ID: 961634105

View in Genome Browser
Species Human (GRCh38)
Location 3:128322091-128322113
Sequence AAACTGCTCCTGCTATAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 227}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961634105_961634113 14 Left 961634105 3:128322091-128322113 CCCCTCTATAGCAGGAGCAGTTT 0: 1
1: 0
2: 2
3: 22
4: 227
Right 961634113 3:128322128-128322150 AATCCCCAGTGCCCAGCTTGGGG 0: 1
1: 0
2: 1
3: 30
4: 221
961634105_961634119 28 Left 961634105 3:128322091-128322113 CCCCTCTATAGCAGGAGCAGTTT 0: 1
1: 0
2: 2
3: 22
4: 227
Right 961634119 3:128322142-128322164 AGCTTGGGGCACATGTGTCAAGG 0: 1
1: 0
2: 1
3: 22
4: 186
961634105_961634111 12 Left 961634105 3:128322091-128322113 CCCCTCTATAGCAGGAGCAGTTT 0: 1
1: 0
2: 2
3: 22
4: 227
Right 961634111 3:128322126-128322148 AGAATCCCCAGTGCCCAGCTTGG 0: 1
1: 1
2: 2
3: 22
4: 289
961634105_961634112 13 Left 961634105 3:128322091-128322113 CCCCTCTATAGCAGGAGCAGTTT 0: 1
1: 0
2: 2
3: 22
4: 227
Right 961634112 3:128322127-128322149 GAATCCCCAGTGCCCAGCTTGGG 0: 1
1: 0
2: 4
3: 29
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961634105 Original CRISPR AAACTGCTCCTGCTATAGAG GGG (reversed) Intronic
901393930 1:8966796-8966818 CACCTGCTCCTGCTCTAGAGAGG - Intronic
903953784 1:27011535-27011557 AAACTGCCCCAGCTATAAAATGG + Intronic
909136067 1:71802012-71802034 AAACTGTTCATGCTATGAAGTGG + Intronic
909747794 1:79120491-79120513 AAACTACTCTTGCTATGGAAAGG + Intergenic
910353264 1:86324297-86324319 AAACTGACCCTGGTAGAGAGTGG + Intergenic
913930314 1:124952532-124952554 AAACTGCTCTTTCTAAAGAAGGG + Intergenic
913931568 1:124972033-124972055 AAACTGCTCTTTCTAAAGACGGG + Intergenic
918126263 1:181586824-181586846 AAACTGCTCCTGGCATTCAGTGG - Intronic
920421046 1:205833771-205833793 AAACTGCCTCTGCTCTAGAAAGG + Intronic
921589296 1:216985072-216985094 AAGCTGCACCTGCCATAAAGGGG - Intronic
924941741 1:248816876-248816898 CAACTCCTCCTGCCACAGAGAGG + Exonic
1065643081 10:27805084-27805106 AAAAAGCTCCTGCTACACAGAGG + Intergenic
1066823930 10:39537636-39537658 AAACTGCTCTATCAATAGAGAGG - Intergenic
1066830349 10:39724800-39724822 AAACTGCTCTTTCTAAAGAAAGG - Intergenic
1066933180 10:41792804-41792826 AAACTGCTCAATCTAAAGAGAGG - Intergenic
1070155151 10:73829099-73829121 AAACTGCTCCTGCCCTCAAGCGG + Intronic
1071136391 10:82459018-82459040 AAACTGCTCTGGCTACAGTGTGG - Intronic
1071597980 10:86942020-86942042 CTACTGCTCCTGCTACAGAGAGG - Intronic
1071751467 10:88482033-88482055 AAACAGCTCATGACATAGAGAGG - Intronic
1071879862 10:89885281-89885303 AAACTACTGCTGCTATAAAATGG - Intergenic
1073488502 10:103837338-103837360 AAACTTCTCCTGCTAGCAAGTGG - Intronic
1080637990 11:34140230-34140252 AACCTGCTCCTGCCATAGAAGGG - Intronic
