ID: 961635503

View in Genome Browser
Species Human (GRCh38)
Location 3:128330354-128330376
Sequence ATGTGGCAGGCACTGTGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1648
Summary {0: 1, 1: 8, 2: 84, 3: 339, 4: 1216}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961635497_961635503 -5 Left 961635497 3:128330336-128330358 CCTCTCAGAGTGTGCCCCATGTG 0: 1
1: 0
2: 1
3: 13
4: 144
Right 961635503 3:128330354-128330376 ATGTGGCAGGCACTGTGCTGAGG 0: 1
1: 8
2: 84
3: 339
4: 1216
961635496_961635503 -1 Left 961635496 3:128330332-128330354 CCTTCCTCTCAGAGTGTGCCCCA 0: 1
1: 0
2: 0
3: 23
4: 211
Right 961635503 3:128330354-128330376 ATGTGGCAGGCACTGTGCTGAGG 0: 1
1: 8
2: 84
3: 339
4: 1216
961635493_961635503 25 Left 961635493 3:128330306-128330328 CCACATGGTAGAAAGCCAGATCA 0: 1
1: 0
2: 0
3: 10
4: 127
Right 961635503 3:128330354-128330376 ATGTGGCAGGCACTGTGCTGAGG 0: 1
1: 8
2: 84
3: 339
4: 1216
961635494_961635503 10 Left 961635494 3:128330321-128330343 CCAGATCATTCCCTTCCTCTCAG 0: 1
1: 0
2: 1
3: 29
4: 410
Right 961635503 3:128330354-128330376 ATGTGGCAGGCACTGTGCTGAGG 0: 1
1: 8
2: 84
3: 339
4: 1216
961635495_961635503 0 Left 961635495 3:128330331-128330353 CCCTTCCTCTCAGAGTGTGCCCC 0: 1
1: 0
2: 2
3: 26
4: 229
Right 961635503 3:128330354-128330376 ATGTGGCAGGCACTGTGCTGAGG 0: 1
1: 8
2: 84
3: 339
4: 1216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961635503 Original CRISPR ATGTGGCAGGCACTGTGCTG AGG Intronic
900183199 1:1321369-1321391 AAGTAGTGGGCACTGTGCTGTGG + Intronic
900351676 1:2238024-2238046 CTGTGCCAGGCGCTGGGCTGTGG + Intronic
900630900 1:3634635-3634657 TCGTGCCAGGCACTGTGCTCTGG - Intronic
900765616 1:4503183-4503205 ATGGGGCAGGGAGAGTGCTGGGG + Intergenic
900851022 1:5143142-5143164 AAGAGGCTGGCATTGTGCTGTGG - Intergenic
901096903 1:6688906-6688928 ATGTGCCTGGCACTGTGCAGGGG + Intronic
901154027 1:7123596-7123618 ATGTGGCAGTCCCTCTGCTTTGG + Intronic
901177821 1:7317472-7317494 CTGTGGCAAGCACTGTTCTATGG - Intronic
901233402 1:7653788-7653810 ATGTGCCAGGCATTGTTCTGAGG + Intronic
901405360 1:9041445-9041467 GTGTGCCAGGCTCTGTGCTTGGG - Intronic
901438040 1:9261523-9261545 CTGTGCCAGGCAATGTGCAGGGG - Intronic
901561785 1:10077534-10077556 ATGTGCTAAGCACGGTGCTGGGG - Intronic
901626296 1:10627113-10627135 ACGTGGCAGGCAGTGGGCAGTGG + Intronic
901648254 1:10728110-10728132 ATGTGGCAGGCATGGTGCCAAGG - Intronic
901737180 1:11320008-11320030 ATGGGGCAGGCACTCTGCTTGGG - Intergenic
901850540 1:12012149-12012171 CTGAGGCGGGCCCTGTGCTGGGG + Exonic
901909061 1:12439688-12439710 ATTTGCCAGGCACTGTTCTAAGG - Intronic
902115774 1:14119885-14119907 ATGTGCCAGGCACTGTTCTAAGG + Intergenic
902192980 1:14776583-14776605 ATGTGTCAGGCACTCTGCTAAGG + Intronic
902396786 1:16136252-16136274 ATGTGCCAGCCCCTGTGATGGGG - Intronic
902538733 1:17137277-17137299 ATGTGCCAGACACTGAGCTAAGG + Intergenic
902541433 1:17158355-17158377 ATGTGCCAGGCTCTGTGCTGGGG + Intergenic
902733698 1:18386197-18386219 ATGTGCCAGGCACTGTTCTAAGG - Intergenic
902995340 1:20220755-20220777 ATGGGCCAGGCACTCTGCCGGGG + Intergenic
903240023 1:21976550-21976572 ATGTATCAGGCACTGTTCTAGGG - Intergenic
903243771 1:22001186-22001208 ATGTATCAGGCACTGTTCTAGGG - Intergenic
903290638 1:22311942-22311964 GTGTGCCAGGCATGGTGCTGGGG - Intergenic
903290779 1:22312917-22312939 TGGTAGCAGGCACTGTGCTAGGG + Intergenic
903315741 1:22504381-22504403 GTGTGCCAGGCAGTGTGCTGAGG + Intronic
903325966 1:22568707-22568729 AAATGCCAGGCACCGTGCTGGGG + Intronic
903357803 1:22758814-22758836 AGGTACCAGGCTCTGTGCTGGGG - Intronic
903371771 1:22841057-22841079 ATGTGGTGGGCACCTTGCTGGGG - Intronic
903547579 1:24136269-24136291 ATGTGCCAGGCACTATGCTGAGG + Intronic
903582912 1:24385551-24385573 TTGTGCCATGCACTGTTCTGAGG + Intronic
903640761 1:24858446-24858468 ATGTGCCAAGCACTGTTCTAAGG - Intergenic
903649441 1:24913918-24913940 ATGTGCCGGGCACTGTGCAAGGG + Intronic
903794671 1:25919750-25919772 ATTTGTCAGGCACTGTTCTATGG - Intergenic
903834406 1:26193602-26193624 GCGTGCCAGGCACTGTGCTGGGG - Intronic
903862585 1:26373831-26373853 CTGTGTCTGGCACTGTGCTAGGG + Intronic
903885554 1:26539067-26539089 ATGTGGTAGGCGCTATGATGGGG + Intronic
903931989 1:26867633-26867655 ATGAGGCAGGCCCAGTCCTGAGG + Intergenic
903962663 1:27066507-27066529 ATGTGCCAGGCACCATGCTAAGG - Intergenic
903972269 1:27126697-27126719 ATGTGTCAGGCTCCGTGCTGAGG - Intronic
903989548 1:27256812-27256834 ATGTGCCAGGCATTGTGCTGAGG - Intronic
904042277 1:27591862-27591884 ATGTGTCAGGCACTGTGCCAAGG - Intronic
904052913 1:27651004-27651026 ATGTGCCAGGCCCTGTGCTAGGG + Intergenic
904288960 1:29471487-29471509 GGGTGCCTGGCACTGTGCTGGGG - Intergenic
904330467 1:29755077-29755099 GTGTACCAGGCACTGTGCTGTGG - Intergenic
904337120 1:29805190-29805212 ATGGGGCAGGCACTGGCATGGGG + Intergenic
904371102 1:30047872-30047894 GTGTGTCAGGCACTGTGAAGGGG - Intergenic
904386678 1:30147150-30147172 TTGTGGCAGGCACTGGACTAAGG + Intergenic
904416209 1:30362518-30362540 GTGTGCCAGGCACTGTGCTAAGG + Intergenic
904447948 1:30589701-30589723 ACGTGCCTGGCCCTGTGCTGTGG - Intergenic
904542274 1:31240887-31240909 ATGTGCCAGGTTCTCTGCTGGGG + Intergenic
904575470 1:31502513-31502535 ATGAGCCACACACTGTGCTGGGG - Intergenic
904717136 1:32476905-32476927 ATGTGTCAGGCTCTGTTCTAGGG - Intronic
904758636 1:32784864-32784886 ATGTGTTAGGCACTATGCTAGGG - Intronic
904822455 1:33255101-33255123 CTGTGCCAGGCACTGTGCTTGGG + Intergenic
904874752 1:33645674-33645696 ATGTGCCAGGCACTGTACCAAGG + Intronic
904906469 1:33900834-33900856 ATGTTTCAGGCACTGTACTAAGG - Intronic
905227084 1:36486079-36486101 GTGTGTCCGGCACTGTACTGAGG - Intergenic
905242144 1:36588262-36588284 GTGTGCCAGGCCCTGAGCTGGGG - Intergenic
905284951 1:36873185-36873207 GAGTGCCAGGCCCTGTGCTGGGG - Intronic
905474540 1:38216897-38216919 ATGTGACAGGCACTGTACTAGGG + Intergenic
905527512 1:38650067-38650089 TTATGCCAGGCACAGTGCTGGGG + Intergenic
905924134 1:41737919-41737941 ACTTGCCAGGCCCTGTGCTGGGG + Intronic
906013075 1:42547806-42547828 ATGTGTCAGGCACTGTAGGGAGG + Intronic
906071891 1:43022941-43022963 ATGTGCCAAGCCCTGTGATGGGG + Intergenic
906114948 1:43350201-43350223 TTTTGGCAGGCACTGTGCTAAGG - Intronic
906156285 1:43615913-43615935 ATGTGCCAGTCCCCGTGCTGGGG + Intronic
906480179 1:46194510-46194532 ATGGGGCAGGGCCTGGGCTGGGG - Intronic
906699250 1:47845877-47845899 ATGTGCCAGGCATTGTTCTAGGG - Intronic
906742879 1:48199446-48199468 ATGTGTCTGGCACTGTGCTGGGG + Intergenic
906804079 1:48762980-48763002 GTGTAGCAGGCACTGTTCGGTGG - Intronic
907354398 1:53860610-53860632 CTGTGCCAGGCCCTGTGCAGGGG - Intronic
907375806 1:54038486-54038508 AGGAGCCAGGCACTGTGCTAGGG - Intronic
907380380 1:54082465-54082487 CTGTGCTAGGCACTATGCTGGGG + Intronic
907381514 1:54094693-54094715 ATGTGCCAGGCTCTGTGCTTGGG - Intronic
907531435 1:55102004-55102026 ATCTGCCAGGCACTGTGCATGGG + Intronic
907576106 1:55527226-55527248 CTGTGCTAGGCACTGTGCAGAGG - Intergenic
907681036 1:56563827-56563849 ATGTGGCAGGCAGTGAGCTAGGG - Intronic
907707317 1:56844081-56844103 CTGTGCCAGGCAGTGTGCTGGGG + Intergenic
907708269 1:56851794-56851816 AGGTGGCAGGCACTGGGCTTGGG + Intergenic
907834388 1:58095165-58095187 GTGAGCCAGGCTCTGTGCTGGGG - Intronic
907906399 1:58785988-58786010 GTGAGCCAGGCACTGAGCTGGGG + Intergenic
907944940 1:59127320-59127342 CAGTGCCAGGCACTGTGCTATGG + Intergenic
907944984 1:59127735-59127757 GTTTGCCAGGCACTGTGCTATGG + Intergenic
908030278 1:59991894-59991916 ATGTGTCAGATACTGTGCTTGGG + Intronic
908281842 1:62547556-62547578 GTGTGCTAGGCACTATGCTGAGG - Intronic
908457790 1:64321116-64321138 ATGTGGGAGTCGCTGTGGTGAGG - Intergenic
908476609 1:64494773-64494795 ATGTGCCAGGCATTATGCTAAGG + Intronic
908766552 1:67559653-67559675 AGGTGGCAGGCACTGGGCTGAGG - Intergenic
908776811 1:67648645-67648667 CTGTGCCACGCCCTGTGCTGGGG + Intergenic
908784375 1:67720596-67720618 CTGTGCCAGGCACTGTGTTAAGG + Intronic
908809119 1:67960881-67960903 ATGAGGCAGCTGCTGTGCTGTGG + Intergenic
908833903 1:68209433-68209455 ATGTGCTAGGCATTGTGCTAGGG + Intronic
909598254 1:77431194-77431216 ATCTAGCAGGCAATGTGCTAAGG + Intronic
909725508 1:78829990-78830012 ATGCAGCAGGCAATGTTCTGGGG - Intergenic
910364666 1:86451858-86451880 ATGTGCCAGGCACTTTTCTAAGG - Intronic
910375884 1:86569853-86569875 ATGTGCCAGTCACCGTGCTGGGG - Intronic
910382951 1:86649534-86649556 ATGTTGCAAGCACTGTGCTTAGG + Intergenic
910443887 1:87281315-87281337 GTGTGGCAGGCACTGCGCTCAGG - Intergenic
910466394 1:87504836-87504858 ATGTGCCAGGTACTGTGCCAAGG - Intergenic
910601351 1:89035746-89035768 ATGTGTCAGGCACTGATTTGAGG - Intergenic
910687002 1:89927870-89927892 ACGTGGCAAGCACTGTACTAGGG - Intronic
910706086 1:90131169-90131191 TGGTGCCAGGCACTGTGCTAGGG - Intergenic
910867797 1:91804005-91804027 TTGTGCCAGATACTGTGCTGGGG - Intronic
910903858 1:92152322-92152344 ATGTGCTAGGCACTGTTCTAAGG - Intergenic
911056672 1:93714405-93714427 ATGTGCCAGGCAGTGTTCTAGGG - Intronic
911101106 1:94096440-94096462 AAGGGCCGGGCACTGTGCTGAGG - Intronic
911137993 1:94463364-94463386 ATGTGTCAGACACTGTGCTAAGG - Intronic
911406288 1:97444430-97444452 ATGTTTCAGGCACTGTGCTAAGG - Intronic
911499980 1:98673594-98673616 AGGTGTCAGGCACTGGGCTGGGG - Intronic
911546875 1:99227875-99227897 CTGTGGCTGGCACTCTGCAGAGG - Intergenic
912323527 1:108736889-108736911 ATGTGCCAGGCACTGTTCTAAGG + Intronic
912511886 1:110195325-110195347 ACGGGCCAGGCCCTGTGCTGGGG + Intronic
912700834 1:111877214-111877236 AAGTGCCAGGCACTGTGCCAGGG + Intronic
912858984 1:113196241-113196263 AAGTGCCAGGCTCTGTGCTAGGG - Intergenic
912962613 1:114209411-114209433 AGGTGCCAGTCACTGTGCTGAGG - Intergenic
913224373 1:116686062-116686084 GTGTGGCAGGCACCATGCTAAGG + Intergenic
913524907 1:119681673-119681695 AGCTGGAAGGCAGTGTGCTGGGG + Intronic
913558349 1:119992226-119992248 TTATGACAGGCACTATGCTGGGG + Intronic
913639492 1:120798225-120798247 TTATGACAGGCACTATGCTGGGG - Intergenic
914253540 1:145941835-145941857 TTGTGGCAGGGACTGTTCTAGGG - Intronic
914278955 1:146151711-146151733 TTATGACAGGCACTATGCTGGGG + Intronic
914332712 1:146687177-146687199 ATGTGCTAGGCACAGTGTTGGGG + Intergenic
914452033 1:147800944-147800966 ATGTGCCAGGCACTGTTCTTAGG - Intergenic
914506247 1:148291750-148291772 ATGTGCCAGGTACTGTGCTAAGG - Intergenic
914540003 1:148602653-148602675 TTATGACAGGCACTATGCTGGGG + Intronic
914626644 1:149468564-149468586 TTATGACAGGCACTATGCTGGGG - Intergenic
914830067 1:151164855-151164877 TTATGCCAGACACTGTGCTGAGG - Intronic
914913063 1:151802110-151802132 CTAGGCCAGGCACTGTGCTGAGG + Exonic
914920176 1:151841108-151841130 ATGCACCAGGCACTGTGCTAGGG + Intergenic
914941777 1:152029363-152029385 ATGTTCCAGACACTGTGCCGGGG - Intergenic
915141340 1:153770495-153770517 ATGAGCCAGGCTCTGGGCTGGGG + Intronic
915622819 1:157096372-157096394 ATTTGCCAGGCACTGTCCTAGGG - Intronic
915814398 1:158951283-158951305 ATGGGCCAGGCAGTGAGCTGTGG + Intronic
915928541 1:160042678-160042700 ATGTGCCAGGCACTGTGCAGGGG + Intronic
915948658 1:160172898-160172920 ATGTGCTAGGCATTGTGCTAGGG + Intronic
916004159 1:160644599-160644621 ATGTGGCAGCCACTGTGCAAGGG - Intronic
916180476 1:162078968-162078990 ATGTGCAAGGCACTGTACTCAGG - Intronic
916189654 1:162166771-162166793 ATGGGCCAGGCACGGTGCTAAGG - Intronic
916218223 1:162417191-162417213 ATGTGAGAGGCAGTGTGGTGTGG + Intergenic
916261532 1:162847148-162847170 CTGATGCAGGCACTGTGCTTGGG - Intronic
916498129 1:165363827-165363849 TTATGCAAGGCACTGTGCTGAGG - Intergenic
916518554 1:165543004-165543026 AGGTGCCAGGCACTGTGCTTAGG + Intergenic
916582329 1:166120148-166120170 CTGTGCCAGGTGCTGTGCTGGGG + Intronic
916691286 1:167192446-167192468 GTGGGCCAGGCACTATGCTGGGG - Intergenic
916722283 1:167493476-167493498 CTGTGCCAGGCCCTGTGCTGAGG + Intronic
916743202 1:167663862-167663884 ATGTGCCAGGCACTGTGCTGGGG + Intronic
916768274 1:167882951-167882973 ATGTGCCAGGCACTGTTCTCAGG - Intronic
916845295 1:168644227-168644249 ATGTATCAGGCACTGTGCCAGGG + Intergenic
916866169 1:168861381-168861403 ATGTGCCAGGCCCTGTACTAAGG + Intergenic
916932967 1:169598765-169598787 ATGTGTCAGGCCCTGTTCTCTGG - Intronic
916998658 1:170330477-170330499 TTGTGGGTGGCACTGTGCTATGG - Intergenic
917316840 1:173734780-173734802 ATGTTTCAGCCACTGTGCTTGGG + Intronic
917625016 1:176836894-176836916 ATGTGCCAGGCATTGTTATGGGG - Intronic
917667866 1:177242751-177242773 GTGTGGCAGACATGGTGCTGGGG - Intronic
917977409 1:180249206-180249228 AAGTGTCAGGCACTGTCCTGAGG - Intronic
918370969 1:183861150-183861172 ATATGCCAGGTACTGTGCTAAGG - Intronic
919709144 1:200708940-200708962 GTGGGCCAGTCACTGTGCTGAGG + Intergenic
919814607 1:201429623-201429645 AAGAGGCCGGCACCGTGCTGAGG - Intronic
920033843 1:203052986-203053008 TTGTGCCAGGCACAGTGCTAAGG + Intronic
920058574 1:203211954-203211976 ATGTGGCAGGAGCTGTGCTAGGG - Intergenic
920443600 1:205998712-205998734 GTTTGGTGGGCACTGTGCTGAGG + Intronic
920547621 1:206831614-206831636 ATGCGCCAGGTACTGTGCTGAGG + Intronic
920723600 1:208413020-208413042 ATGTGCCAGCCACTGTGTTTGGG - Intergenic
920744046 1:208608765-208608787 ATGTTGCAGTCTCTGTGCTGGGG + Intergenic
920849564 1:209619378-209619400 AAGTGCCAGGCACTGTGCTGGGG - Intronic
921345887 1:214184874-214184896 CTGCGTCAGGCACTGTTCTGGGG - Intergenic
921574185 1:216815237-216815259 ATGTGCCAGGCACCATGCTCAGG + Intronic
921618264 1:217297464-217297486 GTTTGCCAGGCACTGTGCTAGGG + Intergenic
921995649 1:221415021-221415043 ATGTGCCAGGCATTAGGCTGGGG - Intergenic
922092709 1:222412374-222412396 ATGTTTTAGGCACTGTGCTTGGG + Intergenic
922307699 1:224358254-224358276 ATGGGGCAGGCACTGTGCTAGGG - Intronic
922355903 1:224774758-224774780 ATGTGTCTGGTACTGGGCTGGGG - Intergenic
922570463 1:226631726-226631748 GTTTGACAGGCACTGTGCAGGGG + Exonic
922826889 1:228527803-228527825 CTGTGACTGGCTCTGTGCTGGGG - Intergenic
923491985 1:234492245-234492267 ATGCTCCAGGCACTGTACTGGGG + Intergenic
923497879 1:234540743-234540765 GAGTGCCAGGCACTGTGCTGGGG - Intergenic
923520780 1:234733490-234733512 ATGTACCAGGCTCTGTGGTGGGG - Intergenic
923695683 1:236248134-236248156 ATGTGCCAAGCACTGTTCTAGGG - Intronic
923840437 1:237665019-237665041 TTGTGTCAGGCACTTTGCTAAGG + Intronic
924185191 1:241481318-241481340 CTGTGGCAGGCACTGTGCTAGGG - Intergenic
924195796 1:241605547-241605569 ATGTGCCAGGCACTGTGCAGTGG + Intronic
924259445 1:242214490-242214512 ATGGGCCAGGCAGTGAGCTGTGG - Intronic
924300612 1:242633833-242633855 CTCTGTCAGGCACTGTGCTGAGG + Intergenic
924461853 1:244266729-244266751 GTGTGGCAGGCACTGCGCGAGGG - Intergenic
924588878 1:245384331-245384353 ATATGCCAGGCACTGTGCTGAGG + Intronic
924606001 1:245536006-245536028 GTGTTCCAGGCACTGTGCTTGGG + Intronic
924624498 1:245687823-245687845 CTGCCGCTGGCACTGTGCTGAGG - Exonic
