ID: 961633982

View in Genome Browser
Species Human (GRCh38)
Location 3:128321494-128321516
Sequence GGTCTGCCCAGAGACTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 196}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961633982_961633987 3 Left 961633982 3:128321494-128321516 CCAGGACAGTCTCTGGGCAGACC 0: 1
1: 0
2: 1
3: 13
4: 196
Right 961633987 3:128321520-128321542 TGGGGTGCATCCTGCTAGCTAGG 0: 1
1: 0
2: 1
3: 5
4: 124
961633982_961633989 19 Left 961633982 3:128321494-128321516 CCAGGACAGTCTCTGGGCAGACC 0: 1
1: 0
2: 1
3: 13
4: 196
Right 961633989 3:128321536-128321558 AGCTAGGACACTGTCCTGACAGG 0: 1
1: 0
2: 0
3: 11
4: 115
961633982_961633993 28 Left 961633982 3:128321494-128321516 CCAGGACAGTCTCTGGGCAGACC 0: 1
1: 0
2: 1
3: 13
4: 196
Right 961633993 3:128321545-128321567 ACTGTCCTGACAGGCTGGAGGGG 0: 1
1: 0
2: 2
3: 30
4: 203
961633982_961633990 23 Left 961633982 3:128321494-128321516 CCAGGACAGTCTCTGGGCAGACC 0: 1
1: 0
2: 1
3: 13
4: 196
Right 961633990 3:128321540-128321562 AGGACACTGTCCTGACAGGCTGG 0: 1
1: 0
2: 2
3: 16
4: 198
961633982_961633992 27 Left 961633982 3:128321494-128321516 CCAGGACAGTCTCTGGGCAGACC 0: 1
1: 0
2: 1
3: 13
4: 196
Right 961633992 3:128321544-128321566 CACTGTCCTGACAGGCTGGAGGG 0: 1
1: 0
2: 1
3: 28
4: 333
961633982_961633991 26 Left 961633982 3:128321494-128321516 CCAGGACAGTCTCTGGGCAGACC 0: 1
1: 0
2: 1
3: 13
4: 196
Right 961633991 3:128321543-128321565 ACACTGTCCTGACAGGCTGGAGG 0: 1
1: 0
2: 3
3: 15
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961633982 Original CRISPR GGTCTGCCCAGAGACTGTCC TGG (reversed) Intronic