ID: 961636461

View in Genome Browser
Species Human (GRCh38)
Location 3:128335937-128335959
Sequence CTGGAGAAGCAGAAGGCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 603
Summary {0: 1, 1: 0, 2: 6, 3: 45, 4: 551}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961636455_961636461 -2 Left 961636455 3:128335916-128335938 CCCTGACATCAGAGCGTTGCCCT 0: 1
1: 0
2: 0
3: 7
4: 95
Right 961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG 0: 1
1: 0
2: 6
3: 45
4: 551
961636454_961636461 -1 Left 961636454 3:128335915-128335937 CCCCTGACATCAGAGCGTTGCCC 0: 1
1: 0
2: 0
3: 5
4: 95
Right 961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG 0: 1
1: 0
2: 6
3: 45
4: 551
961636450_961636461 25 Left 961636450 3:128335889-128335911 CCAGGTGGGTGGAAGCCCCAGCT 0: 1
1: 0
2: 2
3: 27
4: 239
Right 961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG 0: 1
1: 0
2: 6
3: 45
4: 551
961636453_961636461 8 Left 961636453 3:128335906-128335928 CCAGCTTTTCCCCTGACATCAGA 0: 1
1: 1
2: 1
3: 19
4: 211
Right 961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG 0: 1
1: 0
2: 6
3: 45
4: 551
961636451_961636461 10 Left 961636451 3:128335904-128335926 CCCCAGCTTTTCCCCTGACATCA 0: 1
1: 0
2: 2
3: 21
4: 295
Right 961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG 0: 1
1: 0
2: 6
3: 45
4: 551
961636456_961636461 -3 Left 961636456 3:128335917-128335939 CCTGACATCAGAGCGTTGCCCTG 0: 1
1: 0
2: 0
3: 3
4: 86
Right 961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG 0: 1
1: 0
2: 6
3: 45
4: 551
961636452_961636461 9 Left 961636452 3:128335905-128335927 CCCAGCTTTTCCCCTGACATCAG 0: 1
1: 0
2: 3
3: 22
4: 211
Right 961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG 0: 1
1: 0
2: 6
3: 45
4: 551

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961636461 Original CRISPR CTGGAGAAGCAGAAGGCTGA AGG Intronic
900951470 1:5860383-5860405 CTGCGGAAGCAGCAGGCTAACGG + Intergenic
901219586 1:7575803-7575825 CTGGGGAAGAGGAAAGCTGAGGG + Intronic
902436225 1:16399522-16399544 CTGGTGAAGAAGGAGGCAGAAGG + Intronic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903944196 1:26951497-26951519 CTGGATGAGCAGGATGCTGAGGG - Exonic
904390868 1:30184999-30185021 CAGGAGAAGCCCAAGGCTGGTGG - Intergenic
904600672 1:31671021-31671043 CTGGAGAAGAAAATGGCTGGTGG - Intronic
904696437 1:32334407-32334429 GAGGAGAACCAGATGGCTGATGG + Exonic
905264044 1:36739043-36739065 CTGGCAGAGCAGGAGGCTGAAGG - Intergenic
905658009 1:39698501-39698523 CTGGAGGAGCAAAATGCAGATGG + Intronic
905658018 1:39698578-39698600 CTGGAGGAGCAAAATGCAGATGG + Intronic
905794355 1:40807274-40807296 CTGGAGAGTCACAAGGCGGAAGG + Intronic
905913054 1:41666974-41666996 CTGGCCAAGCAGATGGGTGAGGG - Intronic
906030715 1:42718003-42718025 GTGGAGATGCGGAAGGCTGCGGG - Intergenic
906109396 1:43312934-43312956 AAGGAGAAGCAGAAGCTTGAGGG + Intronic
906608789 1:47188368-47188390 TTGGGGAAGCAGAGGCCTGAAGG - Intronic
906736161 1:48130938-48130960 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
906960809 1:50418657-50418679 CCGGAGAAGCAGTAGGGCGAGGG - Exonic
