGG - Intergenic
992719530 5:79546904-79546926 CAGTTGCAACAGAGACCGTGTGG - Intergenic
993447011 5:88025633-88025655 CAGTTGTAACAGAGGCTGTATGG - Intergenic
993557652 5:89361572-89361594 TAGTTGCAACAGAGATTTTCTGG + Intergenic
993653770 5:90553740-90553762 TAGTTGCCACAGAGACTATGTGG + Intronic
995385188 5:111581009-111581031 TAGTTGCAACAGAGATTGTATGG + Intergenic
995651848 5:114378263-114378285 TAGTTGCAACAGAGGCCATGTGG + Intronic
996282262 5:121744725-121744747 TAGATGGAACAGAGGGTTTGGGG - Intergenic
996290162 5:121843467-121843489 TAGTCGCAACAGAGACTGTATGG + Intergenic
996813716 5:127549804-127549826 TAGTTGCAACAGAGAATGTCTGG + Intronic
998136168 5:139675884-139675906 GAGTGGCAACACAGGTGGTGGGG + Intronic
1000097080 5:157980849-157980871 TAGTTGCAAGAGAGGTTGTATGG + Intergenic
1000896236 5:166858854-166858876 TAGTTGCAACACAGACTGTCTGG - Intergenic
1001219672 5:169889677-169889699 TGGTTGCAACAGAAACTGTGTGG - Intronic
1001499851 5:172222313-172222335 TAGGTCCTAAAGAGGTTGTGTGG - Intronic
1003576804 6:7304300-7304322 TAGTTGCAAGAGAGGCTTTATGG - Intronic
1004207429 6:13605310-13605332 TAGTTGCAACAGAGACTGGCTGG + Intronic
1005328687 6:24727471-24727493 TAGTTGAAACAGAGATTGTATGG - Intergenic
1007293436 6:40803725-40803747 CAGCCACAACAGAGGTTGTGAGG + Intergenic
1008302842 6:49863173-49863195 GAGCTGGAACAGAGTTTGTGAGG + Intronic
1009478741 6:64129122-64129144 TAGTTGGAACAGAGGTTGTATGG + Intronic
1010302724 6:74280831-74280853 TTGTTGCAAAAGAGCTTGTTGGG + Intergenic
1011237836 6:85237465-85237487 TAGTTGCAATAGAGACTGTATGG + Intergenic
1011933702 6:92746769-92746791 TAGTTGCAACAAAGACTGTATGG + Intergenic
1012492058 6:99793112-99793134 TAGCTGCAACACAGGTAATGTGG - Intergenic
1012949987 6:105507421-105507443 TAGTTGCTATAGAGATTGTATGG - Intergenic
1013041109 6:106434639-106434661 CAGTTGCAATAGAGACTGTGTGG - Intergenic
1013455406 6:110325319-110325341 GAGTTGCAACAGAAACTGTGTGG - Intronic
1013740896 6:113283428-113283450 AAGTAACAACAGATGTTGTGAGG + Intergenic
1014102026 6:117521788-117521810 TAAATGCAACAGAGATTGTATGG - Intronic
1014135383 6:117883231-117883253 CAGTAGAAACAGAGGTTCTGAGG + Intergenic
1015416268 6:132952278-132952300 TTGTTGAAACAGATGTTGTGGGG - Intergenic
1015807608 6:137127115-137127137 TAGTTGCAAGAAAGGTTGGGAGG + Intergenic
1016272640 6:142306405-142306427 AGTTTGCAACAGAGGTAGTGTGG + Intronic
1016410154 6:143774484-143774506 TAGCTGCAACAGAGACTGTCTGG - Intronic
1016411637 6:143789318-143789340 CAGTTGCAACAAAGATTGTATGG - Intronic
1016929909 6:149394881-149394903 TAGTTGTGACAGAGATTATGTGG - Intronic
1016971283 6:149766649-149766671 TAGTTGCAACAGAGATTACACGG + Intronic
1017054698 6:150426315-150426337 TTGTTGCAACAGAGACTGTGTGG + Intergenic
1017363357 6:153603464-153603486 CAGTTGCAGCAGAGGCTCTGGGG + Intergenic