1086676072 11:89608556-89608578 AGACTGCCCCAGCTACAGAGCGG - Intergenic
1091820283 12:3470909-3470931 AACCTGCTCCTGCAAAAGACAGG + Intronic
1094869442 12:34582994-34583016 AAACTGCTCATGCAAAAGAAAGG + Intergenic
1094870082 12:34592831-34592853 AAACTGCTCCTTCAAAAGAAAGG - Intergenic
1094870092 12:34593117-34593139 CAACTGCTCCTTCAATAGAAAGG - Intergenic
1094870169 12:34594311-34594333 AAACTGCTCCTTCAATCGAAAGG - Intergenic
1094870209 12:34595000-34595022 AAACTGCTCCTTCAGTAGAAAGG - Intergenic
1094877165 12:34662436-34662458 AAACTACTCCTACAAAAGAGAGG - Intergenic
1094883917 12:34839763-34839785 AAACTGCTCCATCTAAAGAAAGG - Intergenic
1094893132 12:34989237-34989259 AAACTGCTCCATCAATAGAAAGG - Intergenic
1094898609 12:35078236-35078258 AAACTGCTCCATCAATAGAAAGG - Intergenic
1094929621 12:35579758-35579780 AAACTGCTCCATCAATAGAAAGG - Intergenic
1094953513 12:35967303-35967325 AAACTGCTCCATCAATAGAAAGG - Intergenic
1094955066 12:35992098-35992120 AAACTGCTCCATCAATAGAAAGG - Intergenic
1094977287 12:36350474-36350496 AAACTGCTCCATCAATAGAAAGG - Intergenic
1094994939 12:36636541-36636563 AAACTGCTCCATCAATAGAAAGG - Intergenic
1095001998 12:36750846-36750868 AAACTGCTCCTTCAAAAGAAAGG - Intergenic
1095057909 12:37639042-37639064 AAACTGCTCCATCAAAAGAGTGG + Intergenic
1095058470 12:37649731-37649753 AAACTGCTCATTCAAAAGAGAGG - Intergenic
1095070045 12:37830951-37830973 AAACTGCTCATACAATAGAATGG - Intergenic
1095073485 12:37888219-37888241 AAACTGCTCTTTCTAAAGAGAGG + Intergenic
1095078133 12:37959176-37959198 AAACTGCTCCTGCAAAAGAAAGG - Intergenic
1097653600 12:62334036-62334058 AAACTACTCCAGCAAAAGAGGGG + Intronic
1099654530 12:85472071-85472093 AAACAGCCCATGCTATAGATCGG - Intergenic
1101877288 12:108604126-108604148 AAACTGCTCATGCTATAGATGGG + Intergenic
1105087873 13:16231411-16231433 AAACTGCTCCTTCAAAAGAGTGG - Intergenic
1105088082 13:16235168-16235190 AAACTGCTCCTTCAAAAGAGTGG - Intergenic
1105088292 13:16238929-16238951 AAACTGCTCCTTCAAAAGACTGG - Intergenic
1105088497 13:16242687-16242709 AAACTGCTCCTTCAAAAGAGTGG - Intergenic
1105088707 13:16246443-16246465 AAACTGCTCCTTCAAAAGAGTGG - Intergenic
1105097824 13:16401128-16401150 AAACTGCTCTTTCAATAGAAAGG - Intergenic
1105116585 13:16707417-16707439 AAACTGCTCCGTCAATAGAAAGG - Intergenic
1105118497 13:16738624-16738646 AAACTGCTCTTTCAATAGAAAGG - Intergenic
1105125082 13:16846263-16846285 AAACTGCTCTGTCTATAGAAAGG - Intergenic
1105129004 13:16910379-16910401 AAACTGCTCTGGCAATAGAAAGG - Intergenic
1105131096 13:16944493-16944515 AAACTGCTCTGTCTATAGAAAGG - Intergenic
1105134012 13:16991898-16991920 AAACTGCTCTGGCAATAGAAAGG - Intergenic
1105139830 13:17087399-17087421 AAACTGCTCTTTCAATAGAAAGG - Intergenic