924668072 1:246094264-246094286 ATGTGCCAGGTCCTGTGCCGGGG + Intronic
1063214635 10:3913071-3913093 AAGTGGTAGGCAGTGTGCTGAGG - Intergenic
1063369148 10:5509529-5509551 ATGTGCCAGGCGCTGTGCTGAGG + Intergenic
1063410701 10:5834447-5834469 ACGTGCCAGGGACTGTGCTCAGG + Intronic
1063411452 10:5839756-5839778 ACGTGCCAGGGACTGTGCTCAGG - Intronic
1064141984 10:12798322-12798344 ATGTGTCAGGCAGTGTGATGGGG + Intronic
1064162680 10:12959504-12959526 GTTAGCCAGGCACTGTGCTGAGG - Intronic
1065678437 10:28203906-28203928 ATGTGACAGGGACTGTTCTAAGG - Intronic
1065841751 10:29707761-29707783 ATATGCCAGGCACTGTGCTAAGG + Intronic
1065843636 10:29726798-29726820 GTTTGCCAGGCCCTGTGCTGAGG - Intronic
1065863887 10:29896447-29896469 ATGTGCTAGGCACTGTGTTGAGG + Intergenic
1065888415 10:30099506-30099528 ATGTTCCAGGCACTGTGCTAGGG + Intronic
1066268034 10:33795300-33795322 ATGTGTCAGACCCTGGGCTGGGG - Intergenic
1066483626 10:35822736-35822758 ATGTGTCAGATGCTGTGCTGGGG + Intergenic
1066527560 10:36297728-36297750 CTGCAGCAGGCACAGTGCTGGGG + Intergenic
1066584420 10:36916756-36916778 ATGTGCAAGACACTGTGCTAGGG + Intergenic
1066588486 10:36965130-36965152 ATGTTACAGTCACTGTGCTTGGG + Intergenic
1067055854 10:43049475-43049497 ATGTGGCTGGCAGTGGGCGGGGG - Intergenic
1067096410 10:43304002-43304024 ATGGGCCAGGCAGTGAGCTGTGG + Intergenic
1067519576 10:46987040-46987062 ATGTGGCAGTTACTATGCTAGGG - Intronic
1067536464 10:47114193-47114215 ATGTGGCAGGGGCAGAGCTGGGG + Intergenic
1067642671 10:48064799-48064821 ATGTGGCAGTTACTATGCTAGGG + Intergenic
1067724556 10:48760099-48760121 ATGGGTCAGGCACTGTGCCTTGG + Intronic
1067816012 10:49477369-49477391 ATGGGTGAGGCACTGTACTGGGG - Intronic
1068047336 10:51903979-51904001 ATTTGCCAGGCACTGAGCTAAGG - Intronic
1068934278 10:62621019-62621041 ACGTGCCTGGCACTGTGCTGGGG + Intronic
1068935945 10:62635949-62635971 GTGTTGCAGGCCCTGGGCTGAGG - Intronic
1069374933 10:67784132-67784154 ATGTGCCAGGCACTGCGGTAGGG - Intergenic
1069708898 10:70476748-70476770 ACGTGCCAGGCACTGTGCTGTGG + Intergenic
1069747324 10:70724056-70724078 GTGTGCCAGGCACTGTGCCAAGG - Intronic
1069819851 10:71220699-71220721 GTGTGCCGGGCACTGTGCTAAGG - Intronic
1070299739 10:75194551-75194573 ATGTGTCAGACACTGTGCTGGGG - Intergenic
1070676782 10:78417446-78417468 ATGTGGCAGGCCATGGTCTGTGG - Intergenic
1071051242 10:81451175-81451197 ATGGTGCAGACAGTGTGCTGGGG - Intergenic
1071503183 10:86217880-86217902 CTGAGGCAGGCTCTGTGGTGTGG - Intronic
1071685631 10:87752434-87752456 CTGTGCCAGGCACTATGCTGAGG + Exonic
1071768577 10:88698490-88698512 ATGGGCCAGGCACTGAGCTAAGG - Intergenic
1071780223 10:88836307-88836329 ATGTGCCAGGCACTATGTTATGG - Intronic
1072003975 10:91224397-91224419 GTGTGTCAGGCACTGTGCTGGGG + Intronic
1072213010 10:93264115-93264137 CTGTGTCAGGCATTGTGCTATGG - Intergenic
1072421425 10:95292791-95292813 CTATGCCAAGCACTGTGCTGGGG - Intergenic
1072531605 10:96324661-96324683 CTGTGTCAGACACAGTGCTGAGG - Intronic
1072581499 10:96744013-96744035 ATGATGCAGCCACAGTGCTGTGG - Intergenic
1072661007 10:97363512-97363534 GTGTGCCCAGCACTGTGCTGAGG - Intronic
1072668078 10:97408994-97409016 CTGTGCCAGGCACTGGGCTAAGG - Intronic
1072724295 10:97802018-97802040 ATGTGCCAGGCATTGTGCCAAGG + Intergenic
1072743251 10:97922848-97922870 GTGTGCCAGGCACTGAGCCGTGG - Intronic
1072962806 10:99944616-99944638 ATGTGCCAGGCACTGTGCTAAGG - Intronic
1073090063 10:100928801-100928823 ATGTGACAGGCACTGCACTAAGG - Intronic
1073489593 10:103844236-103844258 GGGTGCCAGGCACTGCGCTGAGG + Intronic
1073824979 10:107310427-107310449 ATGTACCAGGGACTGTGCTATGG + Intergenic
1073959091 10:108905275-108905297 ATGTGTCAGGCACTGTTCCAGGG - Intergenic
1074153234 10:110777114-110777136 AAGTGGGAGGCAGTGTGCTGAGG + Intronic
1074445572 10:113518635-113518657 CTGAGCCAGGCCCTGTGCTGAGG + Intergenic
1074577136 10:114680860-114680882 AGGTGGCAGGCACCATGCTAGGG - Intronic
1074692412 10:116018334-116018356 ATGTGCCCAGCACTGTGCTGTGG + Intergenic
1074703220 10:116110271-116110293 CTGTGCCAGGCACTGGGCTATGG + Intronic
1074987518 10:118670885-118670907 ATGTGCCAGCAACTGTGCAGAGG + Intergenic
1075478165 10:122754629-122754651 ATGTGGCAGGCACAGTGACTGGG - Intergenic
1075532528 10:123241867-123241889 GCGTGCCAGGCACTGTTCTGGGG + Intergenic
1075539775 10:123302397-123302419 TTGTGCCAGGCACTGTGCTAAGG - Intergenic
1075671384 10:124266004-124266026 ATGTTCTGGGCACTGTGCTGGGG - Intergenic
1076269522 10:129139215-129139237 AGGTGGCAGGGACTGTGCTCTGG + Intergenic
1076348357 10:129796373-129796395 ATGGGCCAGGCACTGTTCTGGGG + Intergenic
1076630149 10:131847457-131847479 GCGTGGCAGGCCCTGCGCTGTGG - Intergenic
1076738001 10:132467303-132467325 ATGTGTCACCCACTGAGCTGGGG + Intergenic
1076845557 10:133067922-133067944 CTGTGGCCAGCACAGTGCTGGGG - Intergenic
1077245402 11:1534602-1534624 GTGTACCAGGCTCTGTGCTGGGG - Intergenic
1077327705 11:1970881-1970903 ATGTCGCAGCCAGGGTGCTGCGG + Intronic
1077418082 11:2435127-2435149 ATGTGCCAGGCACTGTGTCAGGG + Intergenic
1077470077 11:2753524-2753546 AGGTGGCAGGTACTTTGCTCGGG - Intronic
1077605792 11:3610846-3610868 TTGTGCCAGGCTCTGTGCTAGGG + Intergenic
1077723982 11:4655091-4655113 ATGTTCTAGGCACTTTGCTGGGG - Exonic
1077800092 11:5528343-5528365 CTGTGGGAGGCACTTTTCTGAGG + Intronic
1078006264 11:7534797-7534819 CTCTGGCAGGCATTGTGCAGTGG + Intronic
1078421738 11:11218218-11218240 GTGGGGCAGACACTTTGCTGTGG + Intergenic
1078444700 11:11395419-11395441 ATGTAGCAGGGCCTGTGCTAGGG + Intronic
1078483959 11:11704931-11704953 CTGTGGCAGGCTGTGTGCTACGG - Intergenic
1078535595 11:12170890-12170912 CTGTGCCAAGCCCTGTGCTGGGG - Intronic
1078640574 11:13091893-13091915 ATGTGCCAAGAATTGTGCTGGGG + Intergenic
1078746540 11:14120771-14120793 GTGTGCCAGGAACTGTGCTAAGG + Intronic
1078773648 11:14374364-14374386 ATGTGCCAGGCACTGAGCCAGGG - Intergenic
1078901766 11:15649219-15649241 ATGTGCCAAGCACTGTGCCCTGG - Intergenic
1078937486 11:15964615-15964637 ATGTGCCAAGCACTGTGTTGGGG + Intergenic
1079025014 11:16940183-16940205 ATGTGCCAGCCACTGTGCTAGGG - Intronic
1079108873 11:17592331-17592353 ATAGGGCAGGCACTGTACTGGGG + Intronic
1079131635 11:17750185-17750207 ATGTGCCAGCCACGGTGCTGGGG - Intronic
1079138691 11:17793116-17793138 CTGTGTCAGGCATGGTGCTGGGG - Intronic
1079331275 11:19534996-19535018 ATGTCCCAGGCACTGTGCTAAGG - Intronic
1079390214 11:20015686-20015708 GTGTGCCAGGCATTGTGCTGGGG - Intronic
1079470050 11:20769537-20769559 CTGTGCCAGGCTCTGTACTGTGG - Intronic
1079621576 11:22562023-22562045 CTGTGCCAGGTACTGTGCTAAGG + Intergenic
1079670881 11:23169482-23169504 TTGGGCCAGGCACTGTTCTGAGG + Intergenic
1079743322 11:24092593-24092615 ATGTGCCTGGCACTGTTCTGTGG - Intergenic
1079774066 11:24501088-24501110 GTGTGGCAGACACTGTGCACAGG - Intronic
1080025484 11:27609615-27609637 CTGTGCCAGGCATTGTGCTCAGG + Intergenic
1080127605 11:28755475-28755497 GTGTACCAGGCACTGTGCTATGG - Intergenic
1080494229 11:32799962-32799984 ATGTGCCAAGCACTGCGCTGAGG - Intergenic
1080609386 11:33891076-33891098 TTGTGCCAGGTACTGTGCTTGGG - Intronic
1080638726 11:34145905-34145927 AGGGGGCAGGCATTGTGCTGGGG - Intronic
1080700224 11:34638383-34638405 AGGTACCAGGCACTCTGCTGTGG + Intronic
1080758926 11:35228992-35229014 GTGTGCCAAGCACTGTGCTAGGG - Intronic
1080791716 11:35527350-35527372 ATGTGGTAGGCTCTGTGCTATGG - Intronic
1081343122 11:41951651-41951673 ATGTGCCAGGCTCTGTTCTAAGG + Intergenic
1081721724 11:45294416-45294438 ATGTGCCAGGCACTGCTCTAGGG - Intergenic
1081737550 11:45414491-45414513 AAATGCCAGGCTCTGTGCTGAGG + Intergenic
1081753631 11:45529468-45529490 ATGCAGCAGGCTCTGGGCTGTGG - Intergenic
1081849693 11:46266378-46266400 GTGTGCCAGGCTCAGTGCTGAGG - Intergenic
1081871199 11:46383300-46383322 ATGGGGCAGCCATTGTGATGTGG - Intronic
1081979096 11:47255060-47255082 ATGTGGGAGGCAAGCTGCTGAGG - Intronic
1082004245 11:47410890-47410912 CTGTGCCAGGCACTGGGCTGAGG + Intronic
1082006275 11:47420853-47420875 ATGTGCCAGTCCCTGGGCTGGGG - Intronic
1082086572 11:48055211-48055233 ATGTGCCAGGCACCATGCTAGGG - Intronic
1082887923 11:58108004-58108026 ATGAGGCAGGCACTGTGTTTAGG + Intronic
1082928048 11:58571743-58571765 ACATGCCAGGCACTGTGCTCAGG + Intronic
1082961913 11:58926349-58926371 ATGGGCCAGGCAGTGAGCTGTGG + Intronic
1083148063 11:60773287-60773309 CTGTGGGAGGCAGCGTGCTGGGG + Intronic
1083149229 11:60781454-60781476 ATGGGGCAGGCTCAGAGCTGGGG - Intergenic
1083244141 11:61412734-61412756 GTGTGCCTGGCACTGTGCTAAGG - Intronic
1083299017 11:61730583-61730605 AGCTGGCAGACACTTTGCTGGGG + Intronic
1083627009 11:64077088-64077110 AGGTGGAGGGCACTGGGCTGAGG - Intronic
1084373925 11:68763484-68763506 ATCTGGGAGAGACTGTGCTGGGG + Intronic
1084442325 11:69181750-69181772 TTGGGGCAGGCACTCTGCTTCGG - Intergenic
1084445535 11:69201515-69201537 TTGTGCCAGGCACTTTGCTGGGG + Intergenic
1084551810 11:69848205-69848227 ATGTGCCAGGCTCTGTGCCAGGG + Intergenic
1084592180 11:70097206-70097228 ATGGGGCAGGGACTGGGCTGTGG - Intronic
1084686491 11:70698867-70698889 ATGTGAGATGCACTGTCCTGGGG + Intronic
1084726205 11:70943824-70943846 ATGTGGTTGGCCCTGTGGTGAGG - Intronic
1085029777 11:73264137-73264159 ATGTGCCAAGCACTGTGCTAAGG - Intergenic
1085043273 11:73339234-73339256 AGATGCCAAGCACTGTGCTGGGG - Intronic
1085063755 11:73473089-73473111 ATGTGACAGGTACTGTGCTAAGG + Intronic
1085295077 11:75426911-75426933 GTGTGCCAGGCTCTGTGCTCAGG + Intronic
1085432156 11:76462410-76462432 ATGTGCAAGGCACTATACTGGGG + Intronic
1085447702 11:76611600-76611622 ATGTGCCAGGCACTGATCTAGGG - Intergenic
1085450404 11:76628802-76628824 GTGTGTCAGGCCCTGGGCTGAGG + Intergenic
1085816148 11:79739340-79739362 ATGTGCCAGACCCTGTGCTGGGG - Intergenic
1085847145 11:80078787-80078809 ATGTGCCAGGCACTCCACTGTGG - Intergenic
1085874536 11:80390075-80390097 CTGTGACAGACACTTTGCTGAGG + Intergenic
1085903541 11:80731528-80731550 ATGTGCAAGGCACTGTCCTAGGG - Intergenic
1086072039 11:82810556-82810578 CTGTGGCAGGCACTGTGTTATGG - Intergenic
1086131496 11:83406733-83406755 ATGTGTCAGGCATTGTACTAGGG + Intergenic
1086252001 11:84827030-84827052 ATATAGCTGGCACTGTGGTGTGG + Intronic
1086464171 11:87036929-87036951 ATTTACCAGGCACTGTGCTAAGG - Intergenic
1086890769 11:92255429-92255451 CTGTGGCAAGGACTGTGCTAGGG - Intergenic
1086900060 11:92357192-92357214 ATGTGCCAGACACTGTACAGAGG + Intronic
1086961810 11:92985600-92985622 ATATGCCAGGCACTGTTCTAAGG + Intergenic
1086971787 11:93089371-93089393 ATGTGGCAGGGACTGCATTGAGG + Intergenic
1086998600 11:93389561-93389583 ATGTGCCAGGAACTGTTCTAAGG + Intronic
1087040052 11:93790115-93790137 ATGTGCCAGGCATTGTTCTAGGG + Intronic
1087834679 11:102861281-102861303 ATGTGCCAGGCACTGTTCCAAGG - Intergenic
1087958410 11:104318538-104318560 AAGTGCCGGGCACTGTGCTAAGG + Intergenic
1088432799 11:109777326-109777348 ATGTGTCATGCCCTCTGCTGTGG + Intergenic
1088488523 11:110364870-110364892 ATGTGTCAGGTAATGTGCTAAGG - Intergenic
1088824604 11:113483233-113483255 CTGTGTCAGGTTCTGTGCTGGGG - Intergenic
1088882774 11:113984510-113984532 CTGTGCCAGGCCCTGTGCTGGGG - Intronic
1088907471 11:114165478-114165500 ATGTACCAGGCACTTTGCTAGGG - Intronic
1089049447 11:115533740-115533762 GTGTGTCAGGCACTGTGCCAGGG + Intergenic
1089062653 11:115638499-115638521 ATGTGTCAACCACTGTGCTTGGG - Intergenic
1089180007 11:116577009-116577031 ATGTGTCAGGTACTGCACTGAGG + Intergenic
1089181585 11:116586984-116587006 ATGTGCCAGGAACTGTGCTAAGG - Intergenic
1089344582 11:117782757-117782779 ATGTGCCAGGCACTGTTGTTAGG + Intronic
1089582689 11:119491290-119491312 ATGTTCCAGGCACTGTGCTGAGG + Intergenic
1089654325 11:119935836-119935858 AAGTGCCAGGTGCTGTGCTGGGG + Intergenic
1089701689 11:120248435-120248457 ATGTGCCAAGCACTGTGCTAAGG - Intronic
1089787320 11:120917367-120917389 ATGTGCCAGTCACTGTGCTGGGG + Intronic
1089921399 11:122212956-122212978 AGGTGCCAGGCATTGTGCTGAGG - Intergenic
1090347156 11:126080659-126080681 ACATAGCAGGCACTTTGCTGAGG + Intergenic
1090410883 11:126508853-126508875 CTATGACAGGCACTGTGCTGAGG - Intronic
1090472598 11:126993650-126993672 ATGCAGTAGGCACTGTGCTGGGG - Intronic
1090741929 11:129670055-129670077 ATGTGTCAGGCATTGTTATGAGG + Intergenic
1090992742 11:131834428-131834450 ATGTGGTAGGCACTGTGCTGGGG + Intronic
1091191735 11:133701350-133701372 ATGTGCCTGGTATTGTGCTGAGG + Intergenic
1091195469 11:133727172-133727194 ATATATCAGGCCCTGTGCTGAGG - Intergenic
1202810687 11_KI270721v1_random:26061-26083 ATGTCGCAGCCAGGGTGCTGCGG + Intergenic
1091688644 12:2581168-2581190 ATGTGCCAGGCACTCTACAGGGG + Intronic
1091690365 12:2592294-2592316 ATGTGCCAGGCACCGTTCTGAGG + Intronic
1091782996 12:3225613-3225635 ATGAGTCAGGCACTGTGCAGGGG - Intronic
1091878529 12:3957704-3957726 ATGTGCCAGGGATTGTGCTAAGG - Intergenic
1092033186 12:5306997-5307019 ATGAGCCAGGCACTGTTCTAAGG - Intergenic
1092078070 12:5689801-5689823 ATGTGCCAGACACTTGGCTGGGG - Intronic
1092078147 12:5690497-5690519 AGGAGGCATTCACTGTGCTGAGG - Intronic
1092119404 12:6033653-6033675 GAGAGGCAGGCAGTGTGCTGGGG - Intronic
1092289751 12:7152681-7152703 ATGTGCCAGGCACTGTGCTCGGG + Intronic
1092446321 12:8560755-8560777 ATGGGCCAGGCAGTGAGCTGTGG + Intergenic
1092734127 12:11563707-11563729 ATGTAGCAGGCGCTGTACTTTGG + Intergenic
1092804638 12:12208614-12208636 ATGTGCCAGTCATTGTGATGTGG - Intronic
1093348155 12:18065850-18065872 ATGTGCCAGACACTGTGCTAAGG + Intergenic
1093685621 12:22050380-22050402 ATGTGCCAGGCACTATTCTAAGG - Intronic
1093823669 12:23653905-23653927 GTGTGTCAGGCATTGTGCTAGGG - Intronic
1094033650 12:26043081-26043103 CTGTGCCAGCCACTATGCTGAGG + Intronic
1094142094 12:27191902-27191924 ATGTGCCAAGTATTGTGCTGGGG + Intergenic
1094639595 12:32261199-32261221 ATGTGCCAGACCCTGTGCTAGGG + Intronic
1095055333 12:37591521-37591543 AGGTGGCAGGCACTGTTCCTGGG - Intergenic
1095127096 12:38492683-38492705 ATGTGCCAGGCACTGTTATAAGG + Intergenic
1095495865 12:42783051-42783073 ATGTGTCAAGCACTATTCTGGGG - Intergenic
1095886378 12:47192754-47192776 GTGTAACAGGCACTGTGCTGAGG + Intronic
1096240962 12:49960195-49960217 CTGTGCCAGGCACTGTGCTAAGG + Intergenic
1096256442 12:50064887-50064909 ATGTGCCAGGTCCTGCGCTGGGG + Intronic
1096408969 12:51363795-51363817 ATGTGCCAGGCACTGAACTAAGG - Intronic
1096513143 12:52142953-52142975 ATGTGCTAGGCACTTTGCTAAGG - Intergenic
1096534027 12:52259364-52259386 ATGTGCCTAGTACTGTGCTGAGG + Intronic
1096638720 12:52977392-52977414 GTGTGTCAGACACAGTGCTGGGG + Intergenic
1096639425 12:52982312-52982334 GTGTGGCAGGTACTGTGCTAAGG + Intergenic
1096684569 12:53279494-53279516 ATGTGCCAGGCACTGTGCCCAGG - Intronic
1096707487 12:53431387-53431409 AAGTGGCAGGCACTCCGCTGAGG - Exonic
1096765441 12:53884902-53884924 ATGTGCCATGCATTGTGCTAAGG - Intergenic