907089292 1:51709545-51709567 CTGGAGAAGATCAAGGCTGATGG + Intronic
907137976 1:52157288-52157310 TTGGATAAGCAGGAGGCTGAGGG - Intronic
907221427 1:52909826-52909848 CTGCAGATGCAGAGGGCTGACGG + Intronic
907261263 1:53220447-53220469 CTGAAGGAGCAGGAGGCAGAAGG - Intronic
910361127 1:86414416-86414438 TTGGAGAAGCAGAAGGCCATTGG - Intergenic
910460302 1:87441927-87441949 CTGGAGAGGAAGAAGGATCAAGG + Intergenic
910542011 1:88370285-88370307 CTGGAGAATCAGATGTCTGCTGG - Intergenic
911125255 1:94335386-94335408 GTGGAGAAGAATGAGGCTGAGGG - Intergenic
911425686 1:97708083-97708105 CTGGCTACTCAGAAGGCTGAGGG - Intronic
912624674 1:111197318-111197340 ATGAAGGAGCACAAGGCTGAGGG + Intronic
913473779 1:119217184-119217206 CTGGACAAGCAGAATGATGATGG - Intergenic
914898733 1:151699640-151699662 CTGTAAAAGCAAAAGGCTGTAGG - Intergenic
915447424 1:155981885-155981907 CTGGAGAATCTGAAAGCTGATGG - Intronic
916167689 1:161978368-161978390 CTGGGGATACAGAAGGCAGAGGG - Intergenic
916329731 1:163601196-163601218 CCTGAGAACCAGAGGGCTGATGG - Intergenic
916849575 1:168689820-168689842 CTGGAGAAACAGAAGGCATTAGG - Intergenic
916896450 1:169168305-169168327 CTGAGGAAGCATAAGGCAGAAGG - Intronic
918709206 1:187705718-187705740 CTGGAACAGCAGATGGGTGAGGG - Intergenic
918928876 1:190826700-190826722 ATGGAGATTCAGAAGGGTGAGGG + Intergenic
919738168 1:200966486-200966508 CTGCAGAAGCAGGAGGTTGGGGG - Intergenic
920693176 1:208162208-208162230 CAGGAAGGGCAGAAGGCTGAGGG + Intronic
920920365 1:210293018-210293040 CTGGAAAAGGAGGAGGCTGTGGG - Intergenic
920955673 1:210618566-210618588 CTGGAGGAGCAGATGGCCGGAGG - Intronic
922651339 1:227341601-227341623 AAGGAGAAGCAGAGGGATGAGGG + Intergenic
923232460 1:231999734-231999756 CTGAAGGGGCAGAAGGCAGAAGG - Intronic
923351788 1:233114614-233114636 CTGGATAAACAGAAAACTGATGG + Intronic
923710037 1:236380391-236380413 CTGGAAAATAAGAAGACTGAAGG + Intronic
923806028 1:237258956-237258978 CTGGCCAAGCAGAAGGCAGAAGG - Intronic
923976886 1:239274018-239274040 ATGGAGGAGCAAAAGGCTGAAGG - Intergenic
924108113 1:240669712-240669734 ATGGAGACTCAGAAGGGTGAAGG - Intergenic
1063034889 10:2276653-2276675 CTGGAGAAGCAGGAGTATGGTGG - Intergenic
1063224662 10:4004486-4004508 CTGTTGAATGAGAAGGCTGAAGG + Intergenic
1064005687 10:11697117-11697139 CTGAACAACCAGAAGGATGAAGG - Intergenic
1065251641 10:23821534-23821556 CTTGAGAAGCAGAAGGAAGCAGG + Intronic
1065913023 10:30326814-30326836 CTGGAGAAACAGAAGGCAACTGG - Intronic
1066695025 10:38069629-38069651 CTGGAGAATCAGAAGACTTGGGG + Intergenic
1066997486 10:42577550-42577572 CTGGAGAATCAGAAGCCTTGGGG - Intronic
1067656166 10:48193243-48193265 CTGTAAAAGCAGAAAGCAGAAGG - Intronic
1067690294 10:48497463-48497485 AAGGAGATGCAGAAGGCAGAGGG + Intronic
1067935266 10:50605904-50605926 ATGGAGACTCAGAAGGGTGAAGG - Intronic
1068132770 10:52915411-52915433 CTGGAGAATAAAAAGTCTGATGG + Intergenic
1068515051 10:58015490-58015512 ATGGAGAAGAAAAAGGCTTAAGG - Intergenic
1068640260 10:59396956-59396978 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
1069486596 10:68827678-68827700 CTGGAGGCGCAGAAGGCGGCGGG + Exonic