1105163147 13:17466949-17466971 AAACTGCTGCTTCAAAAGAGAGG - Intergenic
1105164003 13:17480363-17480385 AAACTGCTGCTTCAAAAGAGAGG - Intergenic
1105167496 13:17535452-17535474 AAACTGCTGCTTCAAAAGAGAGG - Intergenic
1105176205 13:17671419-17671441 AAACTGCTGCATCTAAAGAGAGG - Intergenic
1105178285 13:17703568-17703590 AAACTGCTCCATCAATAGAAAGG - Intergenic
1105185530 13:17816566-17816588 AAACTGCTCCATCAATAGAAAGG - Intergenic
1105186456 13:17831176-17831198 AAACTGCTCCATCAATAGAAAGG - Intergenic
1105188652 13:17865178-17865200 AAACTGCTGCTTCAAAAGAGAGG - Intergenic
1105189673 13:17881158-17881180 AAACTGCTCTTTCAATAGAAAGG - Intergenic
1105346879 13:19581360-19581382 AAATTGCTCCTGATATAGATCGG + Intergenic
1105590881 13:21791870-21791892 TAGCTGCTTCTGCTAGAGAGAGG + Intergenic
1107257484 13:38445758-38445780 AAAATGCTGATGCTATAAAGAGG - Intergenic
1107479597 13:40774570-40774592 AAATTGCTCCTGATATAGAGTGG + Intergenic
1109341159 13:61060734-61060756 TACCTGCTCCTGCTATGGGGTGG - Intergenic
1109513121 13:63405118-63405140 AAATTGGTACTGGTATAGAGTGG - Intergenic
1111932206 13:94524062-94524084 CATCTCCTCCTGCTATAAAGGGG - Intergenic
1113834819 13:113321879-113321901 TAACTCCCCCTGCTTTAGAGAGG + Intronic
1116243081 14:42371851-42371873 AAAATGATCATGTTATAGAGGGG - Intergenic
1121826895 14:97017515-97017537 ACACTGCTCCTGCTGTGAAGAGG + Intergenic
1122761563 14:104032677-104032699 ACACTGCTCCTGGCATACAGTGG - Intronic
1129770727 15:78201709-78201731 AGACTTCTTCTTCTATAGAGAGG - Intronic
1131723718 15:95200626-95200648 AAACTGGTGCTGGTAGAGAGAGG + Intergenic
1132179114 15:99738401-99738423 CAACTGCTCATTTTATAGAGAGG + Intergenic
1136916119 16:34199693-34199715 AAACTGCTCCATCAAAAGAGAGG + Intergenic
1141284915 16:82662698-82662720 TAACAGCTTCTGCTATAGAAGGG + Intronic
1141322112 16:83020779-83020801 TATCTGCTCTTGCAATAGAGAGG + Intronic
1141608158 16:85167311-85167333 GAACAGCACCTGCTCTAGAGAGG + Intergenic
1141806835 16:86347573-86347595 AAAATGGTCCTGCTTGAGAGAGG - Intergenic
1141903688 16:87008850-87008872 CAAGTGCTCCTGCTAGAGTGAGG + Intergenic
1144354571 17:14432794-14432816 ATACTGATCCTGGTATAGTGAGG + Intergenic
1146484383 17:33231397-33231419 GGACTGCTCATGCTATACAGAGG + Intronic
1149794138 17:59504234-59504256 AAACTCCTCCTGCTAATCAGGGG + Intergenic
1151403654 17:73872816-73872838 AACCTGCTCCTTATGTAGAGGGG + Intergenic
1154376156 18:13811726-13811748 AGACAGCTCCTCCTCTAGAGTGG + Intergenic
1154559034 18:15800963-15800985 AAACTGCTCCTTCAAAAGGGTGG - Intergenic
1154560377 18:15819629-15819651 AAACTGCTCCTTCAAAAGGGTGG - Intergenic
1154565424 18:15889358-15889380 AAACTGCTCCTTCAAAAGGGTGG - Intergenic
1154572662 18:15987779-15987801 AAACTGCTCCTTCAAAAGGGTGG - Intergenic