1020722091 7:11758814-11758836 TGGTTGCAACAGAGGCCATGTGG - Intronic
1021787382 7:24165173-24165195 CAGTAGCAACAGAGGGTGGGAGG + Intergenic
1021953876 7:25804123-25804145 TAGTTGCAATAGAGACTGTCAGG + Intergenic
1022169644 7:27812966-27812988 TAGTTGCAACAGAGACTGTGTGG + Intronic
1023200123 7:37687953-37687975 TCGTTGCAACAGAGATTGTTTGG - Intronic
1023287568 7:38634755-38634777 CTGCTGAAACAGAGGTTGTGGGG + Intergenic
1023303217 7:38795758-38795780 TAGTTCCCACAGGGTTTGTGTGG - Intronic
1023342690 7:39238521-39238543 TAGTTGTAACAAAGATTATGTGG + Intronic
1023395779 7:39750708-39750730 TAGCTGCAACAGAGATTGTATGG + Intergenic
1026465906 7:70654304-70654326 TAGTTGCTACAGAGACTGTATGG - Intronic
1027422951 7:78034989-78035011 TAGTTGAAACACAGGATGTGAGG + Intronic
1027579906 7:79979566-79979588 TAGTTGCAACAGAGATCATATGG - Intergenic
1027744340 7:82054990-82055012 TAGTTGCCACACAGGTTTTCTGG - Intronic
1028195736 7:87905207-87905229 TAGTTGCAACAGAGATCTTACGG - Intronic
1028664172 7:93321149-93321171 TTGTTGCCACAGAGACTGTGCGG + Intronic
1028781904 7:94746815-94746837 TGATTGCAGCAGAGGTTGTGAGG - Intergenic
1028822390 7:95227624-95227646 TAGTTGCAATAGAGACTGTATGG + Intronic
1029026346 7:97420910-97420932 CAGTTTCTACAGAGCTTGTGGGG - Intergenic
1029055698 7:97739336-97739358 TAGTTGCAACAGAGATTACATGG - Intronic
1030260027 7:107554162-107554184 TAGTTGCAACAGAGACTGTATGG + Intronic
1030527985 7:110676265-110676287 TAGTTGCAACAGAGATCATATGG - Intronic
1030607854 7:111657294-111657316 TAGTTGCAACAAAGATTGTGTGG + Intergenic
1030713422 7:112781001-112781023 TAGTTAAAACAGAGATTGTATGG - Intronic
1031375523 7:121020425-121020447 TAATTGCAACAGAGTCTGTATGG + Intronic
1031984358 7:128153626-128153648 CAGTTGCAACAGAGATGCTGTGG + Intergenic
1032151165 7:129431360-129431382 ATGATGCAACAGAGGTTGTAGGG - Intergenic
1033027507 7:137790034-137790056 TAGTTGTGACTGAGATTGTGTGG - Intronic
1033093211 7:138405760-138405782 TACATGCAACAGAGATTGTAAGG + Intergenic
1035100484 7:156392228-156392250 TGGTTGCAACGGTGCTTGTGGGG + Intergenic
1035719239 8:1779063-1779085 AAGTTGAAACAATGGTTGTGTGG + Intronic
1035838496 8:2785437-2785459 TAGTTGAGCCAGAGATTGTGTGG + Intergenic
1036482309 8:9150361-9150383 TAGCTGCAAAAGAGGGAGTGGGG - Intronic
1037892554 8:22631055-22631077 AAGTTGCAACAGAAATTGTATGG - Intronic
1037912775 8:22753914-22753936 TAGAATCAGCAGAGGTTGTGGGG - Intronic
1039693710 8:39887510-39887532 TAGTTGCAATAGAGATTATATGG - Intergenic
1040805738 8:51394572-51394594 TAGTTGGAACAAAGATTGTATGG - Intronic
1040988658 8:53324989-53325011 TTGATGCATCAAAGGTTGTGGGG + Intergenic
1041084143 8:54241708-54241730 TGGTTGCAATAGAGACTGTGTGG + Intergenic
1042672468 8:71279942-71279964 TGGTTGCAACAGAGACCGTGTGG - Intronic
1042869162 8:73381759-73381781 TAGTTACAACAGAGAGTGTGAGG + Intergenic