1096995564 12:55835879-55835901 CTGAGGCAGGCACTGCCCTGTGG - Intronic
1096997628 12:55848732-55848754 ATGCAACAGGCGCTGTGCTGGGG - Intergenic
1097000925 12:55875891-55875913 ATGTAGCAGGCCCAGTTCTGAGG + Intergenic
1097181155 12:57172803-57172825 GTGTGCCAGGCGCTGTCCTGGGG - Intronic
1097400478 12:59122474-59122496 ATGTGCAAGGCACTGTGCCCAGG - Intergenic
1097457667 12:59820072-59820094 ATGTGTCAGTCACTATTCTGAGG + Intergenic
1097636639 12:62130625-62130647 ATGTGGCAGGCACTGTGCTAGGG + Intronic
1097696238 12:62777408-62777430 ATCTGCTGGGCACTGTGCTGGGG - Intronic
1098143949 12:67479664-67479686 ATGTGCCAGGCAATGTTTTGAGG + Intergenic
1098324544 12:69287996-69288018 AGATGTCAGGCACTGTGCTAGGG + Intergenic
1098378385 12:69842116-69842138 ATGGGCCAGGCACAGTGCTAAGG - Intronic
1098551280 12:71764031-71764053 ATGTGCCAAGCACTGTGCTTGGG - Intronic
1098595244 12:72266642-72266664 CAGTGCCAGGCACTGTGCTAGGG - Intronic
1098890552 12:76006196-76006218 AAGTTGCAGCCACTGTGCTTGGG + Intergenic
1099346177 12:81502643-81502665 ATGTGCTAGGAACTGTGCTAGGG + Intronic
1099705246 12:86143984-86144006 ATGTGCTAGGCACTGTGCTAGGG - Intronic
1100233122 12:92630409-92630431 ATATGCCAGGCACTGAGCTATGG + Intergenic
1100343622 12:93705172-93705194 ATGGGACAGGCACTGTCCTGGGG - Intronic
1100347785 12:93749041-93749063 ATCTGCCAGGCACTATTCTGGGG + Intronic
1100461745 12:94806620-94806642 GTGTGCCAAGCACTGTGCTAAGG - Intergenic
1100555354 12:95687811-95687833 ATGTACCAGACACTGTTCTGGGG - Intronic
1100596038 12:96072954-96072976 ATGTGCCAGGCACTGTTCTTGGG - Intergenic
1100656933 12:96656887-96656909 ATGTGCTGGGCACTGTGCTGAGG + Intronic
1100888043 12:99094128-99094150 ATGTGCCAGGCACTGGGCTGTGG + Intronic
1101045731 12:100803809-100803831 ATCTTGCAGGCACTGTGCTAAGG - Intronic
1101114823 12:101521821-101521843 ATGTGCCAGGAACTCTGCTAAGG + Intergenic
1101143683 12:101821317-101821339 ATGAGGCAGGCACTCTGCCAGGG + Intronic
1101234165 12:102771461-102771483 ATGTGCCAGACTCTGTGCTAAGG + Intergenic
1101332274 12:103766659-103766681 CTGTGTCAGGCACTGGGCTAGGG - Exonic
1101366779 12:104079243-104079265 ATGTACCAGGCACTCTTCTGGGG - Intronic
1101403400 12:104407552-104407574 GTGAGGCAGGCACTGTTCTAGGG - Intergenic
1101519820 12:105471225-105471247 ATGTCCCAGGCACAGTTCTGGGG + Intergenic
1101836802 12:108301538-108301560 ATGTGCCAGGCACTGAGCTGGGG - Intronic
1101845228 12:108358177-108358199 ATGTGCCAGGCACTGGGCTGGGG + Intergenic
1101886262 12:108665715-108665737 GTGTGTCTGGCTCTGTGCTGAGG - Intronic
1102090827 12:110185876-110185898 AGGTGTGAGCCACTGTGCTGGGG + Intronic
1102131269 12:110530677-110530699 ATGAGCCAGTCACTGGGCTGGGG - Intronic
1102221386 12:111197238-111197260 AAGTGGTAGGCACTGAGCTAGGG - Intronic
1102307110 12:111813420-111813442 ATTTGGCAGGCAGTGTAATGAGG + Intergenic
1102499120 12:113339099-113339121 AAGTGCCAGGCACTATGCTATGG - Intronic
1102522642 12:113488284-113488306 ATGTGCTAGGCACTCTGCTAGGG + Intergenic
1102689039 12:114746171-114746193 ATGTGCCAGGCACCATGCTAGGG + Intergenic
1102762582 12:115401354-115401376 CTCTGGCAGGCACTGTGCTGGGG - Intergenic
1102859753 12:116325559-116325581 GTGTGCCAGGCCCTGTGCTAAGG + Intergenic
1103137410 12:118519491-118519513 ATGTGCCAGGCACTGGGTAGGGG - Intergenic
1103444424 12:120984891-120984913 GTGAGCCAGGCACCGTGCTGAGG - Intronic
1103504528 12:121432944-121432966 ATCTGGCTGGCACACTGCTGTGG + Intronic
1103673828 12:122640315-122640337 ATGTGCCAGGAACTGTTCTGGGG + Intergenic
1103853182 12:123946621-123946643 GGGTGCCAGGCACTGTGCTAGGG - Intronic
1103885149 12:124194923-124194945 ATGTGCCAGGCACTGTTTTAGGG - Intronic
1104150333 12:126075838-126075860 ATGTTCCAGGCACTGTGAAGAGG - Intergenic
1104358712 12:128112140-128112162 CTGGGGCAGGCACTGCCCTGGGG - Intergenic
1104748731 12:131225056-131225078 ATGTGTCACACACTGTGCAGTGG - Intergenic
1104784393 12:131440508-131440530 ATGTGTCACACACTGTGCAGTGG + Intergenic
1105356307 13:19663192-19663214 CACTGCCAGGCACTGTGCTGGGG + Intronic
1105435955 13:20378518-20378540 TTGCGCCAGGCAGTGTGCTGGGG - Intergenic
1105719532 13:23100315-23100337 ATGTGGCAGGCACACAGCTATGG - Intergenic
1105830996 13:24162649-24162671 GTGTGCCAAGCACTGTTCTGAGG + Intronic
1105849715 13:24323182-24323204 TCTTGGCAGGCACTGTGGTGGGG - Intergenic
1105871702 13:24511368-24511390 ATGTGGCGGACACTGGGCTAGGG + Intronic
1105891354 13:24684743-24684765 AAGTGGCAGCCACAATGCTGTGG + Intronic
1106322555 13:28655767-28655789 GTATGCAAGGCACTGTGCTGTGG + Intergenic
1106569509 13:30914428-30914450 AACTGGCATGCACTGTGATGAGG + Intronic
1106593910 13:31121088-31121110 ATGTGGTTGGCACAGAGCTGGGG + Intergenic
1106805483 13:33302338-33302360 ATGTGTCAGGCACTATTCTAAGG + Intronic
1107027741 13:35820984-35821006 ATGTGTCAGGTACTGTGCCAGGG - Intronic
1107070629 13:36264787-36264809 ATGTGTCAGGCATTGTGCTAGGG + Intronic
1107236377 13:38175745-38175767 ATTTGGCAGGCAGTGGGCTAGGG + Intergenic
1107243405 13:38264727-38264749 TTCAGGCAGGCACTGAGCTGCGG + Intergenic
1107484585 13:40813662-40813684 ATCAGGCAGGAGCTGTGCTGGGG - Intergenic
1107635570 13:42388973-42388995 ATGTGCCAGGCACTGACCTAGGG - Intergenic
1108072234 13:46640270-46640292 CTGTGGCAGGCACTGCTCTAAGG + Intronic
1108604202 13:52020969-52020991 ATGTGTCAGGCACTGTTCTGGGG + Intronic
1109224582 13:59677094-59677116 ATGAGGTGGGCACTGTGCTAGGG - Intronic
1109689032 13:65861951-65861973 ATGAGGGTTGCACTGTGCTGGGG + Intergenic
1109715819 13:66220493-66220515 ATGTGCCAAGCAATGTGCTAAGG + Intergenic
1110155520 13:72312171-72312193 ATATGCCAGGCACTATGCTATGG + Intergenic
1111243848 13:85509054-85509076 ATGTGCCTGGCAGTGTGCAGTGG + Intergenic
1111341456 13:86891548-86891570 ATGTGGTAGGCACTGTTCTGAGG - Intergenic
1111896429 13:94147957-94147979 CTGTGGCAGGGATTCTGCTGAGG + Intronic
1112433943 13:99377157-99377179 GTGTGTCAGGCTCTGTGTTGGGG + Intronic
1113415588 13:110126054-110126076 CCGTCTCAGGCACTGTGCTGGGG + Intergenic
1113435048 13:110284876-110284898 AAGTGCCAGACAATGTGCTGTGG + Intronic
1113476931 13:110590612-110590634 ACCTGCCAGGCATTGTGCTGAGG - Intergenic
1113490670 13:110689268-110689290 AGGTGGCAGGTGCTGTGCTTGGG - Intronic
1113555209 13:111228476-111228498 ATGAGGCAGGCTCGATGCTGAGG + Intronic
1113916381 13:113876407-113876429 ATGTGGGTGTCACTGTGGTGTGG + Intergenic
1114240153 14:20859549-20859571 ATGGGACAGGCACTTTGCTTAGG + Intergenic
1114267437 14:21081259-21081281 GAGTGGCAGGCTCTGTGCTAAGG - Intronic
1114431968 14:22669576-22669598 ATGTGGTAGGCACTGTACAAGGG - Intergenic
1114474765 14:22986376-22986398 AGGTGTCAGGTACTGTGCTATGG - Exonic
1115143135 14:30197022-30197044 ATGTGTCAAGCCCTGTTCTGAGG - Intergenic
1115161682 14:30403530-30403552 ATGTGGCAGGCATTGCTCTAAGG - Intergenic
1115330446 14:32190984-32191006 GTGTAGTAGGCACTGTGTTGGGG + Intergenic
1116393210 14:44417929-44417951 AAGTGCCAGGCAGTGAGCTGTGG - Intergenic
1117717748 14:58598204-58598226 CTGTTCCAAGCACTGTGCTGAGG - Intergenic
1117867151 14:60161812-60161834 ATGTGCCGGCCTCTGTGCTGGGG - Intronic
1117980269 14:61336007-61336029 GTGAGGCAGGTACTGTGTTGTGG - Intronic
1118013282 14:61632019-61632041 ATGTGTTGGGCACTGGGCTGAGG + Intronic
1118055556 14:62076127-62076149 ATATGCCAGGCACTGTGATAAGG + Intronic
1118060406 14:62131801-62131823 ATGAGCCAGGCACTGTGCTAGGG + Intergenic
1118368736 14:65117832-65117854 AGGTCGCAGCCACTATGCTGTGG - Intergenic
1118608789 14:67523427-67523449 ATGTGCCATGCACTGTGCTAAGG + Intronic
1118744250 14:68762552-68762574 ATGTGCCAGGTCCTGTGCTAGGG - Intergenic
1119234608 14:73009052-73009074 TTGCGTCAGGCACTGTGCTAAGG - Intronic
1119433612 14:74584079-74584101 ATGGGCCAGGCACTATGCAGGGG + Intronic
1119497612 14:75093910-75093932 ATTTGCCAGGCACTGTTCTAGGG + Intronic
1119520266 14:75279681-75279703 AAGAGACAGGCACTGCGCTGCGG + Intronic
1119537439 14:75413934-75413956 GTGTGCCAGGCACTGTGTGGGGG + Intergenic
1119552384 14:75524326-75524348 ATGTGCCAGGCATTGTGCTGGGG + Intronic
1119616041 14:76099700-76099722 ATGTGCCAGGCGCTGTGCTGAGG + Intergenic
1119624098 14:76155999-76156021 ATGGGCCAGGCACTGTACTATGG + Intronic
1119877544 14:78073736-78073758 ATGTGCCAGGCCAAGTGCTGGGG + Intergenic
1119980636 14:79076895-79076917 ATGCACCAGGCAATGTGCTGGGG - Intronic
1120048904 14:79842132-79842154 ATGTGCCTGGCGCTGTTCTGTGG + Intronic
1120063769 14:80015687-80015709 ATGTGCCAGACACTCTGCTAAGG - Intergenic
1120182787 14:81362837-81362859 ATGTGCCAGGCAACATGCTGGGG + Intronic
1120281706 14:82447066-82447088 ATGTGCCAGGCAATATGCTCAGG + Intergenic
1120637640 14:86971606-86971628 ATCTTGCAAGCACTGTTCTGTGG + Intergenic
1120848656 14:89148858-89148880 AAGTGGCAGGCACCGTACTGGGG + Intronic
1121246532 14:92464975-92464997 AGATGTCAGGCACGGTGCTGGGG - Intronic
1121351847 14:93179759-93179781 ATATGTGAGGCACTGAGCTGAGG - Intergenic
1121420020 14:93806646-93806668 ATGTGGTAGGCACTTTTGTGGGG + Intergenic
1121425915 14:93851967-93851989 GTGTGTCAAGCACTGTGCTAGGG - Intergenic
1121521908 14:94591881-94591903 CTGCCCCAGGCACTGTGCTGGGG - Intronic
1121608936 14:95262476-95262498 GTCAGGCAGGCACTGTGCTTAGG + Intronic
1121693911 14:95897124-95897146 TTGTGCCAGGCACTGTTCTGGGG + Intergenic
1121758748 14:96425208-96425230 ATGGCCCAGGCACTGTGATGAGG + Intronic
1121805801 14:96821205-96821227 ATGTGCCAGGAACTGTGCTAGGG - Intronic
1122295671 14:100704412-100704434 TTGCGCCAGGCACTGTGCTGTGG - Intergenic
1123031907 14:105455943-105455965 GTGGGGAAGTCACTGTGCTGAGG + Intronic
1123977056 15:25563587-25563609 GTGTGGAGGGCACTGTGATGTGG + Intergenic
1124504877 15:30264083-30264105 CAGTGCCAGGCCCTGTGCTGAGG + Intergenic
1124578374 15:30928930-30928952 GTGTCGCAGGCACTGTGCCAAGG + Intronic
1124619048 15:31263871-31263893 ATGTGGCTGGCACACAGCTGAGG - Intergenic
1124636448 15:31367759-31367781 ACGTGCCAGGCGCTGTGCTGAGG + Intronic
1124738675 15:32274552-32274574 CAGTGCCAGGCCCTGTGCTGAGG - Intergenic
1124988586 15:34648095-34648117 ATGTGCCAGGCACTGTGTTAGGG - Intergenic
1125183303 15:36902122-36902144 ATGTGCCAGGCATTGTGCTAAGG - Intronic
1125252540 15:37721947-37721969 ATTTGCCAGGCACAGTGCTGAGG - Intergenic
1125328583 15:38561923-38561945 CTATGGCAGGTACCGTGCTGGGG + Intronic
1125754025 15:42050092-42050114 ATGTGACAGGCACTCTGCCAGGG + Intronic
1125786998 15:42327964-42327986 GTGTGCCAAGCACTGTGCTAAGG + Intronic
1126070334 15:44860370-44860392 ATGTGCCAGGCACTGGGCTGAGG - Intergenic
1126087701 15:45024747-45024769 ATGTGCCAGGCACTGGGCTGAGG + Intronic
1126135197 15:45383076-45383098 CTGTGTCAGGCACTGTGCTAGGG - Intronic
1126376878 15:48005876-48005898 GTGTGCCAGGCACTGTGCTAGGG - Intergenic
1126691208 15:51290164-51290186 ATATGCCAGGCACTGTGCAAAGG - Intronic
1126800147 15:52290926-52290948 ATGTGTCAGGTGCTGTGCTAAGG + Intronic
1126865452 15:52932318-52932340 AAATGCCAGGCACTTTGCTGGGG + Intergenic
1127238669 15:57086103-57086125 ATGTGGCAGGCATCATTCTGAGG + Intronic
1127242290 15:57129711-57129733 AAGTGTTAGGCCCTGTGCTGGGG - Intronic
1127568560 15:60217367-60217389 ATGTGCCAGGCACTTTGCTAAGG - Intergenic
1127744699 15:61955197-61955219 GTGTGGCAGACACTGTTCTAAGG + Intronic
1128090115 15:64913439-64913461 ATGTGCCAGACACTGTGCCAGGG + Intronic
1128136873 15:65270280-65270302 TTGTGCCAGAAACTGTGCTGGGG + Intronic
1128183681 15:65626122-65626144 CTCTGCCAGGCACTGTGCTGGGG + Intronic
1128358143 15:66942846-66942868 ATGCGCCTGGCACTGTGCTGGGG + Intergenic
1128718866 15:69930906-69930928 ATCTGACAGGCCCTGTTCTGAGG - Intergenic
1129276323 15:74448091-74448113 ACCAGGCAGGCACTGAGCTGGGG - Intronic
1129412232 15:75356357-75356379 AGGTGGCGGGCGCTGGGCTGGGG + Exonic
1129468754 15:75738661-75738683 GAGTGGCTGGCACTGGGCTGGGG - Intergenic
1129542582 15:76363033-76363055 CTGTGGCAGGCACAGTGCTGGGG - Intronic
1129705171 15:77790280-77790302 ATGTGCCAAGCAGTGTTCTGGGG - Intronic
1129745365 15:78015757-78015779 ATGTGCCAGGAGCTGTGCTAAGG - Intronic
1129801615 15:78419068-78419090 ATGTGGCATGCTCTGAGCTATGG + Intergenic
1130233469 15:82113939-82113961 GTGTGCCGGGCACTGTGCTAAGG - Intergenic
1130275178 15:82472664-82472686 GTGTGGCCGGCACTGCGCTGGGG + Intergenic
1130467537 15:84200059-84200081 GTGTGGCCGGCACTGCGCTGGGG + Intergenic
1130496728 15:84473483-84473505 GTGTGGCCGGCACTGCGCTGGGG - Intergenic
1130516267 15:84628284-84628306 ATGCGCCAGGCACTGTGCTAAGG + Intergenic
1130526823 15:84714386-84714408 ATGTGCCAGACACTCTTCTGAGG + Intronic
1130589829 15:85204657-85204679 GTGTGGCCGGCACTGCGCTGGGG + Intergenic
1130866966 15:87941539-87941561 ATGAACCAGGCACTGTGATGGGG - Intronic
1130925060 15:88379160-88379182 ACTTGCCAGGCACTGTGCTATGG - Intergenic
1130938823 15:88491203-88491225 GCATGGCAGTCACTGTGCTGGGG + Intergenic
1131090183 15:89618618-89618640 ATGTGCCAGGCACTGTGTGTTGG - Intronic
1131090752 15:89623174-89623196 ATGTGCCAGGCACTGTGTGTTGG - Intronic
1131122586 15:89831790-89831812 ATGTGGCAGGCACAGGGCCATGG + Exonic
1131224000 15:90608701-90608723 CTGTGCCGGGCACTGTGCTAGGG - Intronic
1131338093 15:91569988-91570010 ACGTGGCGGGCACTTTGCTGAGG - Intergenic
1131794501 15:96001051-96001073 CTGTGCCAGGCACTGTGCTGGGG + Intergenic
1132104404 15:99052300-99052322 AGGTGCCAGGCAGGGTGCTGGGG - Intergenic
1132176147 15:99716760-99716782 CTGTTGCATGCACAGTGCTGTGG + Intronic
1132302503 15:100784660-100784682 TTCTGGCAGGCACTGTGCACAGG + Intergenic
1132551517 16:555695-555717 ACCTGGCAGGGTCTGTGCTGTGG - Intergenic
1132634635 16:937618-937640 AAGGGGCAGGGCCTGTGCTGGGG - Intronic
1132729324 16:1353304-1353326 ATGTGTTAGGGTCTGTGCTGGGG + Intronic
1132761728 16:1511801-1511823 ATGTGCCAGGCGCTGTGCTGGGG + Intronic
1132888279 16:2192002-2192024 ATGAGTCAGGCTCTGTGCCGTGG + Intronic
1133206861 16:4239247-4239269 ACATGGCGGGCACTGAGCTGTGG + Intronic
1133273501 16:4623274-4623296 ATGTGCCAGGCATCATGCTGAGG - Intronic
1133386671 16:5375664-5375686 ATGTGCCAGGCACTGTGCCAGGG + Intergenic
1133579055 16:7125352-7125374 ATTTGCCTGGCACTCTGCTGAGG - Intronic
1133587204 16:7207488-7207510 ATGTAGCAGGCACTGTGCTAGGG - Intronic
1133715976 16:8449069-8449091 TTGTGCCAGGCACTGGACTGGGG + Intergenic
1133804440 16:9114003-9114025 AAGTGCCAGGCACTGTGCTTAGG + Intronic
1133898477 16:9951126-9951148 ATGGAGGAAGCACTGTGCTGGGG - Intronic
1134133059 16:11662783-11662805 ATGTTCCAAGCACTGTGCTAGGG - Intergenic
1134760584 16:16710884-16710906 ATGTGCCAGGAACTGTTCTAAGG + Intergenic
1134799761 16:17072787-17072809 ATGTCCCAGGCACTGCACTGGGG + Intergenic
1134907421 16:17992486-17992508 TTGTGCCAGGCACTGTGCTCAGG - Intergenic
1134985475 16:18648289-18648311 ATGTGCCAGGAACTGTTCTAAGG - Intergenic
1135119208 16:19750966-19750988 CTGTGGCAGGTACGGTGATGAGG + Intronic
1135156104 16:20054097-20054119 GTGTGTCAGGTACTGTGCTAGGG - Intronic
1135195025 16:20387115-20387137 ATGTGCCAGGCACTGTCCTAGGG + Intronic
1135407991 16:22211867-22211889 GTGTGCCAGGCATTGTGCTTTGG + Intronic