1154574015 18:16006447-16006469 AAACTGCTCCTTCTAAACGGTGG - Intergenic
1154576181 18:16035969-16035991 AAACTGCTCCTTCAAAAGGGTGG - Intergenic
1154589125 18:16213289-16213311 AAACTGCTCCTTCAAAAGGGTGG - Intergenic
1154590226 18:16228375-16228397 AAACTGCTCCTTCAAAACAGTGG - Intergenic
1154594356 18:16284556-16284578 AAACTGCTCCTTCAAAAGGGTGG - Intergenic
1154603496 18:16409753-16409775 AAACTGCTCCTTCAAAAGGGTGG - Intergenic
1154614766 18:16564704-16564726 AAACTGCTCCTTCAAAAGGGTGG - Intergenic
1154629197 18:16762691-16762713 AAACTGCTCCTTCAAAAGGGTGG - Intergenic
1154636616 18:16864640-16864662 AAACTGCTCCTTCAAAAGGGTGG - Intergenic
1154647160 18:17009659-17009681 AAACTGCTCCTTCAAAAGGGTGG - Intergenic
1154674038 18:17377247-17377269 AAACTGCTCCTTCAAAAGGGTGG - Intergenic
1154676612 18:17412527-17412549 AAACTGCTCCTTCAAAACAGTGG - Intergenic
1154689272 18:17586067-17586089 AAACTGCTCCTTCAAAAGGGTGG - Intergenic
1154701205 18:17749582-17749604 AAACTGCTCCTTCAAAAGGGTGG - Intergenic
1154702271 18:17764173-17764195 AAACTGCTCCTTCAAAAGGGTGG - Intergenic
1154727254 18:18106777-18106799 AAACTGCTCCTTCAAAACAGTGG - Intergenic
1154740296 18:18285540-18285562 AAACTGCTCCTTCAAAAGGGTGG - Intergenic
1154741692 18:18304533-18304555 AAACTGCTCCTTCAAAAGGGTGG - Intergenic
1154743527 18:18329480-18329502 AAACTGCTCCTTCAAAAGGGTGG - Intergenic
1154744859 18:18347968-18347990 AAACTGCTCCTTCAAAAGGGTGG - Intergenic
1154748134 18:18392741-18392763 AAACTGCTCCTTCAAAAGGGTGG - Intergenic
1154749870 18:18416646-18416668 AAACTGCTCCTTCAAAAGGGTGG - Intergenic
1154753370 18:18464966-18464988 AAACTGCTCCTTCAAAAGGGTGG - Intergenic
1154785618 18:18907227-18907249 AAACTGCTCCTTCAAAAGGGTGG - Intergenic
1154791559 18:18989105-18989127 AAACTGCTCCTTCAAAAGGGTGG - Intergenic
1154792751 18:19005386-19005408 AAACTGCTCCTTCAAAAGGGTGG - Intergenic
1154796520 18:19057292-19057314 AAACTGCTCCTTCAAAACAGTGG - Intergenic
1154803771 18:19157009-19157031 AAACTGCTCCTTCAAAAGGGTGG - Intergenic
1154804470 18:19166509-19166531 AAACTGCTCCTTCAAAACAGTGG - Intergenic
1154821992 18:19407522-19407544 AAACTGCTCCTTCAAAAGGGTGG - Intergenic
1154828830 18:19502484-19502506 AAACTGCTCCTTCAAAAGGGTGG - Intergenic
1154832544 18:19553705-19553727 AAACTGCTCCTTCAAAACAGTGG - Intergenic
1154833517 18:19566937-19566959 AAACTGCTCCTTCAAAACAGTGG - Intergenic
1154834072 18:19574736-19574758 AAACTGCTCCTTCAAAAGGGTGG - Intergenic
1154847483 18:19759086-19759108 AAACTGCTCCTTCAAAAGGGTGG - Intergenic
1154852077 18:19822341-19822363 AAACTGCTCCTTCAAAAGGGTGG - Intergenic
1154859170 18:19920861-19920883 AAACTGCTCCTTCAAAAGGGTGG - Intergenic
1154864714 18:19997494-19997516 AAACTGCTCCTTCAAAAGGGTGG - Intergenic