1043520949 8:81044715-81044737 TGGTTACAGGAGAGGTTGTGAGG - Intronic
1045238137 8:100374221-100374243 TAGTTGCAACAGAGACCGTATGG - Intronic
1045262427 8:100588534-100588556 CAGTTGCAACAGAGACTGTATGG + Intronic
1046058350 8:109105844-109105866 TAGTTGTGACAGAGATTGTATGG + Intronic
1046606447 8:116376337-116376359 TGGTTGCAGCACAGATTGTGTGG + Intergenic
1046936742 8:119891952-119891974 TAGCTCCAACAGAGGCTGAGGGG - Intronic
1046937417 8:119898162-119898184 TAGTTGCAACAGAAATTGTGTGG + Intronic
1046977601 8:120299264-120299286 TGCTTGCAATAGATGTTGTGAGG - Intronic
1047059058 8:121202638-121202660 TAGTTGCCACAGAGGTAGCTGGG - Intergenic
1047315023 8:123724942-123724964 TACTTGCACCAGAGGTTCTGTGG + Intronic
1047625085 8:126648198-126648220 TAGTTGCAACGGAGATTGTCTGG - Intergenic
1047664649 8:127077449-127077471 TAGTGGCAACAGAATCTGTGTGG + Intergenic
1047821246 8:128523518-128523540 TAGTTGCAACAGAGACTGTATGG + Intergenic
1048181625 8:132200363-132200385 TAGTTGCAATAGAGATGGTCTGG + Intronic
1048305671 8:133282759-133282781 CAGTTGCAACAGAGGTCATGTGG + Intronic
1048407748 8:134140348-134140370 TGGTTGCAAAGGAGGTGGTGAGG - Intergenic
1048700169 8:137079402-137079424 TAATTGTAACAGAGATTGTATGG - Intergenic
1048767103 8:137856809-137856831 TAGTTGCAACAGAGACCATGTGG + Intergenic
1049839948 8:144764529-144764551 AAGTTGCAACAGAGGATGAGTGG - Intergenic
1050927293 9:11280465-11280487 TTTTTTCAAAAGAGGTTGTGGGG - Intergenic
1051135290 9:13913213-13913235 CAGTTGCAACAGAGACTGTGTGG - Intergenic
1051284250 9:15479352-15479374 TAGTGGTAAGAGAGGCTGTGGGG - Intronic
1051741002 9:20252079-20252101 CAGTTGGAACAGATGTTGGGAGG + Intergenic
1052090637 9:24322628-24322650 AAGTTGAAACAGAAGATGTGTGG - Intergenic
1052283195 9:26755703-26755725 AAGTTGCAACAGAGTGTGTATGG + Intergenic
1052789645 9:32863238-32863260 TAGTTGCTACAGAGACTGTATGG - Intergenic
1053284411 9:36840984-36841006 TAGTTGCAACAGAGACACTGTGG + Intronic
1053362327 9:37497625-37497647 TAGTTGCAACAGAGGTTGTATGG + Intronic
1054981639 9:71213120-71213142 TAGTTGCAACAGAGATTGTATGG - Intronic
1055253698 9:74339420-74339442 TTGTTGCAACAGAGATTGTATGG - Intergenic
1055723109 9:79197781-79197803 TAGTTGTGACAGAGATTGTATGG + Intergenic
1055874557 9:80926459-80926481 TAGTTGTGACAGAGACTGTGTGG + Intergenic
1056441017 9:86621309-86621331 TTGTTGCAACAGAGATTGTGTGG + Intergenic
1057730161 9:97601648-97601670 TAGTTGCAACAGACACTATGTGG - Exonic
1058007368 9:99931618-99931640 TAGTTGCAACAGAGACTGTATGG + Intronic
1058127945 9:101217564-101217586 TAGTTTCAACAGAGATTGTATGG - Intronic
1058242822 9:102587601-102587623 GAGTTGCAACAGAGATTGCATGG + Intergenic
1058360026 9:104134187-104134209 TAGTTGCAACAGAGACTGGATGG - Intronic
1058458350 9:105159153-105159175 TAGTTGCAACAGAGACCGTGTGG + Intergenic