1135799250 16:25477302-25477324 ATGTCCCAGGCACTGTCCTAGGG - Intergenic
1135950737 16:26911764-26911786 ATGTGTTAGGCACTGTGTTTGGG - Intergenic
1136008921 16:27349693-27349715 ATGTGCCAGGCACATTGCTCAGG + Intronic
1136077513 16:27827153-27827175 ATGTGCCAGGCCCTGTGCCCAGG - Intronic
1136612788 16:31377438-31377460 GTGTGCCAGGCAGGGTGCTGTGG + Intronic
1136712127 16:32247477-32247499 ATGTGGCAGCCACTGGGCACAGG + Intergenic
1136755787 16:32681927-32681949 ATGTGGCAGCCACTGGGCACAGG - Intergenic
1136812326 16:33188445-33188467 ATGTGGCAGCCACTGGGCACAGG + Intergenic
1136818802 16:33298525-33298547 ATGTGGCAGCCACTGGGCACAGG + Intronic
1136825365 16:33355058-33355080 ATGTGGCAGCCACTGGGCACAGG + Intergenic
1136830431 16:33453829-33453851 ATGTGGCAGCCACTGGGCACAGG + Intergenic
1137062225 16:35801361-35801383 ATGAGCCAGGCAGTGAGCTGTGG - Intergenic
1137308412 16:47229075-47229097 ATGTGTCAGGCACTGTGCTGGGG + Intronic
1137407039 16:48197358-48197380 ATGTGACAGGTACTGTGTAGGGG + Intronic
1137476503 16:48814081-48814103 TTGTGCTAGGCACTGTGCTAGGG + Intergenic
1137522628 16:49208085-49208107 TTGTGCCAGGCACTGTGCTGAGG + Intergenic
1137581295 16:49635040-49635062 ATGTGGAAGGCCCTTTGATGTGG - Intronic
1137606526 16:49790370-49790392 CTGAGCCAGGCACTGTGCTGGGG + Intronic
1137769538 16:51004834-51004856 ATGTGCCAGGCACTGTTTTAGGG - Intergenic
1138004641 16:53321069-53321091 ATGTGACAGGCATTATGCTAAGG + Intronic
1138127888 16:54453848-54453870 ATGTGCTGGGCACTCTGCTGAGG + Intergenic
1138131169 16:54481325-54481347 ATGTGGTAGGCACTGTAGTAGGG + Intergenic
1138375827 16:56563375-56563397 CTGTGGCAGGCACTGGGGAGGGG - Intergenic
1138461985 16:57154572-57154594 ATGTGCCAGGCACTGTACCAAGG + Intronic
1138607570 16:58098746-58098768 CTGTGCCAGGCACTGTCCTGGGG + Intergenic
1138695013 16:58804857-58804879 ATCAGACAGGCACTCTGCTGTGG + Intergenic
1138834215 16:60413516-60413538 CTGTGGCAGGCACCATTCTGAGG - Intergenic
1138954937 16:61960482-61960504 ATGTGACAGACTTTGTGCTGAGG - Intronic
1138991526 16:62395867-62395889 AAGTGCCAGGCACTATGCTAGGG + Intergenic
1139294602 16:65889432-65889454 ATGTGCTAGGCACTGTGTTAGGG - Intergenic
1139349832 16:66327976-66327998 GGGTGGCAGGCACTGGGCTGGGG + Intergenic
1139365942 16:66433720-66433742 ATGTGGCAGCAACTGAGCAGAGG + Intronic
1139389582 16:66598247-66598269 ATGTGACAGGCTCTGGGCTGGGG + Intergenic
1139513839 16:67442043-67442065 AAGTGGCAGGCAGTTTGCTGTGG - Intronic
1140000902 16:71024064-71024086 ATGTGCTAGGCACAGTGTTGGGG - Intronic
1140070396 16:71644049-71644071 AGGTAGCAGGCAGTGTGCAGTGG + Intronic
1140133994 16:72189097-72189119 ATGTGCCAGGCACCGTGCTATGG + Intergenic
1140266089 16:73422449-73422471 GTGTGCCAGTCACTGTGCTTGGG - Intergenic
1140313313 16:73869897-73869919 TTGTTCCAGGCACTGTCCTGGGG - Intergenic
1140477921 16:75248283-75248305 ATGTGCGAGGCTCTGTGCTGGGG - Intronic
1140524826 16:75613902-75613924 ATTTGGCAGGCAGGGTGCGGTGG + Intronic
1140942325 16:79733869-79733891 ATGTACCAGACACTGTGCTAAGG - Intergenic
1140951570 16:79823460-79823482 ATGTGCCAGACACTGTGCTCAGG - Intergenic
1140967502 16:79981166-79981188 CTGCGCCAGGCTCTGTGCTGGGG + Intergenic
1141159369 16:81618825-81618847 ACGTGCCAGGCACCGTGCTGAGG + Intronic
1141179265 16:81741230-81741252 GTGTGCCAGGTATTGTGCTGGGG + Intronic
1141274033 16:82568781-82568803 TTGGGCCAGACACTGTGCTGGGG - Intergenic
1141339769 16:83192301-83192323 GTGTGTCAGGGACTGTGCTGTGG + Intronic
1141395440 16:83700478-83700500 ATGTGCCAGGCACTGTTGTTAGG + Intronic
1141643326 16:85354388-85354410 ATGTGCCAGGCACTGATCTAGGG - Intergenic
1141763923 16:86046391-86046413 ATGTGCCAGGCCCTGTGCCAGGG + Intergenic
1141843619 16:86591646-86591668 ATGTGTCAAGCTCTGTGCTGAGG + Intergenic
1141855710 16:86680124-86680146 CTGTGGCAGGCACTATTTTGGGG - Intergenic
1142179952 16:88663517-88663539 CTGTGTGAGGCGCTGTGCTGGGG + Intergenic
1142274132 16:89107052-89107074 ATCTGGCAGGGTCTGTGCTGTGG + Intronic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1202990903 16_KI270728v1_random:11415-11437 ATGTGGCAGCCACTGGGCACAGG + Intergenic
1203057929 16_KI270728v1_random:942283-942305 ATGTGGCAGCCACTGGGCACAGG - Intergenic
1142637323 17:1266074-1266096 ATGTGCCAGGTACCGTGCTAAGG + Intergenic
1142882023 17:2889352-2889374 CAGTGCCAGGCCCTGTGCTGGGG + Intronic
1142931248 17:3285638-3285660 ATTTGTCAGGCACAGTGGTGCGG + Intergenic
1143033312 17:3980264-3980286 ATGTGCCAAGCATGGTGCTGAGG - Intergenic
1143281570 17:5758430-5758452 ACGCAGCAGGCACTGTGCTGGGG - Intergenic
1143425748 17:6835987-6836009 ATGTGCCAGGCACTGTGCTTGGG + Intergenic
1143472776 17:7186269-7186291 ATGCGTCAGGCACTGTGCTGAGG + Intergenic
1143974665 17:10821082-10821104 CTGTGCCAGACCCTGTGCTGGGG - Intergenic
1144563941 17:16344442-16344464 ATGTGGAAAGCGCTCTGCTGAGG + Intronic
1144662937 17:17083035-17083057 CTGTGGCAGGCATGGTGCTGAGG + Intronic
1144749018 17:17635359-17635381 ATGTGTCAGGCACGGGGCTGGGG + Intergenic
1144757278 17:17687270-17687292 ATGTGTTAGGCACTATGGTGGGG + Intronic
1144771322 17:17761190-17761212 ATGTGCCAGTCCCTGTGCTGAGG - Intronic
1144789457 17:17849374-17849396 GAGTGACAGGCCCTGTGCTGTGG - Intronic
1145267098 17:21385107-21385129 ATGGGACAGGCACTGAGATGCGG - Intronic
1145889979 17:28407478-28407500 ACGTGCCAGGCACTGTGCTGGGG + Intergenic
1145902386 17:28497217-28497239 GCTTGGCAGGCACTGGGCTGTGG - Exonic
1146481529 17:33208770-33208792 ATGTGCCAGGCCCTGTTCTGAGG - Intronic
1146635188 17:34498840-34498862 TTGTGCCAGGCATTGTGCTGTGG - Intergenic
1147041201 17:37720684-37720706 ATGTGCCAGGCACAGGGCTATGG + Intronic
1147639572 17:41987470-41987492 ATGTGTCAAGCACTGTGCCAGGG + Intronic
1147645705 17:42032641-42032663 ATTTGCCAGGCACTGTGCCCGGG + Intronic
1147653792 17:42077091-42077113 GTGTGTCAGGCACTGTTCTAGGG - Intergenic
1147870713 17:43585508-43585530 TTGTGCCAGGCATTGTCCTGGGG - Intergenic
1147988065 17:44317912-44317934 CTGTGCCAGGCACCGTGCTGGGG - Intronic
1148143326 17:45343615-45343637 GTGTGCCAGGCACTGTGCCAAGG + Intergenic
1148194939 17:45706565-45706587 TTGTGCCAGGCACTGTTCTAGGG - Intergenic
1148632246 17:49120178-49120200 ATGAGCCAGCCCCTGTGCTGGGG + Intergenic
1148750102 17:49940690-49940712 GTGTGCCAGGCACTGTGCTGAGG + Intergenic
1148901829 17:50884373-50884395 ATGAACCAGGCTCTGTGCTGGGG - Intergenic
1149098891 17:52880044-52880066 AGGTGCCAGGCACTGTTCTAAGG + Intronic
1149234996 17:54578847-54578869 TTGTGGGAGGCACAGTGCTGTGG + Intergenic
1149329119 17:55563339-55563361 ATGTGCCAGGCACTGTCCTTGGG + Intergenic
1149358668 17:55870142-55870164 ATGTGGGAAGCAGTGTCCTGAGG + Intergenic
1149388340 17:56164489-56164511 ATGTGCCAGCTACTGTGCTACGG - Intronic
1149445077 17:56707298-56707320 ATGTGCCAGGAGTTGTGCTGAGG + Intergenic
1149549753 17:57531694-57531716 GTGTGTCAAGCCCTGTGCTGGGG + Intronic
1149785523 17:59431480-59431502 ATGTGGAAGGCACTGTGCTCAGG - Intergenic
1149854302 17:60066738-60066760 ATGTGCCAGGCATCATGCTGAGG + Intronic
1150137756 17:62704758-62704780 ATGTGGGAGCCACTGTTCTAAGG + Intronic
1150203824 17:63385129-63385151 ATGTGTCAGGTTCTGTGCTAGGG - Intronic
1150494838 17:65599375-65599397 ATGTGCTGGGCACTGTGCTAAGG + Intronic
1150506411 17:65703152-65703174 AATATGCAGGCACTGTGCTGTGG + Intronic
1150559643 17:66283435-66283457 ATGTGCCAGGTACTGGGCTTTGG + Intergenic
1150699591 17:67435501-67435523 ATGGGGCTGACATTGTGCTGGGG + Intronic
1150716140 17:67574094-67574116 ATGTGCCAGTCACTGTGCTGGGG + Intronic
1150931147 17:69586807-69586829 TTCTGGTAGGCACTGTGCTAGGG + Intergenic
1151289443 17:73138966-73138988 ATGTGGCAGCTGCTGGGCTGAGG - Intergenic
1151331404 17:73411367-73411389 TTGTGGCAAGCACAGTGCAGAGG + Intronic
1151620661 17:75242983-75243005 ATGTGGTTTGCACTGTGCTGCGG - Intronic
1151675954 17:75597529-75597551 CTGTGCCAGGAACTGTGCTAAGG + Intergenic
1151887954 17:76934192-76934214 ATGTGCCAGGCATTGTGCTAAGG + Intronic
1152257342 17:79247934-79247956 GTGGGCCAGGCACTGTGCTAAGG - Intronic
1152257352 17:79247978-79248000 GTGGGCCAGGCACTGTGCTAAGG - Intronic
1152388675 17:79990334-79990356 ATGGGGCAGGTGCTGCGCTGTGG - Intronic
1152656553 17:81522541-81522563 GTGTGCCAGGAACCGTGCTGGGG - Intronic
1152782909 17:82234301-82234323 CTGTCCCAGGCACTGTGGTGGGG + Exonic
1152998584 18:431861-431883 ATGTGCCAGGCACTGTGCTAAGG + Intronic
1153345414 18:4020425-4020447 ATGTGCCAGGTCCTGGGCTGGGG + Intronic
1153370041 18:4305094-4305116 ATGTGCCAGGACCTGTGGTGAGG + Intronic
1153608298 18:6855899-6855921 ACGTGCCTGGCTCTGTGCTGTGG + Intronic
1153675291 18:7451715-7451737 CTCTGGCAGGTGCTGTGCTGTGG + Intergenic
1153698575 18:7668951-7668973 ATGTGCCAGGCACTGGTCTAAGG - Intronic
1154074952 18:11191244-11191266 ATGGGGCAGGAACTGAACTGAGG + Intergenic
1154304941 18:13223727-13223749 GTGTGCCAGGCTCTGTTCTGAGG + Intronic
1155038073 18:22042114-22042136 CTGTGCCAAGCACTGTGCTAGGG - Intergenic
1155095421 18:22550600-22550622 CTGTCCCAGGCACTGTGCTGAGG - Intergenic
1155779390 18:29811814-29811836 TTGTGGCAGGGACTGTGCATGGG - Intergenic
1156046319 18:32881446-32881468 ATCTGGCAGGGACAGAGCTGGGG - Intergenic
1156234772 18:35191810-35191832 ATGTGCCAGACGCTGTGCTAGGG + Intergenic
1156385539 18:36601517-36601539 ATATGCCAGGCACTGTCCTAAGG + Intronic
1157047806 18:44123927-44123949 GTGTGTCTGGCACTGTTCTGAGG + Intergenic
1157505107 18:48220467-48220489 AAGTGTCAGGCATGGTGCTGGGG + Intronic
1157699885 18:49755538-49755560 ATGTGCCAGGCATTGTGCTGGGG + Intergenic
1157828189 18:50831443-50831465 ATGTGCCAAGTACTGTGCTGGGG - Intergenic
1158438512 18:57452274-57452296 ATGTGTTAGGCATTGTGGTGGGG - Intronic
1158553524 18:58457323-58457345 ATGTACAAGGCACTGAGCTGGGG + Intergenic
1158775652 18:60575416-60575438 ATGAATCAGGCACTGTGCTGAGG + Intergenic
1158913787 18:62098125-62098147 ATGTGCTAGGCACTATGCTCAGG - Intronic
1159634727 18:70790531-70790553 ATGTGTTAGGCACTGGGCTAAGG + Intergenic
1160060622 18:75526033-75526055 ATGTGTCAGGCACTGTGCTGGGG + Intergenic
1160087778 18:75794660-75794682 AGGTGTGAGGCACTGTCCTGAGG - Intergenic
1160128636 18:76204312-76204334 AAGGGGCAGGCACTTGGCTGAGG + Intergenic
1161482763 19:4519021-4519043 GTATGCCAGGCACTGTTCTGTGG - Intergenic
1161609329 19:5232279-5232301 ATGTGCCAGGTACTGTGCCAAGG + Intronic
1161609483 19:5233433-5233455 ATGTGCCAGGCACTGTGCCAAGG + Intronic
1161609634 19:5234680-5234702 GCGTGCCAGGCACTGTGCTAAGG + Intronic
1161609652 19:5234817-5234839 GTGTGCCAGGTGCTGTGCTGGGG + Intronic
1161642238 19:5431567-5431589 ATGTGCCAAGCCTTGTGCTGAGG - Intergenic
1161673176 19:5625663-5625685 TGATGCCAGGCACTGTGCTGAGG + Intronic
1161933521 19:7356919-7356941 GTGTACCAGGCACTGTGCCGGGG + Intronic
1162104205 19:8360348-8360370 ATATGCCAGGCACTGTACTGGGG - Intronic
1162799052 19:13101081-13101103 GTGGGGCAGGCGCTGGGCTGGGG + Exonic
1163601151 19:18249952-18249974 ATGTGCTGGGCTCTGTGCTGGGG - Intronic
1164489329 19:28692300-28692322 ATGTGGGGAGCACTGTCCTGAGG - Intergenic
1164714446 19:30381266-30381288 ATGTGCCAGGCACTGTGCTGGGG + Intronic
1164760596 19:30725698-30725720 AGGTGCCAGGCGCTGTGTTGAGG - Intergenic
1164761059 19:30728593-30728615 ATATGGGAGGCCCAGTGCTGGGG + Intergenic
1164811666 19:31162198-31162220 GTGGGCCAGGCACTGTGCTGGGG - Intergenic
1165655318 19:37527446-37527468 ATGTGCCAGGCACTGTTCAAAGG + Intronic
1165707854 19:37989071-37989093 ACACGGCAGGCACCGTGCTGGGG - Intronic
1165733585 19:38162066-38162088 ATGTGCCAGACACCGTTCTGAGG - Intronic
1165901435 19:39171113-39171135 TTGTGGCCAGCACTGTCCTGGGG + Intronic
1166127168 19:40722085-40722107 GTGTGCCAGGCCATGTGCTGGGG + Intronic
1166130741 19:40744232-40744254 ATGTGCCCAGCACCGTGCTGAGG + Intronic
1166321235 19:42020407-42020429 ATGTGCCAGGCACTCAGGTGAGG - Intronic
1166323783 19:42036765-42036787 ATGTGTCAGGCCCTGAGCTGGGG + Intronic
1166561974 19:43738894-43738916 GTGTGCCAGGCCCTGTGCAGGGG - Intronic
1166730190 19:45054848-45054870 CTGTGCCAGGCTCGGTGCTGGGG - Intronic
1166743150 19:45126244-45126266 ATGTGGCAGGCACAGAGTGGTGG + Intronic
1166940015 19:46356885-46356907 ATGGGGCAGGCTCTGGGCTCAGG + Intronic
1167015713 19:46839691-46839713 CTGTGCCTGGCCCTGTGCTGGGG + Intronic
1167176322 19:47866916-47866938 ATGGGGCAGGCCAGGTGCTGTGG - Intergenic
1167196984 19:48036232-48036254 ATGTGGAAGGCACCGTTCTTGGG + Intronic
1167513083 19:49907093-49907115 ATGTGACAGGGACCGGGCTGGGG + Intronic
1167714917 19:51137102-51137124 ACGTGTCAGGCACTTTCCTGGGG - Intergenic
1167739740 19:51317260-51317282 ATGTGGCAGGCACCGGCCTGTGG - Intronic
1168153369 19:54460642-54460664 AGCCAGCAGGCACTGTGCTGAGG + Intronic
1168328513 19:55551701-55551723 ATGGGCCAGGTACTGTTCTGGGG + Intergenic
1168412799 19:56150130-56150152 ATGTGCCAGGTCCTGTTCTGAGG - Intronic
1168485065 19:56754467-56754489 ATGTGTTAGGCACAGTGCTAGGG + Intergenic
1168639923 19:58024435-58024457 AGGTGTGAGCCACTGTGCTGGGG - Intergenic
925148635 2:1599893-1599915 GTGTGGCATGCACAGAGCTGCGG - Intergenic
925293174 2:2761917-2761939 CTGTGTCAGGCACTGTACTAGGG - Intergenic
925801916 2:7609954-7609976 ATGTGCCAGACACTGTGCTAGGG - Intergenic
925976111 2:9143254-9143276 GTGTGCCAGGCCCTGTGCTGGGG + Intergenic
926049451 2:9735122-9735144 ATGTACCAGGTACTGTGCTGGGG + Intergenic
926240384 2:11080769-11080791 ATGTGCTAAGCACTGTGCTCAGG + Intergenic
926392259 2:12405458-12405480 ATGTGGCAGGCATCATACTGTGG - Intergenic
926710071 2:15872175-15872197 ATGTGGCAGGTTCTGTGCTGAGG + Intergenic
927114278 2:19886029-19886051 ATGTGGCAGGCAGTGCCATGGGG - Intergenic
927251529 2:20998926-20998948 ATGTGTAAGGCACTGTGCAGTGG - Intergenic
927271625 2:21216345-21216367 TTTTGCCAGGCACTGTGCTAAGG + Intergenic
927710718 2:25324216-25324238 ATGTGCCAAGCACTGTGCTAAGG + Intronic
927962847 2:27251260-27251282 TTGTGCAAGGCACTGTGGTGCGG - Intergenic
928035436 2:27818218-27818240 ATGTGCCAGGCACTGTTCTCAGG + Intronic
928138551 2:28707560-28707582 ATATGGCAGGCATTGTGCTCAGG + Intergenic
928157723 2:28892212-28892234 ATGTGCCAGGCACTGTTTTAGGG - Intergenic
928259866 2:29756843-29756865 ATGTGCCAGTCACTGTGCTAGGG + Intronic
928275152 2:29893966-29893988 ATGTGCCAAGCACTCTGCTAAGG - Intronic
928413973 2:31075961-31075983 AGGTGTCAGGCACTGTGCTCAGG - Intronic
928437007 2:31261228-31261250 AGGTGCCAGACACTGTGATGAGG - Intronic
928453867 2:31401903-31401925 ATAAGTCAGGCACTCTGCTGAGG + Intronic
928906096 2:36369320-36369342 ATCCAGCAGGCACTGGGCTGTGG - Intronic
928972597 2:37046760-37046782 ATGTGGCAGGCTGGGTGCAGTGG + Intronic
929247458 2:39718565-39718587 ATGTGCCAGTAACTGGGCTGTGG + Intergenic
929563001 2:42967570-42967592 ATGTGTCAGGCCCTGGGCAGGGG - Intergenic
930887166 2:56339143-56339165 TTGTGTCAGGCACTGTTCTAGGG - Intronic
931836392 2:66103325-66103347 ATCTGGCAGGACCTGGGCTGAGG - Intergenic
931913066 2:66923339-66923361 ATGTGCCAAACACTGTCCTGTGG + Intergenic
932123354 2:69121233-69121255 ATGTGCCAAGCAATGTGCTAAGG - Intronic