1154873518 18:20118757-20118779 AAACTGCTCCTTCAAAAGGGTGG - Intergenic
1154894859 18:20412600-20412622 AAACTGCTCCTTCAAAAGGGTGG - Intergenic
1154897209 18:20445140-20445162 AAACTGCTCCTTCAAAAGGGTGG - Intergenic
1154905113 18:20553353-20553375 AAACTGCTCCTTCAAAACAGTGG - Intergenic
1155611460 18:27672385-27672407 AAATTGCTCCTGCTCTTGTGTGG + Intergenic
1160059967 18:75520600-75520622 AAATTGCTCCAACTATAAAGTGG + Intergenic
1161808437 19:6458360-6458382 AACCTGCTCCTGATCTGGAGGGG + Intronic
1164328658 19:24229026-24229048 AAACTGCTCAAGCAAAAGAGAGG + Intergenic
1164346602 19:27270641-27270663 AAACTGCTCTAGCAAAAGAGAGG - Intergenic
1164346721 19:27272436-27272458 AAACTGCTCTAGCAAAAGAGAGG - Intergenic
1164351602 19:27351551-27351573 AAACTGCTCAAGCAAAAGAGAGG + Intergenic
1164352206 19:27363063-27363085 AAACTGCTCCATCAATAGAAAGG + Intergenic
1164366722 19:27591945-27591967 AAACTGCTCATTCAATAGAAGGG - Intergenic
1164898718 19:31899796-31899818 TAGCTCCTCCTGCTGTAGAGGGG - Intergenic
1165373613 19:35425976-35425998 ATCCTGCTCCTGCTCAAGAGAGG - Intergenic
926294005 2:11554178-11554200 AAAGTGCTCCTGAAAGAGAGAGG - Intronic
928359387 2:30650387-30650409 AAACTGCTCCTACTAGCCAGAGG + Intergenic
928854960 2:35792107-35792129 AAACTGCCCTTGCTATAGACTGG + Intergenic
930975957 2:57461501-57461523 CAAGTGCTCCTGCTATTTAGAGG + Intergenic
932315041 2:70774729-70774751 AAAGTGATCCTGCTATAAAGTGG + Intergenic
933326315 2:80842643-80842665 AAAGTACACATGCTATAGAGGGG + Intergenic
935073519 2:99717053-99717075 AAACTGCTCACGCTATAGCATGG - Intronic
935295401 2:101644891-101644913 ACCCTACTACTGCTATAGAGAGG - Intergenic
939316334 2:140554576-140554598 AAACTGTTCCGGATATGGAGAGG - Intronic
941428682 2:165384622-165384644 ATACTGCTCCTGCTTTTGAGGGG + Intronic
941454545 2:165699834-165699856 AAGCTGATCCTGCAATAGATAGG + Intergenic
942688065 2:178555037-178555059 AACCTGCGCCTACTATTGAGTGG - Exonic
945693102 2:213066677-213066699 AAACTGCTGCTGCTACATTGTGG - Intronic
946474934 2:219997938-219997960 AATCTGCTCATGCTACAGATGGG + Intergenic
949012350 2:241687944-241687966 AAACTGTCTCTGCCATAGAGAGG + Intergenic
1169153235 20:3306926-3306948 AAACTGCTCCTGCTGCTGAGTGG + Intronic
1171057180 20:21918656-21918678 AAACTGCTCCTGCTTCAAATGGG - Intergenic
1171360790 20:24585091-24585113 AAACAGCTCCTGCTACAGCTGGG + Intronic
1171738200 20:28825216-28825238 AAACTGCTCCATCAAAAGAGAGG + Intergenic
1175937327 20:62519771-62519793 GGACTGTTCCTGGTATAGAGTGG + Intergenic
1176321108 21:5326677-5326699 AAACTGCTCAATCAATAGAGTGG + Intergenic
1176478455 21:7256017-7256039 AAACTGCTCCATCAAAAGAGAGG + Intergenic
1176478493 21:7256698-7256720 AAACTGCTCAATCAATAGAGTGG + Intergenic
1176760325 21:10776260-10776282 AAACTGCTCCATCAAAAGAGAGG - Intergenic