1059522309 9:114955086-114955108 TAGTTGCAACAGAGGCTGTCTGG - Intergenic
1059557652 9:115297485-115297507 TAGTTACAATAGAGATTATGTGG - Intronic
1059679694 9:116574156-116574178 CACTTGCAACAGAGACTGTGTGG - Intronic
1060384244 9:123208538-123208560 CAGTTGCCACAGAGACTGTGTGG - Intronic
1061601232 9:131671509-131671531 TTGCTGCCACAGAGGTTCTGGGG + Intronic
1185816184 X:3158182-3158204 TAGTTGCAACAGAGACTGAATGG - Intergenic
1186139724 X:6558869-6558891 TAGCTGCAGCAGAGACTGTGGGG - Intergenic
1186160291 X:6770302-6770324 TAGATGCAACAGAGATGCTGTGG + Intergenic
1186343770 X:8670064-8670086 TAGTTCCAACACATTTTGTGGGG - Intronic
1186417160 X:9393744-9393766 TAGTTGCAACAGAGACTGCATGG - Intergenic
1186547922 X:10470242-10470264 TAGTTGCAACAGAGACTGTATGG - Intronic
1186750549 X:12617389-12617411 TAGTTGCAACAGAAACTGTCTGG + Intronic
1186842534 X:13498486-13498508 TAGTTGCCACAGAGACTGTGGGG + Intergenic
1186947281 X:14582797-14582819 TAGTTGCAACAGAGGCAATCTGG - Intronic
1187291208 X:17955177-17955199 CAGTTGCTACAGGAGTTGTGAGG - Intergenic
1187566071 X:20450866-20450888 TAGTTACAGTAGAGATTGTGTGG + Intergenic
1187603006 X:20852807-20852829 TAATTGCAACAAAGATTGTATGG + Intergenic
1187767850 X:22662902-22662924 TAGTTGCAACAGAGACTATATGG + Intergenic
1188303930 X:28539317-28539339 TAGTTTAAACAGAAGCTGTGCGG + Intergenic
1188905486 X:35786477-35786499 TAGTGGCAAGACAGGTTGAGAGG + Intergenic
1189138488 X:38576046-38576068 TAGTTGCAACAGAGACTATATGG - Intronic
1189182043 X:39013685-39013707 TAGTTGCAACAGAGACTGTAGGG + Intergenic
1189865239 X:45320891-45320913 TAGTTGCAACAGAGGCTCTTTGG - Intergenic
1190164855 X:48064947-48064969 TAGTTGCAACAGGGGCCGTATGG + Intronic
1192390489 X:70721763-70721785 TAGTTGTGACAGAGACTGTGTGG + Intronic
1192619180 X:72659821-72659843 TAATTGCAACAGATGCTGTATGG - Intronic
1192729847 X:73792024-73792046 TAGTTGCAACAGAGACCATGTGG - Intergenic
1193807694 X:86013955-86013977 TAACTGCAACAGAGGCTGTGTGG - Intronic
1195593848 X:106665297-106665319 TAGTTGCAAAAGAAATTGTATGG - Intronic
1195834369 X:109096124-109096146 CAGTTGCAACAGTGGCAGTGGGG + Intergenic
1196133006 X:112177856-112177878 TAGTTGAGACAGAGACTGTGTGG - Intergenic
1196424116 X:115552277-115552299 TAGTTGCAACAGACACTGTATGG + Intergenic
1197004763 X:121482100-121482122 TAGTTGCAACAGAGATTCTATGG + Intergenic
1197687586 X:129458084-129458106 TAGTTGTGACAGAGATTGTGTGG - Intronic
1198501940 X:137258748-137258770 TAGTTGCAACAGACACTGTATGG + Intergenic
1198814540 X:140574306-140574328 TAGATGCAACAGAGACTATGTGG - Intergenic
1198816223 X:140593915-140593937 TAATTGCAACAGAGGTCATATGG + Intergenic
1199854752 X:151751302-151751324 TAGGTGCTACAGATGTAGTGGGG - Intergenic
1201335163 Y:12872855-12872877 TTGTTGCAGCAGAGATTGTGAGG + Intergenic