1069486683 10:68828014-68828036 CTGGAGGCGCAGAAGGCGGCGGG + Intronic
1070325300 10:75384886-75384908 TTGGAGAGGCAGAGGGATGAAGG - Intergenic
1070771751 10:79086305-79086327 CGGGAGGAGGAGAAGGCTGAGGG - Intronic
1071588272 10:86846484-86846506 CTGGAGAAGAGGCACGCTGACGG - Intronic
1073517006 10:104085497-104085519 GGGGAAAAGGAGAAGGCTGAAGG - Intronic
1074914483 10:117942178-117942200 CTGGAGGAGGAGAAAACTGAAGG - Intergenic
1075589142 10:123678780-123678802 CAGGGGAAGCAGAACTCTGATGG - Intronic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1075887456 10:125913738-125913760 CAGGTGAAGCAGGAGGCTCAGGG - Intronic
1075987653 10:126801404-126801426 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1076003939 10:126933053-126933075 CTGGACAAGCAGAAGGCCCAGGG + Intronic
1076171576 10:128324327-128324349 CTGGAGAGTCAGAAGTCAGAGGG - Intergenic
1076545855 10:131245497-131245519 GTGGAAATGCAGAAGGCTGGAGG - Intronic
1076685097 10:132194994-132195016 CTGGTCAAGGAGAAGGGTGAGGG + Exonic
1077843810 11:6002873-6002895 CAGGAGGAAGAGAAGGCTGAGGG + Exonic
1077846240 11:6027573-6027595 CAGGAGGAAGAGAAGGCTGAGGG + Exonic
1077992933 11:7428360-7428382 CTGGAGATGGAGACAGCTGATGG - Intronic
1078457042 11:11483519-11483541 CTGGAGAAGCCAATGGCAGATGG + Intronic
1078530167 11:12130956-12130978 CTGGAGGAGCAGAGGCCGGAGGG + Intronic
1078898096 11:15615928-15615950 GTGGGGATGCAGAAGGCAGAAGG - Intergenic
1079181036 11:18193745-18193767 CTGCAGAATCACAAGGATGAGGG - Intronic
1079476538 11:20835943-20835965 CTGGTAGAGCAGAAGGCTTAAGG - Intronic
1079522500 11:21344855-21344877 CTGGAGAAGCAGAATAATTAAGG - Intronic
1080027098 11:27626444-27626466 CTGGATATGCAGAAGCGTGAGGG - Intergenic
1080504354 11:32897812-32897834 CTAGAGAAGCAGAGGTGTGATGG - Intronic
1080609292 11:33890128-33890150 CTGGAGACTCAGAAGGGTGGGGG + Intronic
1081621301 11:44620478-44620500 CTGCAGAAGCAGATGCCTGCGGG - Intergenic
1081652339 11:44832758-44832780 CTGAACAAGGAGAAGGCTGCAGG - Intronic
1083710537 11:64545691-64545713 CTGGAGAGGCAGAAGCCTGGGGG - Intergenic
1084064225 11:66694085-66694107 CTGGAGAACCACATGGCTGGGGG + Intronic
1084196395 11:67525300-67525322 CTTGAGAAGCAAGAGGTTGAAGG - Intergenic
1085349233 11:75787941-75787963 ATGGAGAAGAAGAGGCCTGATGG - Intronic
1085932301 11:81098168-81098190 CTGAAGAAGCTGATAGCTGAAGG + Intergenic
1086487688 11:87326133-87326155 CTGCAGAGGCAGCAGGCTGGGGG - Intergenic
1087006957 11:93480410-93480432 CTGGTGATGCAGAATGCTGGGGG - Intronic
1087092585 11:94288941-94288963 CTGCAGAAGCAGGAGGATAAGGG + Intergenic
1087283821 11:96243006-96243028 CTGGAGAAGCAGATGTTTAAAGG - Intronic
1088641935 11:111880972-111880994 TTGGAGAGGAACAAGGCTGATGG + Intronic
1089276263 11:117338063-117338085 CAAGAGCAGCAGAAGGCAGAAGG - Intronic
1089868521 11:121652297-121652319 GTGCAGAAGCAGAAGTCAGAAGG + Intergenic
1090007731 11:123017642-123017664 GTGGAGAAGGAGGAGGCTGGAGG + Intergenic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1092925825 12:13271182-13271204 CTGGAGAATGAAAAAGCTGATGG - Intergenic
1093652069 12:21657535-21657557 GCGGAGGAGCAGAAGGCAGAGGG - Exonic