1180061300 21:45386332-45386354 AAACTGCTCCTGCTGCTGGGGGG - Intergenic
1180626011 22:17194072-17194094 AAACTGCTTCTTCTTTTGAGAGG - Intronic
954349927 3:50034825-50034847 AAACTGCCCTTGCTATAGACTGG - Intronic
956315370 3:67929655-67929677 TAGCTGCTCTTGCTATAGAAAGG + Intergenic
958203345 3:90352579-90352601 AAACTGCTCATTCAAAAGAGAGG + Intergenic
958213489 3:90525975-90525997 AAACTGCTCTCTCAATAGAGAGG + Intergenic
958222827 3:90716895-90716917 AAACTGCTCTCTCAATAGAGAGG + Intergenic
958405039 3:93746703-93746725 AAACTGCTCCATCAAAAGAGAGG + Intergenic
958408906 3:93788848-93788870 AAACTGCTCCATCTAAAAAGAGG + Intergenic
959599233 3:108160608-108160630 AAACTCTTCATGCTATAGAATGG + Intergenic
961634105 3:128322091-128322113 AAACTGCTCCTGCTATAGAGGGG - Intronic
962596831 3:136954881-136954903 CAACTTCTCTTTCTATAGAGGGG + Intronic
966796236 3:183716737-183716759 AAACTGCCCCTGCTTGAAAGGGG - Intronic
967897002 3:194404541-194404563 AAACTGATCGTGCTATAAAATGG - Exonic
973145197 4:46817018-46817040 CAGCTGCTCATGCTACAGAGTGG + Intronic
973981478 4:56311825-56311847 AAAGGGCTCCTGCTAGAGTGTGG - Intronic
976786754 4:88830102-88830124 AAACTTCTTCTGCTACTGAGTGG + Intronic
977977918 4:103288181-103288203 AAACAGACCCTGCTATAAAGAGG - Intergenic
980027981 4:127789304-127789326 AATCTGCTCTTGCTATTGTGTGG - Intronic
985382762 4:189412773-189412795 CAACTGCTCCTGCTCTAGGGAGG + Intergenic
987663440 5:20906395-20906417 CATCTGCTCCTCCTCTAGAGAGG + Intergenic
988759242 5:34295792-34295814 CATCTGCTCCTCCTCTAGAGAGG - Intergenic
989835439 5:45982798-45982820 AAACTGCTCCATCTAAAGATAGG - Intergenic
989837775 5:46015496-46015518 AAACTGCTCCTTGTAAAGAAAGG - Intergenic
992971297 5:82061232-82061254 TTACTGTTTCTGCTATAGAGAGG - Intronic
993882959 5:93384247-93384269 AAACTGCCCTTGCTAAAGAATGG + Intergenic
994792800 5:104252557-104252579 AAACTACTCCTGCTATTTTGTGG + Intergenic
996467070 5:123815320-123815342 AGACTGCTCCTTCTATATCGTGG + Intergenic
1003699202 6:8443714-8443736 AAACAGCTCTCTCTATAGAGAGG + Intergenic
1007114601 6:39334708-39334730 ATACTGCTGCTGCTACATAGGGG + Exonic
1009254062 6:61353258-61353280 AAACTGCTCCTTCAAAAGAATGG - Intergenic
1009254124 6:61354289-61354311 AAACTGCTCCTTCAAAAGAATGG - Intergenic
1009258748 6:61455079-61455101 AAACTGCTCCTTCAAAAGAATGG - Intergenic
1009258810 6:61456110-61456132 AAACTGCTCCTTCAAAAGAATGG - Intergenic
1014309793 6:119785698-119785720 CAACTGCTCCAGGTCTAGAGGGG + Intergenic
1014550130 6:122780469-122780491 AAACTGCTTCTTCTTCAGAGTGG + Intronic
1015612828 6:135044270-135044292 AAACCACTCCACCTATAGAGTGG - Intronic
1015766798 6:136727231-136727253 AAACTGTTCCTCCTATAAATGGG - Intronic
1016440192 6:144075334-144075356 AAACTTCTCCAGTTACAGAGGGG + Intergenic