932191229 2:69742647-69742669 ATGTGCCGGGCACTGTGCCGAGG - Intronic
932432590 2:71684887-71684909 CTGTGGCTGGGACTGTGCTTAGG + Intronic
932469547 2:71944936-71944958 CTGTGATAGGCACTGTGCTAGGG - Intergenic
932471825 2:71964205-71964227 ATGGGCCAGGCACTGTTCTCAGG + Intergenic
933269586 2:80218698-80218720 AAGTAGCAGGCACTGGGCTAAGG - Intronic
933575150 2:84058829-84058851 GTGTGTCAGGCACTGTTCTAGGG + Intergenic
933989582 2:87624669-87624691 GTAGGTCAGGCACTGTGCTGGGG + Intergenic
934921855 2:98350293-98350315 ATATGTCAGGCACTGAGCTGAGG - Intronic
935091075 2:99895607-99895629 CTGTGGCTGGCACGGTGGTGAGG - Intronic
935205724 2:100895279-100895301 TTGTGCCGGGGACTGTGCTGGGG + Intronic
935279763 2:101507161-101507183 ATGTGCCAGGCACTGTGCACAGG + Intergenic
935290363 2:101604996-101605018 ATATGCCAGGCACTGTTCAGGGG + Intergenic
935336505 2:102021789-102021811 TTGTGGCAGGCACTTTGGAGAGG + Intronic
935587725 2:104816790-104816812 ATGGGCCAGGCACTGTGCCGGGG - Intergenic
935860163 2:107320858-107320880 ATATGGCAGGCACTGCTCAGGGG - Intergenic
935863514 2:107360163-107360185 CTGAGCCAGGCACGGTGCTGTGG - Intergenic
936142008 2:109948593-109948615 CTGTGCCAGGCACTGTGCCAGGG - Intergenic
936178696 2:110246541-110246563 CTGTGCCAGGCACTGTGCCAGGG - Intergenic
936202682 2:110422891-110422913 CTGTGCCAGGCACTGTGCCAGGG + Intronic
936797838 2:116228406-116228428 ATATGCCAGGAACTGTGCTGGGG + Intergenic
937103746 2:119291510-119291532 ATGTGACAGGTAATGTGCTCAGG + Intergenic
937229194 2:120387551-120387573 TTGGGCCAGGCACTGTGCTCGGG - Intergenic
937486975 2:122325295-122325317 ATGTGTCAGGCACTATTCTAGGG - Intergenic
937803753 2:126112945-126112967 GTGTGACAGTCACTGTGATGAGG - Intergenic
938196707 2:129334928-129334950 GAGTGGCAGTCACTGTGCAGTGG + Intergenic
938772529 2:134512620-134512642 TTGTGCCAGGCACTGTTCTGGGG + Intronic
938986695 2:136583479-136583501 CTGTGCCAGGCACTGGGCTGTGG + Intergenic
939131848 2:138244460-138244482 ATGTGGTAGGCAGGGGGCTGGGG + Intergenic
939504934 2:143033516-143033538 ATGTGCCAAGCATTGTGCTGGGG - Intronic
939643054 2:144663823-144663845 ATGTGCTGGCCACTGTGCTGAGG - Intergenic
939729492 2:145764415-145764437 ATGTGCCAGATACTGTGCTAAGG - Intergenic
939953663 2:148505974-148505996 ATGTGCCAAGTACTGTGCTGAGG - Intronic
939954441 2:148514749-148514771 AGGTGGCATGCTCTGTGCTGTGG - Intronic
940044486 2:149394373-149394395 GTGTGTCAGGCACTGTGCCATGG + Intronic
940110558 2:150147941-150147963 ATGTGCCAGGCCTTGTTCTGGGG + Intergenic
940129981 2:150370090-150370112 ATGTGCCTGGCTGTGTGCTGTGG + Intergenic
940339594 2:152566340-152566362 GTGTGGCAGCCACTGTACTAAGG + Intronic
940903360 2:159146993-159147015 AGGCAGCAGCCACTGTGCTGGGG + Intronic
941291484 2:163680950-163680972 ATGTGCCAGACACTATGCTAAGG + Intronic
941310016 2:163915703-163915725 ATATGCCAGGCAATGTGCTGAGG - Intergenic
941319412 2:164035879-164035901 ATGTTGTGGGCACTGTGCTAAGG + Intergenic
941526497 2:166612630-166612652 ATGGGCCAGGCAGTGAGCTGTGG - Intergenic
941782800 2:169463026-169463048 AGGTGGCTGGCACTGTGCTAAGG + Intergenic
941863505 2:170309628-170309650 ATGGAGCAGGCACTGGACTGGGG - Intronic
942181959 2:173388636-173388658 ATGGGCCAGGGCCTGTGCTGAGG - Intergenic
942545585 2:177060447-177060469 ATGTACCAGGCACCATGCTGGGG - Intergenic
943774104 2:191746526-191746548 GTGTGGAAGGCACTGTGCCCAGG - Intergenic
944439363 2:199726936-199726958 AGATGGGATGCACTGTGCTGGGG + Intergenic
944678448 2:202053850-202053872 ATGTGCCAGGCTCTGTGCTGGGG - Intergenic
944816978 2:203387159-203387181 ATGTGTCTGCCACTGTTCTGTGG + Intronic
944973009 2:205015779-205015801 GTGTGCCAGGCAAGGTGCTGAGG - Intronic
944976285 2:205055082-205055104 AAGTGCCAGGCACTGTGCCTGGG - Intronic
945406856 2:209459318-209459340 ATGTGCCAGGCACTGTTCTAGGG - Intronic
945539536 2:211067465-211067487 ATGTGGCAGGCATTGTACTAGGG - Intergenic
945660833 2:212683262-212683284 ATGTGTTAGGCATTGTACTGAGG + Intergenic
945740708 2:213657354-213657376 ATGTGTCAAGCACTCTGCTAAGG - Intronic
946148126 2:217746178-217746200 ATGTGCCAGGCACTGTCCTGTGG - Intronic
946339124 2:219057162-219057184 CTGTGGCAGGCTCTGGACTGTGG + Intronic
946921050 2:224582822-224582844 ATGTGCCAGGCACTGTTCTGGGG - Intronic
947000544 2:225450679-225450701 ATGTGGCAGCCACTTTTCTAAGG - Intronic
947073795 2:226319537-226319559 ATGTGCCAGGTACTGTTCTGGGG - Intergenic
947556078 2:231094361-231094383 ATGGGCCAGGCAGTGAGCTGTGG + Intronic
947709186 2:232301082-232301104 ATGTGTTAGGCACAGTACTGGGG + Intronic
947952675 2:234161575-234161597 CTGTCGTAGGCACTCTGCTGGGG + Intergenic
948859758 2:240747080-240747102 ATGGGGCAGGCTCAGTGCTCTGG + Intronic
948910497 2:241000001-241000023 ATGTGGCTGGCAGTGGGTTGAGG - Intronic
948969488 2:241414074-241414096 ACGGGGAAGACACTGTGCTGTGG + Intronic
949051274 2:241898834-241898856 ATGAGGCATCCACTGTTCTGGGG + Intronic
1168854437 20:998756-998778 CTGTGCCAGGCTCTGTGTTGGGG - Intronic
1168957291 20:1843155-1843177 ATGTGCCAGGCATTGTTGTGAGG - Intergenic
1168966853 20:1903969-1903991 GTGTGTCAGGCCCTGTGCTGAGG - Intronic
1168986869 20:2056490-2056512 CTGTGCCAGGCACTGTACTAAGG + Intergenic
1169004431 20:2195011-2195033 ATGTACCAGGCACTCTTCTGAGG - Intergenic
1169248242 20:4041053-4041075 ATGTGTCAGACATGGTGCTGGGG - Intergenic
1169391501 20:5194880-5194902 ATGTGCCAGGCATAGTGCTAAGG + Exonic
1169609280 20:7361176-7361198 GTGTGGCAGGTATTGTGCTGAGG + Intergenic
1169738842 20:8867912-8867934 GTGTGGCAGGCACTGTTCCTAGG - Intronic
1169803278 20:9533195-9533217 ATGTGACAGGCATTGTGCTAGGG - Intergenic
1170154834 20:13259932-13259954 ATGTATCAGGTACTGTGCTAGGG - Intronic
1170374532 20:15685965-15685987 AAGTGCCAGGCACTGTGCAATGG - Intronic
1170432050 20:16284799-16284821 AGGTGGCATCTACTGTGCTGTGG - Intronic
1170510107 20:17067728-17067750 ATGTGCTAGGCACTGTTCTGGGG + Intergenic
1170591104 20:17772667-17772689 CTGAGGCAGGCACTTTGCTGGGG - Intergenic
1170907734 20:20530860-20530882 CTCTGCCAGGCGCTGTGCTGAGG - Intronic
1171294941 20:24009114-24009136 ATGTGCCAGGCTCTGGCCTGTGG + Intergenic
1171958422 20:31476541-31476563 GAGTGGAAGGCACTGTGCTCAGG - Exonic
1171992228 20:31705531-31705553 GTGTGTTAGGCACTGTGCTGGGG - Intronic
1172145527 20:32755200-32755222 CTGTGCCAGGCACTGTGGTAAGG - Intergenic
1172198423 20:33108159-33108181 GTGTGCCAGGCACTATGCAGGGG + Intronic
1172227561 20:33315243-33315265 ATGTGCCAGGCACCATGCTGAGG - Intergenic
1172256626 20:33524164-33524186 ATGTGCCAGGCACTGAGTTAAGG - Intronic
1172287847 20:33753503-33753525 GTGTGCCAGACACTGTGCTGGGG + Intronic
1172582034 20:36055969-36055991 ATATGCAAGGCACTGTACTGAGG + Intergenic
1172606229 20:36216057-36216079 ATGCGCCAGGCACTGTTCTCAGG - Intronic
1172626052 20:36347480-36347502 ATGTGCCAAGCCCTGTGCTGGGG + Intronic
1172626743 20:36351803-36351825 ATGCCCCAGACACTGTGCTGGGG + Intronic
1172672625 20:36644773-36644795 ATGTGCCAGGCACTTTCCGGAGG + Intronic
1172765492 20:37348553-37348575 AGGTGGCAGGGCCTGAGCTGAGG + Intronic
1172830327 20:37828668-37828690 AGGTGGCAGGCACTGGGCTAGGG - Intronic
1173025751 20:39305889-39305911 ATGTGCCAGGTACTGTGCTGGGG + Intergenic
1173054099 20:39594709-39594731 ATGCGGCAGGCACTGTTCTAGGG - Intergenic
1173234435 20:41231649-41231671 ATGTGTCAGGCTCTGTACTAAGG - Intronic
1173344447 20:42185879-42185901 AGGGGTCAGGCACTCTGCTGAGG + Intronic
1173351422 20:42248923-42248945 ATGTGCCAGGCACTGTGCTAAGG + Intronic
1173391156 20:42634967-42634989 GTGTTTCAGGCACTGTGCTTGGG - Intronic
1173582585 20:44158070-44158092 ATGTGCCAGTCACTGTTCTGAGG - Intronic
1173670448 20:44795157-44795179 ATGTACCACGCACTGTGCTAAGG + Intronic
1173789630 20:45819536-45819558 ATGTGCCAGGCATTGTTCTAAGG - Intergenic
1173871575 20:46345336-46345358 TTGTGGTAGACACTGTGATGTGG + Intergenic
1173939970 20:46902356-46902378 ATGTCCCAGGCATTGTGCTGTGG + Intronic
1174039685 20:47690098-47690120 CTCTGGCAGGCAGAGTGCTGAGG + Intronic
1174060259 20:47827355-47827377 CTGTGCCAGGCACTGCGCTCAGG - Intergenic
1174071638 20:47904015-47904037 CTGTGCCAGGCACTGCGCTCAGG + Intergenic
1174152411 20:48494620-48494642 CTGTGCCAGGCACTGCGCTCAGG - Intergenic
1174224470 20:48985736-48985758 GTGTGCCAGGCACTGTGCTAAGG + Intronic
1174443836 20:50577253-50577275 ATGTGCCAGTCACTGTGCCAGGG - Intronic
1174523511 20:51153529-51153551 ATGTGCCAAGCACTGTGCTGAGG + Intergenic
1174570574 20:51498350-51498372 ATGTGACAGGCACTGTGCTTGGG + Intronic
1174584068 20:51593786-51593808 ATGTGTTAGGCACTGTTCTTGGG - Intergenic
1174607167 20:51768972-51768994 ATGTTGCAGGCAGTGAGCAGTGG - Intergenic
1174622492 20:51886652-51886674 ATGTGCCTGGCACTGTCCTGGGG - Intergenic
1174634521 20:51987539-51987561 ATGTGCCAGGCACTGTTCTATGG + Intergenic
1174774095 20:53327654-53327676 ATGTGACAAGCACTGAGCTAGGG + Intronic
1174929962 20:54802762-54802784 ATGTGCCAGGCATTGTGCTGGGG - Intergenic
1175031932 20:55963325-55963347 ATGTGCAAGGCACTGTGCTATGG + Intergenic
1175078372 20:56395289-56395311 GTATGCCAGGCACTGTGCTCAGG + Intronic
1175161978 20:57015281-57015303 ATGTGCCAGGCACAGTGCCAAGG + Intergenic
1175373479 20:58508714-58508736 ATGTGCCAGGCACTGTTCTAGGG + Intronic
1175415361 20:58797266-58797288 GAGTGCCAGGCACAGTGCTGGGG - Intergenic
1175448128 20:59040482-59040504 ATGTGTCAGCCACTGTTCTTTGG - Intronic
1175640720 20:60628030-60628052 ATGTGCCAGGCACTGTGCTAAGG - Intergenic
1175974849 20:62705655-62705677 CTGGGGCAGCCAGTGTGCTGGGG - Intergenic
1176106512 20:63392110-63392132 AAGTGGCAGGCTGGGTGCTGTGG - Intergenic
1176901380 21:14446221-14446243 ATGATCCAGGCACTGTGCTAGGG - Intergenic
1177193334 21:17876007-17876029 ATGGACCAGGCACTGTGCTGTGG + Intergenic
1178411899 21:32370909-32370931 ATGTGCCAGGCACTGTCCTAGGG + Intronic
1178437259 21:32570944-32570966 ATGTGGCAGGCATTGTTTTAGGG - Intergenic
1178461587 21:32807217-32807239 ATGTGCCAGGCCCTGTGCTAAGG - Intronic
1178769135 21:35486133-35486155 ATGTGCCAGGCACTATGTTAAGG - Intronic
1178892022 21:36528251-36528273 ATGTGCCAGGCAGTGTGGTTAGG + Intronic
1179414527 21:41187375-41187397 GTGTGGCTGGCAGTTTGCTGTGG + Intronic
1179599056 21:42463696-42463718 GTGTGCCAGGCACTGTGCCTGGG - Intergenic
1180713504 22:17856089-17856111 ATGTAGCACGCACTGTGCACAGG - Intronic
1180846546 22:18985957-18985979 ATGTGGCACGCAACGTGCAGTGG + Intergenic
1180978723 22:19868589-19868611 ATGTGGCAGGTACCATGCTGGGG + Intergenic
1181260290 22:21592492-21592514 ATGTGGCAGGAGCTATCCTGAGG - Intronic
1181449318 22:23007727-23007749 ATGAGCCAGGCACTGAGCTATGG + Intergenic
1181544966 22:23597578-23597600 ATGCGCCAGGCACTAAGCTGGGG + Intergenic
1181724717 22:24803948-24803970 ATGTGGCAGGCACTGCGCTAAGG - Intergenic
1181750066 22:24983016-24983038 GTGGGCCAGGCTCTGTGCTGGGG + Intronic
1181764005 22:25078195-25078217 ATGTGCCAGGCACTGGGCCAAGG - Intronic
1181769401 22:25114351-25114373 GTGTGCCTGGCACTGTGCTGGGG - Intronic
1181784565 22:25217647-25217669 ATGCGTCAGGCACTGGGCTCTGG + Intergenic
1181815345 22:25432304-25432326 ATGCGCCAGGCACTAAGCTGGGG - Intergenic
1181909466 22:26227110-26227132 ATGTGCCAGACACTGCGCTGGGG - Intronic
1182007961 22:26977227-26977249 CTGTGCCAGGCACTGTGATAAGG - Intergenic
1182025352 22:27114023-27114045 ATGTGCCAGGCCCTGTGTTAGGG + Intergenic
1182091734 22:27600442-27600464 GAGTGCCAGGCACTGTGCTAGGG + Intergenic
1182114337 22:27746694-27746716 CTGTGCCTGGCACTGTGCTCAGG + Intergenic
1182214308 22:28703099-28703121 ATGTGCCAGGTGCTCTGCTGGGG + Intronic
1182323158 22:29491452-29491474 ATGTGCCAGGCAGTGTGCTAGGG + Intergenic
1182392529 22:30010927-30010949 GTATGCTAGGCACTGTGCTGGGG + Intronic
1182575274 22:31268740-31268762 ATATGCTAGGCACTGGGCTGAGG + Intronic
1183067382 22:35372364-35372386 ACGGGCCAGGCGCTGTGCTGGGG + Intergenic
1183157695 22:36087834-36087856 ACGTGCCAGGCACTGTTCTAAGG + Intergenic
1183224222 22:36538290-36538312 TTATGCCAGGCACTGTGCTATGG + Intergenic
1183247962 22:36708606-36708628 CTGTGTCAGGCCCTGTGCTGAGG + Intergenic
1183251979 22:36736844-36736866 TGGTGCCAGGCACTGTGCTGGGG - Intergenic
1183370574 22:37429462-37429484 GAGTGGCCGGCACTGTGCTGGGG - Intergenic
1183516739 22:38271261-38271283 ATGTGCCAGGCACTATGCTGGGG - Intronic
1183563977 22:38599653-38599675 GTGTGCCAGGCGCTGTGCTAAGG + Intronic
1183604408 22:38860260-38860282 ATGTGCCAGACACTGAGGTGTGG + Intergenic
1183971184 22:41478736-41478758 ATGTGGCAGGGACAGGGCGGGGG - Intronic
1184008906 22:41732012-41732034 AAGTGCCAGGGACTGTGCTATGG + Intronic
1184107696 22:42377906-42377928 ATGTGTCAAGCCCAGTGCTGTGG - Intergenic
1184112468 22:42403384-42403406 ATGTGTCAGGCCCTGTACAGAGG - Intronic
1184234580 22:43176221-43176243 ACGTGCCAAGCACTGTTCTGGGG + Intronic
1184273268 22:43396764-43396786 ATGTGGCAGGCAGGGAGGTGAGG + Intergenic
1184377492 22:44123902-44123924 CTGTGCCAGGCACTGTGCCAGGG - Intronic
1184451339 22:44584489-44584511 TGGTGCCAGGCACTGTTCTGGGG - Intergenic
1184472580 22:44704131-44704153 ATGTGCTAAGCACTGTGTTGAGG - Intronic
1184507796 22:44914607-44914629 GTGTCTCAGGCACTGTGGTGTGG - Intronic
1184530478 22:45052145-45052167 ATGCGGCAGGCCCTGTGCCCAGG - Intergenic
1184563449 22:45276826-45276848 ACGTGTCAGGGACTGTGCTAGGG - Intergenic
1184938349 22:47741288-47741310 ATGTGGCAGTCACTGTGAAAAGG - Intergenic
1185114164 22:48921820-48921842 ATGTGGCAGTCGCTGGGTTGTGG + Intergenic
949121516 3:390306-390328 ATGTGTCAGGCACTGTTCTAAGG - Intronic
949202790 3:1399764-1399786 ATGTGCCAGGCACTGTGCTAGGG + Intronic
949541692 3:5037482-5037504 CTGTGCCAGGCACTATGCTCAGG - Intergenic
949644942 3:6082590-6082612 ATGTGCTAGTCACTGTGCCGAGG + Intergenic
949763731 3:7502187-7502209 TTGTGGCAGTCACTGAGATGAGG - Intronic
949838415 3:8293821-8293843 CTGTGCCAGGCATTGTTCTGGGG - Intergenic
949951197 3:9230131-9230153 GAGTGCCAGGCACTGTGCTAAGG + Intronic
950141356 3:10618322-10618344 ATGTGCCAGGCACAGTACTAAGG - Intronic
950188969 3:10963316-10963338 ACATGGAAGGCACTGAGCTGAGG + Intergenic
950401824 3:12774965-12774987 ATGAGGCAGGCAAGTTGCTGGGG - Intergenic
950436568 3:12983803-12983825 TTGTGCCAGGCGCCGTGCTGAGG - Intronic
950503956 3:13382005-13382027 ATCTGGCAGGCACTTAACTGTGG - Intronic
950580892 3:13861402-13861424 ATGTGCCAGGCACTGTTCTAGGG + Intronic
950708918 3:14801572-14801594 GTGTGCCAGGCACTGGGCTAAGG + Intergenic
950769948 3:15303347-15303369 GTGTGGCAGGCTCTGGGCTGGGG - Intronic
950914884 3:16634295-16634317 GTGTGCCAGGCACTGTGCTAAGG - Intronic
950966934 3:17152967-17152989 ATGTGCCAAACACTGTGCTGGGG - Intergenic
951582763 3:24183289-24183311 AAGTGTCAGGCACTATGTTGGGG + Intronic
952205877 3:31181290-31181312 ATGGGGCAGGGACAGTGGTGAGG - Intergenic
952206682 3:31187363-31187385 GTATGCCAGGCACTGTGCTGAGG + Intergenic
952271716 3:31839359-31839381 ATGTGCCAGGCACTGCTCTCAGG + Intronic
952305881 3:32145618-32145640 ATGTTGGAGGCACTGAGCAGTGG + Intronic