1095154971 12:38841857-38841879 AGGGAGAAGCAGAAAGATGAAGG + Intronic
1095345866 12:41148149-41148171 CTGCAGAAGCAGAACCCTCATGG - Intergenic
1095739179 12:45588375-45588397 CTGGAGAGCCAGAAAGCTGGTGG - Intergenic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096216627 12:49801367-49801389 CAGGAGAAGCAGGAGGCTATTGG - Intronic
1096373587 12:51089071-51089093 CAGGAGAAGCAGAATGATGTAGG + Intergenic
1096547887 12:52353721-52353743 CTGAAGAAGCAGATGGCAGTGGG + Intergenic
1096848768 12:54422022-54422044 ATGGAGAGGAAGAAGGGTGAAGG + Intergenic
1097010956 12:55953203-55953225 CTGGGGCAGCAGAAGGGTCATGG + Intronic
1097075042 12:56386681-56386703 CTGAAGAACCAGAAGGCTAGAGG - Intergenic
1097257343 12:57689293-57689315 ATGGAGACTCAGAAGGATGATGG + Intergenic
1097908811 12:64947685-64947707 ATGGAGAAGGGAAAGGCTGAAGG - Intergenic
1098160865 12:67648010-67648032 CTGGGGAAGCAGTTGGCTGTGGG - Intergenic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1098992733 12:77082433-77082455 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1099043737 12:77689035-77689057 CTGCATAAGCAGAAGGGTTAAGG + Intergenic
1099099982 12:78427137-78427159 ATAGAGAAGCAGAAGCCAGATGG - Intergenic
1099210996 12:79788154-79788176 TTGGAGAAGGAGAAAGCTTATGG - Intronic
1099557801 12:84131425-84131447 GTGGAGAAGCAGAAGACATATGG + Intergenic
1100245610 12:92753711-92753733 CTGGAGAGGCAGAAGGGAAAAGG - Intronic
1100522405 12:95387998-95388020 TTAGAGAAGCAGAAAGCTGTAGG + Intergenic
1102319841 12:111923119-111923141 CTGAAGAAGCACAAAGTTGAAGG + Intergenic
1102852014 12:116256423-116256445 CTGGAGGGGAGGAAGGCTGAGGG + Intronic
1102972448 12:117180491-117180513 CTGGAGAAGCAGAATTCTCCTGG - Intronic
1104294100 12:127496047-127496069 CTGGAGAACCATCAGGATGATGG - Intergenic
1104550927 12:129756587-129756609 CTGGAGATGGATAAGGGTGATGG + Intronic
1105811429 13:23999648-23999670 CTGGGGAAGCCAAAGGCTCAGGG + Intronic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106799083 13:33237553-33237575 CTGGAGAAGCAAGATGCTGGAGG - Intronic
1107225632 13:38044866-38044888 CTGCAATAGCAGAAGGCTTATGG - Intergenic
1108020875 13:46126693-46126715 CTGGAGAGGCAGAACCCTAAAGG + Exonic
1108557008 13:51603371-51603393 CTGGAGCAGCAGGAGCCTCAGGG + Intronic
1110333782 13:74302767-74302789 CCTGTGAATCAGAAGGCTGAGGG - Intergenic
1110530400 13:76590690-76590712 AAGGAGAAGCAGGAGGCTAAGGG - Intergenic
1110613557 13:77516216-77516238 CTAGAGAACCAGGAGGCTCAAGG - Intergenic
1111760442 13:92457405-92457427 CTGGGGAAGGAGAAGGGTGCTGG - Intronic
1112559610 13:100501371-100501393 ATGGAGACTCAGAAGGGTGACGG - Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1113420975 13:110171269-110171291 CTAGAGGACCAGAAGGCAGATGG + Intronic
1113785608 13:113000719-113000741 CGGGAGAAGCTGAAGCCTGGAGG + Intronic
1114010926 14:18367635-18367657 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1114187352 14:20413149-20413171 AAGGAGGAGGAGAAGGCTGAAGG - Intronic
1114402305 14:22421056-22421078 CTGCAGAAGCAGAAGGACTATGG - Intergenic
1114474844 14:22987053-22987075 CTGGGGAAGCAGAACACTGGTGG - Exonic