1019875877 7:3810162-3810184 AAACTGCTCCAGATATGGGGGGG - Intronic
1025314352 7:58000364-58000386 AAACTGCTCTTTCAAAAGAGAGG - Intergenic
1025569566 7:62542924-62542946 AAACTGCTCCATCAAAAGAGAGG - Intergenic
1025571954 7:62584997-62585019 AAACTGCTCCAGCAAAAGAGGGG + Intergenic
1027541715 7:79475626-79475648 AAACAGATACTGCTAGAGAGGGG + Intergenic
1028721917 7:94042695-94042717 AAACAACCCTTGCTATAGAGAGG - Intergenic
1028928886 7:96390961-96390983 AAACAGAGCCTGCTACAGAGTGG + Intergenic
1034876993 7:154733221-154733243 GAACTGCTGCTGCTGGAGAGGGG + Intronic
1035036228 7:155896918-155896940 AAACTTCTCTCGCTAAAGAGCGG + Intergenic
1037146950 8:15583989-15584011 ATACTGCCCCTGCAATACAGAGG - Intronic
1037618679 8:20543955-20543977 GCACTGCTCCTGCAATAGAATGG + Intergenic
1038639586 8:29312659-29312681 ATATTGTTCCTGATATAGAGGGG - Intergenic
1039092204 8:33844201-33844223 AAAATCCTCCAGCTCTAGAGAGG - Intergenic
1041932084 8:63297897-63297919 AAGCTACTCCTGGGATAGAGTGG - Intergenic
1042025797 8:64422392-64422414 AATCTGATCGTGCTACAGAGAGG + Intergenic
1043262643 8:78221066-78221088 AAACTGGTACTGGTATAGTGGGG - Intergenic
1045705590 8:104918872-104918894 AAACTGCACTTGCCATAGGGTGG + Intronic
1046136563 8:110034914-110034936 AAACCACTCCTGCAAGAGAGTGG - Intergenic
1056109863 9:83384349-83384371 CAGCTGCTCCTGCCATTGAGAGG - Intronic
1058487799 9:105459495-105459517 AATCTGCAACTGCTGTAGAGAGG - Intronic
1059576483 9:115494324-115494346 AAACTGCTCCTGGTACACAGTGG + Intergenic
1059744648 9:117188343-117188365 AAACTCCTCATGCTATGGAAAGG - Intronic
1059773902 9:117455480-117455502 AAATTTCTCCTGCTCTGGAGGGG - Intergenic
1203353591 Un_KI270442v1:107873-107895 AAACTGCTCCTTCAAAAGAGTGG - Intergenic
1203401517 Un_KI270519v1:106274-106296 AAACTGCTCCTTCAAAAGAAAGG - Intergenic
1186592599 X:10946984-10947006 GAACTGCTTCTGCTAATGAGTGG - Intergenic
1187864891 X:23715057-23715079 AGACTGTTCCTGCAATTGAGGGG - Intronic
1190386178 X:49884162-49884184 AACCAGATCCTGCAATAGAGTGG - Intergenic
1191565756 X:62526990-62527012 AAACTGCTCTTTCTAAAGAACGG + Intergenic
1191566153 X:62534696-62534718 AAACTGCTCCATCAAAAGAGAGG - Intergenic
1191570354 X:62607481-62607503 AATCTGCTCCTTCTAAAGAAAGG - Intergenic
1191678257 X:63814685-63814707 AATCTGCTCCTGCCATAAGGGGG + Intergenic
1193791456 X:85820135-85820157 AAACAGCTCTTTCTAGAGAGAGG - Intergenic
1193917281 X:87380316-87380338 AAGCTGCATCTGCTATAGAGGGG - Intergenic
1194282014 X:91964655-91964677 AAAATGCTCCTGCTAAAGTGTGG + Intronic
1199655270 X:149988376-149988398 GAACTGCTTCTCCTAGAGAGGGG - Intergenic
1200599612 Y:5189315-5189337 AAAATGCTCCTGCTAAAGTGTGG + Intronic
1201064075 Y:10073695-10073717 AAACTGCTCCTTCAAAAGAAAGG - Intergenic