952333130 3:32383012-32383034 ATGTGCCAGGCACTGTGCTGAGG + Intergenic
952512293 3:34069594-34069616 ATGTGTCAGGCACTGTGTTGGGG + Intergenic
952675515 3:36025832-36025854 ATGTGACAAGCATTGTGCTCAGG + Intergenic
952958661 3:38576339-38576361 ATGTGTCAGGCACCGTGCCAGGG + Intronic
953236919 3:41115023-41115045 ACGTGCCAGGAACTGTGCTAAGG + Intergenic
953386839 3:42511391-42511413 ATGTGTCAGGCACTGTGGCCAGG + Intronic
953481502 3:43256125-43256147 CTGTGCCAGGCACTGTGAGGGGG + Intergenic
953698403 3:45177821-45177843 ATGGGTCAGGCACTGTTTTGAGG - Intergenic
953972704 3:47359535-47359557 ATGTGGGAAGCAGTGTCCTGAGG - Intergenic
954143874 3:48624490-48624512 AGGTGCCAGGCTCTGTGCAGGGG - Intergenic
954700285 3:52447247-52447269 CTGTGTCAGGCCCTGTGTTGGGG + Intergenic
955060960 3:55491046-55491068 AAGTGCCAGGCATTGTTCTGAGG - Intergenic
955134104 3:56199035-56199057 ATATGACAGGCACTGTGCTAAGG + Intronic
955204743 3:56885652-56885674 ATCTGGCAGGAACTGGGTTGGGG - Intronic
955376268 3:58399882-58399904 ATGTACCAGGCACTGTTCTAGGG + Intronic
955378070 3:58414658-58414680 CTCTGCCAGGCATTGTGCTGGGG - Intronic
955583308 3:60448446-60448468 ATGTGGTAGGCACTGTGCCAAGG + Intronic
955679855 3:61489093-61489115 GTGTGCCATGCACTGTGCTTGGG + Intergenic
955834519 3:63040170-63040192 ATGTGTCAGGCAATGTGCCAAGG - Intergenic
955889136 3:63631959-63631981 GTGTGCCAGGCACTGTGCCAAGG - Intergenic
955892726 3:63667010-63667032 ATGAGCCAGGCACTGTTCTAGGG + Intronic
955949517 3:64228170-64228192 ATTTGCCAGTCACTGTGCTAGGG + Intronic
955951181 3:64243676-64243698 ATGTGTCAGGCACTCTGCTAAGG - Intronic
956345797 3:68277058-68277080 ATGTGCCAGGCACTGTGCTAAGG + Intronic
956354221 3:68373106-68373128 ATGTGCCAGGCACTGTGTTAGGG - Intronic
956639477 3:71402036-71402058 TTGTGGCAGGCTCTGAACTGGGG + Intronic
956677897 3:71753241-71753263 ATGTGGGTGGCAGTGTGCTGGGG - Intronic
956747982 3:72324463-72324485 ATGTGCCAGGCACTATGCTAGGG + Intergenic
957573184 3:81975342-81975364 CTGTGCCAGGCACTGCGCTTGGG + Intergenic
958268083 3:91463554-91463576 TTTTGGAAGGCACTGTGGTGTGG - Intergenic
958269986 3:91487549-91487571 ATGTAGCAGCCATTGTGCTGTGG - Intergenic
959637659 3:108593212-108593234 ATGTGCCAAGCACTGTCCTAAGG + Intronic
960281848 3:115789116-115789138 ATTTGGCTGGCACTGAGCTAGGG - Intergenic
960488212 3:118278887-118278909 ATGTGCCAAGCACAGTACTGGGG + Intergenic
960691881 3:120354745-120354767 AAGTGCCAGGCACTGTCCTAGGG + Intergenic
960997246 3:123348368-123348390 ATGTGCCAGGCACTATTCTGGGG + Intronic
961361520 3:126371027-126371049 ATGTGCCTGGTACTGTTCTGGGG + Intergenic
961397543 3:126606598-126606620 ATGTGGCAGAAACAGTGCAGTGG - Intronic
961516399 3:127440137-127440159 ATGTGCCAGGCACTGTGCGTGGG - Intergenic
961519927 3:127461202-127461224 CTGTGCTAGGCCCTGTGCTGGGG + Intergenic
961621073 3:128225578-128225600 ATGTGCCAGGCACGGTGCTGGGG - Intronic
961635503 3:128330354-128330376 ATGTGGCAGGCACTGTGCTGAGG + Intronic
961637088 3:128340536-128340558 GTGTGCCAGGCACTGTTCTAGGG - Intronic
961708731 3:128810231-128810253 ATGTGGCAGGCCGGGTGCGGTGG - Intronic
961907521 3:130277702-130277724 AAGTGTCAGGCCCTGTCCTGGGG - Intergenic
962050701 3:131811781-131811803 TTGTGTCAGGCACTGTGTTAAGG + Intronic
962099122 3:132323336-132323358 ATGTTCCAGGCACTGTTTTGGGG + Intronic
962209911 3:133468930-133468952 AACTGCCAGGCACTGTGCTAAGG - Intronic
962239849 3:133743231-133743253 ATGTGTCAGGCACTGTCCTGGGG - Intergenic
962244228 3:133778200-133778222 ATGTGCCAGTTTCTGTGCTGTGG - Intronic
962629642 3:137263291-137263313 ATGTGCCAGGCTCTGTGTTGGGG - Intergenic
962745722 3:138396211-138396233 TTGTGCCAGGCACTGCACTGAGG + Intronic
962844762 3:139264386-139264408 TTGTGGCAGGCATTGTGCTGGGG + Intronic
962869542 3:139476147-139476169 GTGGGCCAGGCACTGTGCTAAGG + Intronic
962930341 3:140030180-140030202 ATGTGCCAGGTGCTGTCCTGGGG + Intronic
963227533 3:142877524-142877546 TTGTGCCAAGCACTGTGCTAAGG + Intronic
963289296 3:143471152-143471174 ATGTGGCACGCACGGCACTGCGG + Intronic
963294432 3:143530068-143530090 TTGTAGCATGCACTGTACTGAGG + Intronic
963661557 3:148133358-148133380 GTGTGGCAGGCTGAGTGCTGTGG + Intergenic
963885971 3:150582731-150582753 ATATTGCAGCCAGTGTGCTGGGG + Intronic
964216408 3:154289396-154289418 ACGTGCCAGGCACTGTTCTAAGG + Intronic
964499231 3:157330428-157330450 ATGTGGAAGGCCCTCTCCTGGGG - Intronic
964687723 3:159415809-159415831 ATGTGCCAGGCACTGTACTAGGG - Intronic
964704609 3:159604496-159604518 CTGTGCCAGGCACTGTGCCAGGG + Intronic
965095415 3:164218855-164218877 ATGGGCCAGGCAGTGAGCTGTGG + Intergenic
965134161 3:164740248-164740270 ATGTGGGAGGCAGTGTACCGAGG + Intergenic
965488207 3:169304905-169304927 ACGTGCAAGGCACTGTGCTAGGG + Intronic
965509735 3:169555251-169555273 ATGGGCCAGGCACTCTGCTAAGG + Intronic
965611905 3:170553210-170553232 ATATGCTAGGCACTGTGCTTGGG - Intronic
965754902 3:172015813-172015835 CCGTGTCAAGCACTGTGCTGGGG - Intergenic
965798189 3:172463478-172463500 ATGTGTCAGGCACTGTTGAGAGG - Intergenic
966424708 3:179768659-179768681 ATGGGCCAGGCACAGTGCTGGGG - Intronic
966436222 3:179887093-179887115 ATGTGACAGGCACCGAGCAGGGG + Intronic
966669006 3:182506102-182506124 ATGTGAAAGGCTCTGTGGTGGGG - Intergenic
966883971 3:184364643-184364665 CTATGCTAGGCACTGTGCTGAGG - Intronic
966913826 3:184574130-184574152 ATGTGCCAGACACTGTTCTACGG - Intronic
967108395 3:186272050-186272072 ATGTGCCAGGCACCATGCTAGGG - Intronic
967473381 3:189888924-189888946 CTGTGCCAGGCACTGTGCTAGGG + Intronic
967883688 3:194318846-194318868 ATGTGGCAAGCAGTGTCCTGAGG + Intergenic
967888784 3:194350573-194350595 ATGTGCCAGGCGCTGTGTTAAGG - Intronic
967935071 3:194720720-194720742 CTGTGCCAGGCATTGTGCCGAGG - Intergenic
967935794 3:194726381-194726403 CTGTGCCAGACACTGTCCTGGGG - Intergenic
968132907 3:196202476-196202498 AAGTTCCAGTCACTGTGCTGGGG + Intronic
968495527 4:913365-913387 CTGTGGCAGGGGCTGTGCTGGGG - Intronic
968830325 4:2930313-2930335 ATGGGGAGGGCTCTGTGCTGGGG + Intergenic
968976633 4:3825488-3825510 ATGTGGCAGGCCCTGTTTTAGGG - Intergenic
968980441 4:3846129-3846151 ATGTGCCAAGCAGTGGGCTGGGG + Intergenic
969067481 4:4498467-4498489 ATGTGCCAGTCATTGGGCTGAGG - Intronic
969124442 4:4936001-4936023 AGGTGCCAGGCACTGTTCTATGG - Intergenic
969276736 4:6140866-6140888 ATACACCAGGCACTGTGCTGAGG - Intronic
969286842 4:6207897-6207919 GTGTGCCAGGTACTGGGCTGAGG + Intergenic
969482324 4:7453334-7453356 TGGGGTCAGGCACTGTGCTGGGG + Intronic
969582013 4:8071232-8071254 ATGGGGGAGGCACTGGGCTGGGG - Intronic
969722193 4:8898270-8898292 ATGTGCCTGGCTCTGTGCTCTGG - Intergenic
969987231 4:11225009-11225031 ATGTGCCAGGTACTATGCTAAGG - Intergenic
970393913 4:15645905-15645927 ATGAGGCAGGCACTGTTCTTTGG + Intronic
970425378 4:15940953-15940975 GCGTGCCAGGCACTGTGCTAAGG + Intergenic
970884721 4:20974960-20974982 GTGTGATAGGCACTGTGCTAAGG + Intronic
971347098 4:25821478-25821500 ATGTGGAAGGCACTGTGCAGAGG + Intronic
971479884 4:27104987-27105009 ATGTGGCAGGCACTGTACTTTGG + Intergenic
971750133 4:30636323-30636345 ATGTGCCAGGCACTATTCTGGGG + Intergenic
971953194 4:33381473-33381495 ATGTCCTAGACACTGTGCTGAGG - Intergenic
972293657 4:37715641-37715663 ATGTGCCAGGCACTTTTCTAAGG - Intergenic
972478015 4:39471057-39471079 ATGTGCCAGGGACTGTGGTAAGG - Intronic
972583563 4:40416471-40416493 ATGTGCCAGGCTTTGTGATGGGG - Intergenic
972630147 4:40835565-40835587 ATGCCCCAGGCACTGTGGTGAGG + Intronic
972967917 4:44535337-44535359 ATGTGGCAAACACTCTGCAGTGG - Intergenic
973107430 4:46357570-46357592 ATGTGCCAGGCACTGTTCTAGGG + Intronic
973177763 4:47228989-47229011 TATTGCCAGGCACTGTGCTGGGG + Intronic
973551998 4:52044849-52044871 ATGTGCCAGTTGCTGTGCTGAGG + Intergenic
973647876 4:52968200-52968222 GTGTGCCAGGCACTGTGCTAGGG + Intronic
973701795 4:53544755-53544777 ATGCGCCAGGCACTGTACTGGGG + Intronic
973705709 4:53577949-53577971 ATGCGCCAGGCACTGTGCTAGGG + Intronic
973797200 4:54439824-54439846 ATGTGCCAGACACTGTCCGGGGG - Intergenic
974724009 4:65776174-65776196 ATATGTCAGGCACTGTACTAAGG - Intergenic
974866614 4:67588940-67588962 ATGTGCCAGACACTGTACTAAGG + Intronic
974931705 4:68367463-68367485 ATGTGACAGGCATTCTGCTGGGG - Intergenic
975249285 4:72159457-72159479 ATGAGCCAGGCACTGTCCTATGG + Intergenic
975359075 4:73445625-73445647 ATGTGCCAGGCATTGTGCTATGG - Intronic
975459337 4:74631943-74631965 ATGTGCCAGGCATTGAGCTAGGG - Intergenic
976521990 4:86039406-86039428 CTGTGGCAGGCCCAGTGTTGGGG - Intronic
976665172 4:87582725-87582747 TTGTGGCAGACGCTGTGCTAAGG + Intergenic
976836042 4:89375081-89375103 ATGTGCCAGGCACTGGGCTAAGG - Intergenic
977422620 4:96821963-96821985 CAGTGGGTGGCACTGTGCTGAGG - Intergenic
977565657 4:98577878-98577900 ATGTGCCGGGCACTGTGCTGAGG - Intronic
977640510 4:99353320-99353342 CTGTGTCAGGCACTAAGCTGGGG + Intergenic
978103316 4:104870672-104870694 ATGTGGCAGGCATTTCTCTGAGG + Intergenic
978189091 4:105893028-105893050 TTGTGCCAGGCATTGTGCTGGGG + Intronic
978203799 4:106054731-106054753 GTGTGTCAGGCACTATGCTAGGG + Intronic
978338093 4:107691272-107691294 ACATGCCAGGCACTGTGCTGAGG + Intronic
978624015 4:110664169-110664191 ATGTGGGAGCCATTGTTCTGAGG + Intergenic
978955061 4:114602566-114602588 GTGTGCCAAGCACTGTGCTCTGG + Intronic
979471690 4:121106573-121106595 GTGGCACAGGCACTGTGCTGGGG + Intergenic
979592771 4:122499191-122499213 ATGTGCCAGGCACTGGGTTAGGG + Intergenic
979632816 4:122922550-122922572 ATGCGGCAGCCACTGAGCTGGGG - Exonic
980058485 4:128102858-128102880 AAGTAGCAGGCACAGTTCTGAGG - Intronic
980283764 4:130756149-130756171 CTGTGGCAGGCCCAGTGTTGAGG + Intergenic
980486573 4:133464462-133464484 ATGTTTCAGGCACTCTGCTAGGG - Intergenic
980760619 4:137228827-137228849 TTGTGTCAGACACTGAGCTGAGG - Intergenic
981322811 4:143412475-143412497 ATGTACTAGGCACTGTGCTATGG + Intronic
981473659 4:145165821-145165843 ATGTGCCAGGCGCTCTCCTGAGG - Intronic
981880486 4:149605360-149605382 ATGTGGGTGGGACTGTGATGTGG + Intergenic
982102502 4:151981723-151981745 ATGTGACAGATGCTGTGCTGGGG + Intergenic
982107807 4:152025923-152025945 ATGGGCCAGGCACAGTGATGGGG + Intergenic
982163233 4:152590918-152590940 ATGTGCCAGGTACTGTTCTAAGG + Intergenic
982236157 4:153252977-153252999 ATGTGACAGGCACTGCACTAAGG + Intronic
982376369 4:154695393-154695415 ATGTGCCAGGCACTCTGCCAGGG - Intronic
982388437 4:154837902-154837924 ATGGGCCAGGCAGTGAGCTGTGG + Intergenic
982565461 4:156980295-156980317 ATGTGCCAGGTACTGTCCTAAGG + Intergenic
982959966 4:161823627-161823649 GTGTGGCTGCAACTGTGCTGAGG + Intronic
982964986 4:161894990-161895012 ATGTCTCAGGTACTGTGCTTTGG + Intronic
983212497 4:164973141-164973163 ATATGTCAGGCACTATGCTAAGG + Intronic
983566849 4:169162493-169162515 TTCTGGAAAGCACTGTGCTGGGG + Intronic
984090821 4:175373199-175373221 GTATGCCAGGCACTGTGCTATGG - Intergenic
984240076 4:177207723-177207745 ATGACCCAGGCACTGTGATGGGG - Intergenic
984909850 4:184664277-184664299 AAGTGTCAGGCACTGTGCCCAGG + Intronic
984922595 4:184778685-184778707 ATATGTCAGACACTGTGTTGGGG - Intronic
984929477 4:184834104-184834126 AAGTGCCAGGCACTGTATTGGGG - Intergenic
985162462 4:187059047-187059069 ATGCGTCAGGCACTGGGATGGGG - Intergenic
986441190 5:7783289-7783311 ATGTGTCAGGCTCTGTGCCAGGG + Intronic
986535139 5:8778644-8778666 AGGTGCCAGGCACTGTCCAGGGG - Intergenic
986735930 5:10667350-10667372 ATGTGGCTGGCTCTATGCTAAGG + Intergenic
986999063 5:13640800-13640822 ATGTGTCAGCTACTCTGCTGAGG + Intergenic
987270580 5:16304361-16304383 ATGTGCCAGGCATTGTCATGGGG + Intergenic
987380972 5:17285719-17285741 ATGTGGCAGGCCAGGTGCAGGGG + Intergenic
987810821 5:22833325-22833347 ATGTGGCCAGCACTGTGTTCTGG - Intronic
988397029 5:30708499-30708521 ATGTGGGAAGCAGTGTCCTGAGG - Intergenic
988412047 5:30898975-30898997 ATGTGCCAGGCACTGTGGTAGGG + Intergenic
988514994 5:31896525-31896547 ATGTGCCAAGCCCTGTGCTAAGG + Intronic
988609128 5:32709320-32709342 GGTTGCCAGGCACTGTGCTGGGG - Intronic
988662501 5:33287308-33287330 ATGTGCAAGGCACTGTGGGGAGG + Intergenic
989003015 5:36780994-36781016 ATGTTCCAGTCACTGTGCTAGGG + Intergenic
989363658 5:40631952-40631974 ATGTGCCAGGCACTCTTCTGAGG + Intergenic
989989572 5:50745395-50745417 ATGTGTCTGGCATTGTCCTGGGG + Intronic
990086049 5:51979119-51979141 ATGTGTCAGGCACTATGATGAGG - Intergenic
990148743 5:52791628-52791650 ATGTGCAAGGCACTGTGCCAAGG + Intronic
990246197 5:53865555-53865577 ATGTGGCAAGTATTATGCTGTGG + Intergenic
990323285 5:54649701-54649723 GTGTGGCAGGCAAAGTGCAGGGG + Intergenic
990801725 5:59611608-59611630 GTGTACCAGGCACTGTGCTAGGG - Intronic
990827621 5:59919719-59919741 TTGTGGCAGGCACTGACCTGAGG - Intronic
990943587 5:61228289-61228311 ATGTGCCAGGCACTGTGGTAGGG - Intergenic
991599671 5:68340080-68340102 ATGTGTCAGCCTCTGTGTTGGGG - Intergenic
991639517 5:68738943-68738965 ATGTGTCTGGCACTGTGATGGGG - Intergenic
992000266 5:72429509-72429531 ACATGGCAGGCACTGTGTTGGGG - Intergenic
992062854 5:73073500-73073522 ATGTGCCAGGCACTTTGCTAGGG - Intronic
992074274 5:73176487-73176509 ATGTGGGAGGCAGTGTTATGAGG + Intergenic
992441288 5:76799865-76799887 ATGTGCCAGGTACTGTGTTACGG + Intergenic
992557295 5:77916181-77916203 CTGTGGCAGGCACCTTTCTGGGG - Intergenic
992584631 5:78223665-78223687 TGGTGTTAGGCACTGTGCTGAGG + Intronic
993082765 5:83322400-83322422 CTGTGCCAGGCAATATGCTGTGG + Intronic
993369100 5:87070404-87070426 ATGGAGCAGGACCTGTGCTGAGG - Intergenic
993767104 5:91873874-91873896 ATGTGCTAGCCACTGTGCTAAGG + Intergenic
993822342 5:92634004-92634026 ATGTTTCAGTCACTGTGTTGTGG - Intergenic
994174743 5:96699505-96699527 ATGTGACAGGAGCTGAGCTGTGG - Intronic
994505196 5:100634292-100634314 CTGTGTCAGCCACTGTGCTAAGG + Intergenic
994599279 5:101881677-101881699 ATGTGGAAGGCCATGTGCTGTGG + Intergenic
995038026 5:107557207-107557229 ACGTACCAGGCATTGTGCTGGGG - Intronic
995755245 5:115496475-115496497 ATGTGCCAGGCTCTCTTCTGGGG - Intergenic
995814625 5:116153562-116153584 ATGTGCCAGGTATTGTTCTGTGG + Intronic
996251834 5:121344698-121344720 ATATAGCAGGCACTGTGGTAGGG + Intergenic
997258750 5:132449270-132449292 ATATGCCAGGCACTGTCCTAGGG - Intronic
997276342 5:132595301-132595323 ATGTGCCAGGCACTGTTCTAAGG - Intronic
997401295 5:133605033-133605055 ATGTGCTAAGCATTGTGCTGAGG + Intronic
997467837 5:134100041-134100063 ATGTGGCTGGCCCTGTGCATAGG + Intergenic
997528954 5:134570573-134570595 AGGTGGCAGGCTCTGGGATGTGG - Intronic
997662080 5:135597041-135597063 ATATGCTAGGCACTATGCTGGGG - Intergenic
997696009 5:135861543-135861565 ATATGCCAGACATTGTGCTGAGG - Intronic
997735839 5:136212203-136212225 GTGTACCAGGCACTGTGCTCGGG - Intergenic
997857862 5:137389607-137389629 ATGAGGATGTCACTGTGCTGAGG - Intronic
997974817 5:138434783-138434805 ATGTGTCAGACATTGTGCTAAGG - Intronic
998190114 5:140016510-140016532 ACGTGCCAGGCATTGTGCTAGGG + Intronic
998216431 5:140241398-140241420 AAGTGCCAGGCCCTGTGCTGAGG - Intronic
998360942 5:141586315-141586337 ATGTACCAGGCCCTGTGCTAAGG + Intronic
999042690 5:148432595-148432617 GTGTGTCAGGCACTGTTCTAAGG - Intronic
999099058 5:149007172-149007194 AGATGTCAGGGACTGTGCTGGGG + Intronic
999099316 5:149009528-149009550 CTGTGCCAGGCACTGAGCTAGGG - Intronic
999112366 5:149133033-149133055 GTGTGCCAGGCACTGTGCAAAGG - Intergenic
999168645 5:149573691-149573713 TTGAAGCAGGCACTGTTCTGGGG - Intronic
999265856 5:150266485-150266507 CTGTGCCAAGCACTGTGCAGAGG + Intronic
999416021 5:151396735-151396757 ATGTGACAAGCACTGTGCTAAGG + Intergenic
999432680 5:151537641-151537663 ATGTGCCAAGCATTGTACTGGGG - Intronic
999479229 5:151930244-151930266 GTGTGTCTGACACTGTGCTGAGG + Intergenic
999584814 5:153078574-153078596 ATGTGCCAGGCACTCTGTTAGGG - Intergenic
999691021 5:154145932-154145954 ATGTGCCAGGCACTGAGATAGGG + Intronic
999736906 5:154519561-154519583 ATGTGGCAGGCATTGTGCCAGGG - Intergenic
999758848 5:154684807-154684829 ATGAGGCACAGACTGTGCTGGGG - Intergenic
999881691 5:155871641-155871663 GTGTAGCAGGCACTGTGTTATGG + Intronic
1000026382 5:157362638-157362660 ATAGGACAGGCACTGTTCTGGGG + Intronic
1000072423 5:157753002-157753024 ATGTGCCAGGTACTATACTGAGG + Intronic
1000262865 5:159605394-159605416 ATCTGTTAGACACTGTGCTGAGG - Intergenic
1000325592 5:160169720-160169742 ATGTGGCAGATACTGTGCTCAGG - Intergenic
1000365445 5:160486491-160486513 ATGTGCCAAGCACTGTGCTCAGG + Intergenic
1000378115 5:160602983-160603005 AAGTGTCAGGCACCGTGCTAGGG + Intronic
1001071829 5:168592433-168592455 ATGTAGCAGGCACTGAGCTAAGG + Intergenic
1001133074 5:169080344-169080366 ATGTGCCAAGCACTGTGCTAGGG + Intronic
1001210991 5:169810071-169810093 AAGAGCCAGGCATTGTGCTGGGG - Intronic
1001221825 5:169906967-169906989 ATGAGTCAGGCACTGTCCTAGGG + Intronic
1001314213 5:170631310-170631332 ATGTGCCAGGCATGGTGCTTGGG - Intronic
1001572738 5:172741190-172741212 ATGTGCCGGGCACTATTCTGAGG + Intergenic
1001781876 5:174375807-174375829 CTGTGCCAGACACTGTGCTAAGG + Intergenic
1001962539 5:175888423-175888445 ATGTGCCTGGCACTGTGCTAGGG - Intergenic
1002021738 5:176368006-176368028 ATGTGCCAGGCATTGTGCTGAGG + Intronic
1002085051 5:176769431-176769453 ATGTGCCAGGCACTCTTGTGGGG + Intergenic
1002088252 5:176789448-176789470 GTGTGGCAGCCACGGTGCTGGGG + Intergenic
1002156120 5:177281467-177281489 ATGTGCCAGGTATTGTGCTGGGG + Intronic
1002604373 5:180373465-180373487 ATGGGGCAGGCTCTGTGGTCAGG + Intergenic
1002792736 6:447632-447654 GTGAGGCGAGCACTGTGCTGAGG + Intergenic
1003050093 6:2772431-2772453 GTGTGCCAGGCACTGTGCTGGGG - Intronic
1003126918 6:3363049-3363071 AAGTTGCAGGCAGTGGGCTGCGG - Intronic
1003273860 6:4631515-4631537 ATGTGCCAGACACTATGCTGAGG + Intergenic
1003513152 6:6798356-6798378 ATGTGCCAGGTTCTGTGCTTGGG + Intergenic
1003515972 6:6818959-6818981 GGGTGCCAGGCACTGTTCTGAGG - Intergenic
1003633087 6:7806152-7806174 ATGGGGCAAGCACTGCTCTGGGG + Intronic
1004131914 6:12928670-12928692 ATGTGGCAGGCATCGTGGTAGGG + Intronic
1004203020 6:13567302-13567324 GTGTTGCAGGCAATGTTCTGTGG - Intergenic
1004279758 6:14270702-14270724 ATGTGTCAGGCACTGTCCTAGGG + Intergenic
1004323364 6:14650972-14650994 ATGTGCCAGGCATTGTGCTAAGG + Intergenic
1004592435 6:17066472-17066494 ATGTCCCAGGCACTGCACTGAGG + Intergenic
1005186190 6:23165388-23165410 ATGTGCCTGGCAGTGAGCTGTGG - Intergenic
1005219418 6:23569954-23569976 ATGTGGCAGACATTGTGCTGGGG + Intergenic
1005348820 6:24914419-24914441 AGGTGCCAGGCACTCTGCTAAGG + Intronic
1006375040 6:33667367-33667389 CTGTGCCAGGCACTGTTTTGGGG + Intronic
1006466504 6:34197732-34197754 TTGTGCCAGGCCCTCTGCTGGGG + Intergenic
1006520439 6:34568251-34568273 ATCTGCCAGGCACTGCACTGGGG - Intergenic
1006525488 6:34601226-34601248 ATGCGCCAGGCACTGTGCTGAGG - Intronic
1006572539 6:35017643-35017665 TTGTGGCAGGCGCCCTGCTGGGG - Exonic
1006643326 6:35499502-35499524 ATGTGCCAGGCACTGTTCTCAGG - Intronic
1006749165 6:36365846-36365868 ATGTGCCAGGCCTTGTGCTAAGG - Intronic
1006749810 6:36369724-36369746 GTATACCAGGCACTGTGCTGAGG - Intronic
1006903778 6:37519561-37519583 ATGTGCCAGGTAATGTGCTATGG - Intergenic
1006964286 6:37966381-37966403 AAGTGCCAGGCATTGTGCTAAGG + Intronic
1006971730 6:38052536-38052558 ATGTGGCAGGCATTTTGCTAGGG + Intronic
1006979579 6:38136249-38136271 GTGTCACAGGCACTGTACTGGGG - Intronic
1007122732 6:39396735-39396757 ATGTGCCAGGCACTGTGCTGGGG - Intronic
1007164937 6:39822412-39822434 TTGTGCCAGGCTTTGTGCTGGGG + Intronic
1007481232 6:42151456-42151478 CTGTGTCAGGCTCTGTGCTCAGG + Intergenic
1007493419 6:42242279-42242301 ATGTGCCAGGCATTGTGTTAGGG - Intronic
1007619147 6:43201134-43201156 TTGTGTCAGGCACTGTGCAAGGG + Intronic
1007675850 6:43594392-43594414 ATGCGCAAGCCACTGTGCTGAGG + Intronic
1007999122 6:46340019-46340041 TTATGGCAGGCAATGTGCTAAGG - Intronic
1008013649 6:46493177-46493199 GTGTGCCAGGCACTGTGCTTAGG - Intergenic
1008051448 6:46903854-46903876 CTGTGCTAGTCACTGTGCTGTGG + Intronic
1008055847 6:46945461-46945483 ATGTGCCAGGTACTGTGCTAGGG + Intronic
1008088416 6:47268284-47268306 ATGTTCCAGGCACTGTTCTATGG - Intronic
1008600835 6:53092304-53092326 ACCTGGGAGGCACTGTTCTGAGG - Intronic
1008728243 6:54447802-54447824 ATGTTTCAGACACTGTGCTAGGG + Intergenic
1008794681 6:55288525-55288547 ATGTGCCAGGCATTGTTCTAGGG - Intergenic
1008985170 6:57533793-57533815 ATGTAGCAGCCATTGTGCTGTGG + Intronic
1008987120 6:57558010-57558032 TTTTGGAAGGCACTGTGGTGTGG + Intronic
1009173206 6:60426748-60426770 ATGTAGCAGCCATTGTGCTGTGG + Intergenic
1009175078 6:60450578-60450600 TTTTGGAAGGCACTGTGGTGTGG + Intergenic
1009857257 6:69280718-69280740 GTGTGCCAGGCATTGTGCTGAGG - Intronic
1010626046 6:78137421-78137443 ATGGGCCAGGCAGTGAGCTGTGG - Intergenic
1010643229 6:78356157-78356179 AAGTGCCAGGTACAGTGCTGGGG + Intergenic
1011125891 6:84007223-84007245 ATGTGGAAGTCACTGTGATGTGG + Intergenic
1011245576 6:85318049-85318071 ATGTGGGAAGCAGTGTCCTGAGG - Intergenic
1011335105 6:86251539-86251561 ATGAGCCAGGCCCTGTGTTGGGG + Intergenic
1011411852 6:87074445-87074467 ATGGAGCAGGCACTGGGGTGGGG + Intergenic
1011471682 6:87714314-87714336 GTGTGCCAGGCACTGTTCTGAGG + Intergenic
1011695623 6:89910083-89910105 ATGTGTCAGCCACTGGTCTGTGG - Intergenic
1011712622 6:90070026-90070048 TTGTGGCAGTTACTCTGCTGGGG + Intronic
1012200576 6:96401430-96401452 ATGTGCCAGACACTGTGCTAAGG - Intergenic
1012245593 6:96923007-96923029 ATGTGGCAGACATTGTGCTAGGG + Intergenic
1012588301 6:100949306-100949328 ATGGGCCAGGCAGTGAGCTGTGG - Intergenic
1012601679 6:101106124-101106146 ATGTCTCAGTCACTGTGCTAGGG + Intergenic
1012864874 6:104606845-104606867 ATGTGCAAGGCACTGTCCTGTGG - Intergenic
1012986852 6:105884786-105884808 ATGTGGCAGGCACTTTGAGGAGG - Intergenic
1012987732 6:105892930-105892952 ATGTCCCAAGCACTGTGCTGGGG - Intergenic
1013054827 6:106573542-106573564 ATGTGCCAGGCACTGTTTTAGGG + Intronic
1013122264 6:107151314-107151336 ATGTCCCAGGCACTCTGCTAGGG - Intergenic
1013157739 6:107509440-107509462 GTGAGGCAGGCACTATGCTAAGG - Intronic
1013604457 6:111734862-111734884 ATGTGACAGGCACTGTGCTAAGG + Intronic
1013647041 6:112155190-112155212 ATGTGGCAAGCACTTTGGTGGGG - Intronic
1013672135 6:112416198-112416220 ATGTGACAGGCACTGTTCGAAGG - Intergenic
1014510292 6:122312527-122312549 ATGTGCCAGTCACTGTGTTTAGG - Intergenic
1014937804 6:127404429-127404451 ATGTGTCAGGCACTGTTCTAAGG - Intergenic
1015132399 6:129828140-129828162 ATGTGCCAGGCACGGCACTGAGG + Intergenic
1015309999 6:131756444-131756466 ATGTTACAGACACTGTTCTGGGG + Intergenic
1015608266 6:134984323-134984345 ATGTGCCAGGCACTGGGCTAGGG + Intronic
1015826174 6:137314234-137314256 ATGTGTCTGGCACTGTTCTAAGG - Intergenic
1015870342 6:137769840-137769862 ATATGCCAGGCTCTGTGCTGAGG - Intergenic
1015941397 6:138456020-138456042 CTGTGCCAGGCACTGTGCTAAGG + Intronic
1016349095 6:143147889-143147911 GTGGGCCAGGCACTGTGCTAAGG + Intronic
1016358314 6:143241585-143241607 GTGTGTCAGGCACTGTTCTAAGG + Intronic
1016651244 6:146463464-146463486 ATGTGCCAGACACTGTGCTGAGG - Intergenic
1016741299 6:147532089-147532111 ATGTGCCAGTCACTGTTCTAGGG - Intronic
1016896839 6:149061811-149061833 ATGTGCCAAGGACTTTGCTGTGG - Intronic
1016969040 6:149745568-149745590 ATGTGACAGATACTGTGCAGGGG - Intronic
1017693692 6:156992760-156992782 GGGTTGCAGGCACTGTGCGGTGG + Intronic
1017892129 6:158647417-158647439 TTGTGTCAGGCTCTGAGCTGGGG + Intergenic
1018569127 6:165188261-165188283 ATGTGCCAGGCACTGGGCTGGGG + Intergenic
1019664701 7:2245997-2246019 GTGCGACAGGCTCTGTGCTGGGG + Intronic
1020086554 7:5313591-5313613 GTGTGGCAGGCATGGTGATGAGG + Exonic
1020263591 7:6545697-6545719 ATGTGCCAGGCGCTGTGCTTGGG - Intronic
1021803439 7:24331249-24331271 GTGTGGCAGGCACTATGCAAGGG + Intergenic
1021809293 7:24387607-24387629 ATATGGCAGGAATTATGCTGTGG + Intergenic
1022038532 7:26557334-26557356 GTGAGGCAGACACTGTGCTGGGG + Intergenic
1022117494 7:27275087-27275109 ATGGGTCAGGTACTGGGCTGAGG + Intergenic
1022186881 7:27978221-27978243 ATATGACAGACACTGTTCTGGGG + Intronic
1022226866 7:28372006-28372028 GTGTGCCAGGCTCTGTTCTGGGG + Intronic
1022274572 7:28842607-28842629 ATGCTGCAGGCACTGAACTGGGG - Intergenic
1022289248 7:28985422-28985444 GTGTGCCTGGCACTCTGCTGGGG + Intergenic
1022348933 7:29548055-29548077 ATGTGTCAGGTACTGTGCTAGGG + Intergenic
1022828523 7:34041300-34041322 TTGTGCCAGGTACTGTGCTTAGG - Intronic
1022959491 7:35413001-35413023 ATGAGGTAAGCACTGTGATGAGG + Intergenic
1023474372 7:40561508-40561530 ATGTGCCAGGCATTGTGCTTGGG + Intronic
1023576639 7:41635293-41635315 CTGTTGCAGGCACTACGCTGAGG - Intergenic
1023628053 7:42136454-42136476 ATGTGCCAAGCACTGGGCTGAGG - Intronic
1024222168 7:47297489-47297511 AGGTGCCGGGCACTGTCCTGTGG + Intronic
1024633832 7:51270419-51270441 ACGTGCCAGGCACTGTTCTCAGG + Intronic
1025008660 7:55376828-55376850 ATGTGCCAGGCACTGTTATTGGG - Intronic
1025207759 7:57003547-57003569 GTGTGGCAGGCATGGTGATGAGG - Intergenic
1025298757 7:57799123-57799145 AGGTGGCAGGCACTGCGCCTGGG - Intergenic
1025664177 7:63573325-63573347 GTGTGGCAGGCATGGTGATGAGG + Intergenic
1025721836 7:64023692-64023714 ATGTGGCAAACACTGTGATTTGG - Intergenic
1025749386 7:64280223-64280245 ATGTGGCAAACACTGTGATCTGG - Intergenic
1025871597 7:65439355-65439377 ATGTACCAAGCACTGTGCTAGGG - Intergenic
1026145957 7:67746963-67746985 ATGTGACAGGTATTGTGCTTAGG + Intergenic
1026256744 7:68718795-68718817 ATGTGCCAGGCCCTATGTTGAGG - Intergenic
1026279706 7:68911321-68911343 ATGTGGCAGGCTGGGTGCAGTGG + Intergenic
1026291264 7:69008177-69008199 ATGTGTCAGGCTCTGTGCCTAGG + Intergenic
1026594685 7:71724552-71724574 ATGTGCCAGGCACTATGCAAAGG + Intergenic
1026630191 7:72031378-72031400 ATGTGCCAGGCACTGAGCTCAGG + Intronic
1026729543 7:72899306-72899328 ATGTGTGAGGAAATGTGCTGCGG - Intronic
1026846544 7:73701982-73702004 CCTTGGCAGGCAGTGTGCTGGGG - Intronic
1027057860 7:75062610-75062632 ATGAGCCAGGCACTATTCTGGGG - Intronic
1027114453 7:75467803-75467825 ATGTGTGAGGAACTGTGCTAGGG + Intronic
1027429574 7:78096404-78096426 ATGTGTCAGGCACTGTGCTAAGG - Intronic
1027448459 7:78301996-78302018 ATGTGCCAGACCCTGTGCTCAGG - Intronic
1027603255 7:80266538-80266560 ATGTGTCAGGAACTGTGATAGGG + Intergenic
1028056582 7:86252659-86252681 ATGTGGCCAGCACAGTGCTGGGG - Intergenic
1028056591 7:86252703-86252725 TTGTGGGAGGCAGGGTGCTGGGG - Intergenic
1028092865 7:86725249-86725271 ATGTGTCAGACACTGTGCTTAGG - Intronic
1028093522 7:86732577-86732599 ATGTGGCAGGCAATGTTCCAAGG + Intronic
1028600811 7:92598446-92598468 ATGTGCCAGGCACTGTCCTTAGG - Intergenic
1028995320 7:97093666-97093688 ATGTACCAGGCACTGTGCTCAGG - Intergenic
1029380441 7:100210964-100210986 CTGTCGCAGGCCCTGGGCTGTGG + Intronic
1029558571 7:101287303-101287325 AAGTGGGGAGCACTGTGCTGTGG + Intergenic
1030023262 7:105296752-105296774 ATGTGCCAGGTACTGTTGTGGGG + Intronic
1030084829 7:105807146-105807168 ATGTAGCTGGCATTGTGGTGGGG - Intronic
1030218941 7:107077271-107077293 GTGTGTCAGGTACAGTGCTGGGG + Intronic
1030323635 7:108196154-108196176 TTGTGCCAGACACTGTGCTGGGG - Intronic
1030653058 7:112136505-112136527 ATGTGTCAAGCCCTTTGCTGGGG + Intronic
1030714399 7:112790860-112790882 ATGTGTCAGGCACTATGCTAAGG - Intergenic
1030876199 7:114816524-114816546 ATGTGCCAGGCACTGTTTTAGGG - Intergenic
1031354028 7:120768295-120768317 ATGTGGCAGAAACAGTACTGTGG + Intergenic
1031652057 7:124303417-124303439 ATGTGGAAGCCACTGAGCCGTGG - Intergenic
1032162394 7:129520837-129520859 ATCTGGCAGGTGCTGGGCTGAGG + Intergenic
1032497402 7:132373014-132373036 ATGTGCCAGGCACTTTTCTGAGG + Intronic
1032563703 7:132918398-132918420 ATGTGTCACGCACTGTGCCAGGG - Intronic
1032791088 7:135242975-135242997 GTGTGCCAGGAACTGTGCTTGGG + Intronic
1032822304 7:135535502-135535524 ATGTGACAGGCACTGTTCGAAGG - Intergenic
1033144529 7:138859993-138860015 GTGTCGCAGGCACTCTGCTTAGG - Intronic
1033461854 7:141553606-141553628 ATATGGTAGGCTCTGTGCTGGGG - Intronic
1033566167 7:142580313-142580335 ATGCAGAAGACACTGTGCTGTGG + Intergenic
1033947544 7:146740599-146740621 TTGTGGCAGGCATAGTTCTGGGG + Intronic
1034288866 7:149911434-149911456 ATGTGCCAGTCACTGTGCCGGGG - Intergenic
1034662210 7:152781432-152781454 ATGTGCCAGGCACTGTGCCGGGG + Intronic
1034935090 7:155193887-155193909 TGGGGGCAGACACTGTGCTGTGG + Intergenic
1035134486 7:156687763-156687785 ATGTGCCAGGCGCTATGCTAAGG + Intronic
1035331927 7:158102082-158102104 ATGTGGCAGGCACTGAGCCCAGG + Intronic
1035491081 7:159279126-159279148 ATGTGACAGGCAGTGTTCTAAGG - Intergenic
1035737228 8:1897799-1897821 ACGTGGCAGCCACCGAGCTGAGG - Intronic
1035761814 8:2074036-2074058 TTATGTCAGGCAGTGTGCTGGGG + Intronic
1036086080 8:5614583-5614605 ATGTGGCAGGCAGTGTTCAGAGG - Intergenic
1036163198 8:6407280-6407302 GTGTGCCAGGCGCTGTGCTTAGG + Intronic
1036442469 8:8793635-8793657 GAGTGGGAGGGACTGTGCTGAGG + Intronic
1036635810 8:10548836-10548858 GTGTGTCAGGCACTGTGCTGGGG + Intronic
1037127832 8:15371829-15371851 ATGAAGCAGGCACTGTGCGCTGG - Intergenic
1037506869 8:19539452-19539474 ATATGCCAGGCCCTGTGCTGAGG - Intronic
1037630182 8:20648874-20648896 ATGTGCCAGGCATTGTGCTATGG - Intergenic
1037736954 8:21575408-21575430 ATGTGGCAGCCCCTGTGCCTGGG + Intergenic
1037827935 8:22170377-22170399 GTGTTGCATGCTCTGTGCTGGGG + Intronic
1037864610 8:22433273-22433295 GTGTGCCAGGCACTGTGTTAAGG - Intronic
1037938190 8:22929128-22929150 ATGTGCCAGGCACCTTACTGAGG - Intronic
1038246788 8:25865563-25865585 ATATGCCAAGCACCGTGCTGAGG - Intronic
1038358541 8:26854511-26854533 ATGTGGCAGCCAGTGTGGTGGGG + Intronic
1038358581 8:26854785-26854807 ATCTGAAAGGCCCTGTGCTGTGG + Intronic
1038490239 8:27965478-27965500 ATGCAGCGGGCACTGTGATGGGG - Intronic
1038970979 8:32635219-32635241 CTGTGACAGGCATTGTGCTGGGG - Intronic
1039007918 8:33061358-33061380 CTGTGGCATGCATTGTTCTGAGG - Intergenic
1039432645 8:37537252-37537274 CTATGGCAGGCACTGCACTGGGG + Intergenic
1039437233 8:37568038-37568060 GCATGCCAGGCACTGTGCTGGGG + Intergenic
1039835562 8:41253722-41253744 ATGTGCAAGGCACTGTACTGAGG + Intergenic
1039889459 8:41674250-41674272 ACATGCCAGGCACTGTGCTATGG + Intronic
1039969166 8:42306957-42306979 CTGTGTCAGGCACTGTGCTCAGG + Intronic
1040359857 8:46654813-46654835 ATGGGCCAGGCAGTGAGCTGTGG - Intergenic
1041094213 8:54333133-54333155 AGAAGTCAGGCACTGTGCTGCGG - Intergenic
1041239010 8:55832723-55832745 ATGTGTCAGCCACTGTGCCCGGG - Intergenic
1041361732 8:57061828-57061850 GTGTGCCAGGCACTGTGTTAAGG - Intergenic
1041390459 8:57343122-57343144 ATGTGCCAGGCCCTGTGCTGGGG - Intergenic
1041555895 8:59155176-59155198 ATGTGCCAGGCATTGTGCATGGG - Intergenic
1041899389 8:62964336-62964358 ATGTAGTAGGTACTGTGTTGAGG + Intronic
1042183664 8:66115855-66115877 ATGTGCCAGGCACTGTACTAAGG - Intergenic
1042351950 8:67786201-67786223 ATGTGACAGGAAGTGAGCTGGGG + Intergenic
1042724885 8:71862775-71862797 ATGTGCCAGGCACTATCCTAGGG - Intronic
1042769985 8:72369020-72369042 ATGTGCCAGGCACTGTTCTAAGG - Intergenic
1042865963 8:73356914-73356936 ATGTGGCAGGGATTGTGCAGGGG - Intergenic
1042977578 8:74487104-74487126 ATGTGCCAGGCACTGTGCCATGG - Intronic
1043167073 8:76916397-76916419 ACGTGCCAGGCACTGAGCTATGG + Intergenic
1043340824 8:79236908-79236930 CTGTGCCTGGCACTGTGCTAGGG + Intergenic
1043400750 8:79881825-79881847 ATGTGGCAGACATTGTACTGTGG - Intergenic
1043874355 8:85467431-85467453 ATGCGCCAGGCACTGGGCTAGGG - Intronic
1043969956 8:86517819-86517841 GTGTGTCAGGCACTGTTCTAAGG - Intronic
1043989872 8:86739419-86739441 ATGTGCCAGGCACTGTTCCATGG - Intronic
1044379693 8:91520071-91520093 ACATTTCAGGCACTGTGCTGGGG - Intergenic
1044545103 8:93450518-93450540 ATGTGGCAAACACTGTGCTAGGG + Intergenic
1044608740 8:94071431-94071453 AAGGGCCAGGCACTGTGCTAAGG + Intergenic
1045074420 8:98547432-98547454 ATATGTGAGGCACAGTGCTGGGG - Intronic
1045456826 8:102388364-102388386 GTGTGTCAGGCATTGTACTGGGG - Intronic
1045471684 8:102518319-102518341 GTGTGCCAAGCACTGTGCTAAGG + Intergenic
1045664933 8:104474113-104474135 ATATAGCAAGCACTGTGCTGTGG - Intergenic
1045665901 8:104484240-104484262 ATGTATTAGGTACTGTGCTGGGG + Intergenic
1045955651 8:107902694-107902716 AAGTGCCAGTCACTGTGCTAGGG - Intronic
1046336067 8:112788659-112788681 ATGTGCCAGGCATTGTGAAGGGG - Intronic
1046479221 8:114792871-114792893 ATGTGCCAGGGACTGTCCTTGGG - Intergenic
1046763058 8:118041530-118041552 ATGGGCCAGACACTGTGCTAAGG - Intronic
1046779056 8:118195761-118195783 ATGTGCCAAGCATTGTGCTTGGG - Intronic
1046913821 8:119658793-119658815 GTGTGCCAGGGACAGTGCTGGGG - Intronic
1046981093 8:120337046-120337068 ATGTGTTAGACACTGAGCTGGGG - Intronic
1047418037 8:124681852-124681874 ATGTGTCAGGCACTATGCTCTGG - Intronic
1047772884 8:128044581-128044603 GTGTTGCAGGCACTGTGCTGAGG - Intergenic
1047784721 8:128142602-128142624 TTGTGCCAGGCACTGTGCTTAGG - Intergenic
1047819837 8:128506756-128506778 CTGTGCCAAGCACTATGCTGGGG - Intergenic
1047825722 8:128572626-128572648 ATTTGCCAGGCACTATACTGGGG + Intergenic
1047986066 8:130234977-130234999 ATGTGGCAGGCAGTGTATTAGGG + Intronic
1048006865 8:130426654-130426676 ATGGGGCAGGCCCTGTGCCTAGG + Intronic
1048031425 8:130636722-130636744 ATGTGCCAGGCCCTGTTCTTGGG - Intergenic
1048062255 8:130932433-130932455 CTGTGGCAGGCCCAGTGTTGGGG + Intronic
1048179155 8:132179539-132179561 AAGTTGTAGGCACTGTGCTTTGG + Intronic
1048242974 8:132762564-132762586 ATGTACCAGGCACTGTTCTAAGG + Intergenic
1048284518 8:133131317-133131339 ATTTGCCAGGTACTGTGCTGCGG + Intronic
1048366825 8:133745601-133745623 CTGTGCCAGGCACCATGCTGAGG - Intergenic
1048384053 8:133894657-133894679 ATGTGCCAGGCAGTGTTATGAGG - Intergenic
1048406430 8:134127261-134127283 ATATAGCAGGCATTGTGCTGGGG + Intergenic
1048426206 8:134326159-134326181 ATGTGCCAGGCACTGTATTTTGG - Intergenic
1048502723 8:134993519-134993541 ACGTGCCAGGCACTGTTCTATGG + Intergenic
1048643428 8:136389828-136389850 ATGTGTCATGCACAGTGCTAGGG + Intergenic
1048705741 8:137151121-137151143 ATGTGCCAGAAACTGTGCTAAGG - Intergenic
1049018390 8:139937538-139937560 AGGTGGCAGGGCCGGTGCTGGGG + Intronic
1049095029 8:140543689-140543711 ATGTGCCAGGCACCGTGCCAGGG + Intronic
1049245558 8:141560443-141560465 ACGTGCCAGGCTCTGTGCTGAGG + Intergenic
1049445143 8:142626671-142626693 AAGTGGCAAGCACTGTGGTGTGG - Intergenic
1049846740 8:144806144-144806166 ATGTGCCAGGGACTGAGCTCAGG + Intronic
1049994131 9:1018577-1018599 ATGTGACAGGCATCGTGCTAGGG + Intergenic
1050267190 9:3903616-3903638 ATATGCCAGGCACTGTTCTAGGG + Intronic
1050284449 9:4086728-4086750 ATGTGCCGGGCACTGTGCACAGG + Intronic
1050294736 9:4194345-4194367 AAGTGGCAGGCCAGGTGCTGTGG - Intronic
1050567543 9:6901813-6901835 ATTTGGTGGGCCCTGTGCTGTGG + Intronic
1050684768 9:8155574-8155596 ATGTGCCAGGCCCTGTGCTGGGG - Intergenic
1050740504 9:8814063-8814085 ATGTGTCAGGTGCTGTGCTCTGG - Intronic
1050880186 9:10689433-10689455 ATATGCCAGGCATTGTTCTGAGG - Intergenic
1050925429 9:11257678-11257700 ATGGGCCAGGCACTGAGCTGTGG + Intergenic
1050937733 9:11419897-11419919 ATGTGTCAGGAACCGTGCTAAGG - Intergenic
1051070139 9:13156122-13156144 ATGTGCCAGGCACTCTGCTAAGG + Intronic
1051437116 9:17044625-17044647 CTGCGGCAGGCACTGTTCTAAGG + Intergenic
1051531942 9:18113715-18113737 ATATGACAGTCACTGTTCTGAGG + Intergenic
1051560419 9:18435349-18435371 ATGTGCCAGACACTGCTCTGGGG + Intergenic
1052168694 9:25366222-25366244 ATGTGCCAGGTGCTGTGCTAAGG + Intergenic
1052234025 9:26188736-26188758 ATGTGGCAGGCCCAGTGCTGGGG - Intergenic
1052287771 9:26806367-26806389 GTGTGTCAGGCACTGTGCCAAGG - Intergenic
1052750836 9:32488335-32488357 ATGTGTCAGGCTCTGTGCTAAGG - Intronic
1052787259 9:32840469-32840491 ATATGTCAGGCATTGTGCTAAGG - Intergenic
1053114825 9:35490917-35490939 ATGTGCCAGGCACCGTGCTGGGG - Intronic
1053794842 9:41716905-41716927 AGGTGGCAGGCACTGCGCTTGGG + Intergenic
1054150334 9:61597913-61597935 AGGTGGCAGGCACTGCGCTTGGG - Intergenic
1054183252 9:61928963-61928985 AGGTGGCAGGCACTGCGCTTGGG + Intergenic
1054470105 9:65529019-65529041 AGGTGGCAGGCACTGCGCTTGGG - Intergenic
1054655254 9:67659511-67659533 AGGTGGCAGGCACTGCGCTTGGG - Intergenic
1055218271 9:73894900-73894922 ATATTCCAGGCACTGTACTGGGG - Intergenic
1055551034 9:77432506-77432528 ATGCGCCAGGCACTGTGGTAAGG - Intronic
1055767044 9:79674507-79674529 ACGTGGCAGGCCCCTTGCTGGGG - Intronic
1055955561 9:81770145-81770167 ATGTACCAGGTACTGTGCTAAGG + Intergenic
1056540275 9:87565058-87565080 TGCTGGCAGGCAGTGTGCTGTGG + Intronic
1056991743 9:91419673-91419695 ATGTGCCAGGCACAGTGTTGAGG - Intronic
1057311607 9:93946560-93946582 GCGTGCCAGACACTGTGCTGGGG - Intergenic
1057723521 9:97552517-97552539 ATGTGCCAGGCACCTTTCTGGGG - Intronic
1057731545 9:97613360-97613382 ATGTGGCAGGCACTGTTCTAGGG - Intronic
1057985725 9:99711734-99711756 ATGTGGCTGGTAATGTGGTGGGG + Intergenic
1058088264 9:100774646-100774668 ATGTGCCAGGTACAGTGCTTAGG + Intergenic
1058422659 9:104847415-104847437 ATGTGCCAGGCACTGTGCGAGGG - Intronic
1058486262 9:105446050-105446072 ATGTGGCAGACTCTGAGCTGGGG + Intergenic
1058652796 9:107192538-107192560 ATGTGCTAGGCACTGTTCTAAGG + Intergenic
1058787797 9:108407344-108407366 ATGTGCCAGGGACTCTGCTAAGG + Intergenic
1059143615 9:111877218-111877240 ATGTGATAGGCACTGTTTTGAGG - Intergenic
1059217217 9:112575231-112575253 ACCTGGTATGCACTGTGCTGTGG - Exonic
1059315581 9:113423032-113423054 ATGTGTCAGGCACAGGGCTAGGG - Intronic
1059463407 9:114449854-114449876 ATGTGCCAGGCACTGGGCTAGGG + Intronic
1059664753 9:116436106-116436128 ATGTGTCAGGCCGTGTGCTGGGG - Intronic
1059723254 9:116982340-116982362 ATGTGCCAAAGACTGTGCTGAGG - Intronic
1059854102 9:118376292-118376314 ATTTGCCAGGCACTGTGCCAAGG - Intergenic
1059948670 9:119439221-119439243 ATGTGCCAGGCACAGTTCTAGGG - Intergenic
1059949931 9:119451901-119451923 ATATAGCAGGCACTGTTCTAGGG + Intergenic
1059954456 9:119501163-119501185 CTTTGCCAGGCACTGTGCTATGG - Intronic
1059982686 9:119790534-119790556 ATGTGTCAGGCAAGGCGCTGAGG - Intergenic
1060032259 9:120225226-120225248 TTGTGTCAAGCACTTTGCTGAGG - Intergenic
1060050062 9:120372104-120372126 CTGAGGCAGGGGCTGTGCTGAGG + Intergenic
1060161984 9:121372263-121372285 ATGTGGCAGGGAGTGTGCTAAGG + Intergenic
1060290052 9:122293727-122293749 ATGTGCCAGGCTCTGTGCTGGGG + Intronic
1060390507 9:123272682-123272704 ATGTATCAGGCCCTGTGCAGAGG - Intergenic
1060433157 9:123568384-123568406 GTGTGCCAGGCACTGTGCTAGGG - Intronic
1060474990 9:123980013-123980035 ATGTGCCAGGCCCTGAGCTAGGG - Intergenic
1060520118 9:124289574-124289596 ATGAGGAAGGCAGTGTGCAGGGG + Intronic
1060521625 9:124297322-124297344 ATGTGCCAGGCTCTGTGCTAAGG + Intronic
1060587271 9:124794466-124794488 ACGTGCCAGGCGCTGTGCTAGGG - Intronic
1060730844 9:126036059-126036081 ATGTGCCAAGCACTGTGCTAAGG + Intergenic
1060764345 9:126282757-126282779 AGTTGGCTGGGACTGTGCTGGGG + Intergenic
1060824611 9:126680817-126680839 ATGTGCCAGGCACTGTGCGAAGG - Intronic
1060827689 9:126696031-126696053 AGGGGGCAGGGGCTGTGCTGGGG - Intronic
1060925522 9:127452602-127452624 ATGTGCCAGGTACTGTACTAGGG + Intronic
1061017947 9:127993516-127993538 ATGTGCCAGGCCCTGGGTTGGGG - Intergenic
1061192095 9:129087970-129087992 CTGTGCCAGGCTGTGTGCTGGGG + Intronic
1061203275 9:129149212-129149234 ATGTGCCAGGCCCTGAGCTGAGG - Intergenic
1061218711 9:129236701-129236723 GTGTCTCAGGAACTGTGCTGGGG - Intergenic
1061281628 9:129601011-129601033 CTGTGGCAGGCTCTGTGTTAGGG + Intergenic
1061282126 9:129603390-129603412 CTATTTCAGGCACTGTGCTGTGG - Intergenic
1061389859 9:130311443-130311465 GTGTGCCAGGCCCTGTGCTGGGG + Intronic
1061527382 9:131177890-131177912 ATGTGCCAGGCTCTGTGTTAGGG - Intronic
1061707019 9:132461114-132461136 TTGTGCCAGGCACTGTGCGGAGG - Intronic
1061820996 9:133227096-133227118 ATCTGGCAGGAAATGTGTTGGGG - Intergenic
1062684096 9:137801113-137801135 ATCGGCCCGGCACTGTGCTGTGG + Intronic
1186097753 X:6120480-6120502 ATGAGTCAGGCATTGTGCTAGGG + Intronic
1186273961 X:7919983-7920005 GTGTGGCAGGTACTGGGCTGCGG + Intronic
1186831562 X:13395570-13395592 ATGTGCCAGGCACTGTAATCAGG + Intergenic
1186873723 X:13797181-13797203 ATGTGCAAGCCACTGTGGTGGGG + Intronic
1187144945 X:16628942-16628964 CTGTGCCAGGCACTGTTCTAAGG + Intronic
1187238738 X:17493523-17493545 ATATGCCAGGCACTGTGCTGGGG - Intronic
1187300036 X:18039509-18039531 ATATGGCAGATATTGTGCTGAGG - Intergenic
1187604110 X:20864403-20864425 ATGTAGCAGGCATTGTTCTAGGG + Intergenic
1187667590 X:21630417-21630439 ATGTGTCAGGCACTATTCTAAGG + Intronic
1187730989 X:22254436-22254458 ATGTCCTAGGCACTCTGCTGGGG + Intergenic
1187938777 X:24361952-24361974 ATCTGTCAGCCACTGGGCTGCGG - Intergenic
1187963601 X:24589023-24589045 ATGTGCCCGGCACTGTGCTAAGG - Intronic
1188512785 X:30954640-30954662 ATTTGCCAGACACTGTGCTAAGG - Intronic
1188684490 X:33053166-33053188 AAGTGTCAGGCATTGTGCTGGGG + Intronic
1189164376 X:38846049-38846071 ATTTACCAGCCACTGTGCTGTGG + Intergenic
1189316101 X:40057650-40057672 CTGTGCCAGGCACTGAGCTAAGG - Intronic
1189393473 X:40598458-40598480 GAGTGGCAGTCACTGTGCTAGGG + Intronic
1189818264 X:44845636-44845658 ATGTGCCAGGTACTATGCTAAGG - Intergenic
1189830948 X:44972606-44972628 TTGGGGAAGGCAGTGTGCTGGGG + Intronic
1189899746 X:45693846-45693868 ATGTGCCAGGCACTTTTCTAGGG + Intergenic
1190006932 X:46749286-46749308 AGGTGTCAGGCACTGTTCTAGGG + Intronic
1190252534 X:48737880-48737902 ATGGGGCAGGGACAGTGCTCTGG - Intergenic
1190279617 X:48921043-48921065 ATGTGCCAAGCACTGTGCCCAGG + Intergenic
1190408206 X:50108899-50108921 ATGTGGCAGGCACAGGGCTATGG - Intergenic
1190571612 X:51788333-51788355 GGGTGTCAGGCACTGTGATGAGG - Intergenic
1190879858 X:54484393-54484415 ATGTGCTAGGCCCTGTGCTTAGG - Intronic
1191634492 X:63361252-63361274 ATGGGCCAGGCAGTGAGCTGTGG + Intergenic
1191666025 X:63703596-63703618 ATGTACCAGGCACTGTGCTGGGG + Intronic
1191817354 X:65260962-65260984 ATATAACAGGCACTGTGCTATGG - Intergenic
1192201746 X:69070745-69070767 ATGTGCCAGACACTGTTCTGGGG + Intergenic
1192219136 X:69185154-69185176 ATGTGTCAGGTTCTCTGCTGGGG - Intergenic
1192226297 X:69230501-69230523 ATGTGGCAAGCACTGGGCCCTGG - Intergenic
1192260341 X:69502653-69502675 ATGTTACAAGCACTGTGCTAGGG - Intergenic
1192344647 X:70290859-70290881 ATGTGCCAAGCACTGTGCTTGGG + Intronic
1192558667 X:72110403-72110425 AGGTGGCTGGTACTGTGCAGGGG - Intergenic
1192717731 X:73661561-73661583 ATGGGCCAGGCAGTGAGCTGTGG + Intronic
1192848396 X:74928422-74928444 ATGTGCCAAGCAGTGTTCTGAGG - Intergenic
1194192760 X:90857735-90857757 ATGTGGAAAGCAGTGTCCTGAGG - Intergenic
1194528520 X:95012376-95012398 AGGTGGCATGCAGGGTGCTGTGG + Intergenic
1194745849 X:97627605-97627627 ATTTGCTAGGCACTGTGCTAGGG + Intergenic
1195083234 X:101390483-101390505 ATGTGGCAGGCACTGTTCCGGGG - Intronic
1195529281 X:105933504-105933526 ATGTGGTATGCCCTGTCCTGTGG - Intronic
1195616783 X:106918675-106918697 AGGTGCCAGGCACTGTGCTGAGG - Intronic
1196013814 X:110916272-110916294 CTATGCCAGGCACTGTGCTATGG + Intergenic
1196038843 X:111178545-111178567 ATGTGCCATGTACTGTGCTAAGG - Intronic
1196208731 X:112971051-112971073 ATGAGCCAGGCACTGAGCTAGGG - Intergenic
1196650624 X:118164995-118165017 ATTTGCCAGGCACTCTGCTAAGG - Intergenic
1196692530 X:118576171-118576193 ATGTGGCAGGGCATGTGCTAGGG - Intronic
1197388237 X:125827046-125827068 CTGCAGCAGGCACTGAGCTGGGG - Intergenic
1197533140 X:127655357-127655379 ATGTGGCAGGAACTGTATTATGG - Intergenic
1197659130 X:129150768-129150790 GTGGGTCAGGCATTGTGCTGAGG + Intergenic
1197764023 X:130047784-130047806 ATGTGCCAGGCACTGGGTTTAGG + Intronic
1197772110 X:130095788-130095810 ATGGGGCAGGGACCATGCTGTGG - Intronic
1198036220 X:132803874-132803896 ATGTTCCAGGCATTGTGCAGAGG - Intronic
1198161448 X:134012610-134012632 ATGTTCCAAGCACTGTGCTAGGG + Intergenic
1198311672 X:135430844-135430866 CTGTGGCAAGCACAGTGCTAGGG + Intergenic
1198639844 X:138744483-138744505 AAATGCCACGCACTGTGCTGAGG - Intronic
1199681729 X:150229411-150229433 CTGTGCCAAGCCCTGTGCTGAGG - Intergenic
1199822300 X:151461487-151461509 ACATGCTAGGCACTGTGCTGAGG - Intergenic
1199988809 X:152972310-152972332 GTGTGCCAAGCACTGTGCAGAGG + Exonic
1200043130 X:153384298-153384320 AGGTGGCAGGCAGTGTGGAGAGG - Intergenic
1200383562 X:155865554-155865576 CACTGGCAGTCACTGTGCTGCGG - Intergenic
1200539388 Y:4440184-4440206 ATGTGGAAAGCAGTGTCCTGAGG - Intergenic
1200975965 Y:9212377-9212399 ATGGGCCAGGCAGTGAGCTGTGG + Intergenic
1201979419 Y:19891262-19891284 TTGTCCCAGCCACTGTGCTGTGG + Intergenic
1202135200 Y:21654158-21654180 ATGGGCCAGGCAGTGAGCTGTGG - Intergenic