1115167833 14:30469535-30469557 CTGGAGAACCAGAAAACTGGTGG - Intergenic
1115734834 14:36314682-36314704 CTGGAAAAGCAGAAGTAAGAAGG - Exonic
1116762786 14:49035343-49035365 CTGGAGATTCAGAAGGGTGGGGG + Intergenic
1117203746 14:53418889-53418911 CTGGAGCTGCTGAAGGCTGTGGG + Intergenic
1117222263 14:53617889-53617911 CTGGAGAATCTCAAGTCTGATGG - Intergenic
1118345498 14:64937825-64937847 CTTGAGAAGCCCAATGCTGAAGG - Intronic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1120014215 14:79451730-79451752 CTGGAGCAGCAGAATGCAAAGGG - Intronic
1120533574 14:85664311-85664333 CCGGGGAAGCAGAATGATGAGGG + Intergenic
1120929233 14:89831647-89831669 CTGGAGAATGAGAATGGTGAAGG + Intronic
1121463171 14:94097631-94097653 CTGGAGCTGCAGAAGTATGAGGG + Intronic
1122292411 14:100686868-100686890 CTGGAGAGGCAGGAGGGGGAGGG + Intergenic
1122925656 14:104898289-104898311 GTGGAGAGGCCGGAGGCTGAAGG + Intergenic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1202870677 14_GL000225v1_random:160346-160368 CAGGTGAAGCAGGAGGCTCAGGG + Intergenic
1124090924 15:26599282-26599304 CTGGAGGAGCTGGATGCTGATGG - Intronic
1125304605 15:38296145-38296167 CTAGACAAGTAGAAGGCTCAAGG - Intronic
1125765166 15:42130739-42130761 CTGGAGGAGCTCAAGGCTGCAGG - Intergenic
1125959947 15:43821424-43821446 CTGAAGAAGAATAAAGCTGATGG + Intronic
1126161633 15:45619433-45619455 TTGGAGGAGCAAGAGGCTGAGGG + Intronic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1126594575 15:50372745-50372767 CTGGAGATGCAGAAAGCTAGAGG - Intergenic
1126847001 15:52769662-52769684 CTGGAGAAGCAGAAGGCACAGGG + Intronic
1126884384 15:53134042-53134064 CTGGAGAAGAAAAAGACTCAAGG + Intergenic
1127634779 15:60858841-60858863 CGGGAGAAGCACCAAGCTGAGGG - Intronic
1128160521 15:65420746-65420768 CTGTAGAAGGAGAATGATGATGG - Intronic
1128177671 15:65570525-65570547 CTGAAGAAACAGGAGGTTGAAGG + Intronic
1128249435 15:66154053-66154075 TTGGAGAAGCAGACCACTGAGGG - Intronic
1128339479 15:66810499-66810521 GAGGAGAAGAAGAAGGCTAAGGG + Intergenic
1128568738 15:68718274-68718296 CTGGAGACACAGGAGGCTTAGGG + Intronic
1128732090 15:70028251-70028273 CTAGAGAACCAGAAGACTGGCGG + Intergenic
1128748805 15:70133872-70133894 ATGGAGAAGCAAAGGGCAGATGG - Intergenic
1129067149 15:72914802-72914824 CTGTGGAAGGAGAAGGCAGAAGG - Intergenic
1129248121 15:74292363-74292385 CTTGAGAAGCAAGGGGCTGAGGG + Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1130044447 15:80432797-80432819 CTGGAGGAGAAAAAGGCTGTGGG - Intronic
1130067385 15:80615969-80615991 CTAGTGAAGAAGAAGGGTGAAGG - Intergenic
1130090539 15:80817166-80817188 CTGGGGATGCGGAAGGCTGTGGG + Intronic
1130273230 15:82463169-82463191 CTGCAGAAGCAGGGGGCTGGTGG + Intergenic
1130465582 15:84190540-84190562 CTGCAGAAGCAGGGGGCTGGTGG + Intergenic
1130485483 15:84396098-84396120 CCAGAGAAGCGGAAGCCTGAGGG - Intergenic
1130487110 15:84404280-84404302 CTGCAGAAGCAGGGGGCTGGTGG - Intergenic
1130498683 15:84482996-84483018 CTGCAGAAGCAGGGGGCTGGTGG - Intergenic
1130587871 15:85195135-85195157 CTGCAGAAGCAGGGGGCTGGTGG + Intergenic
1131080837 15:89533476-89533498 ATGGAGACTCAGAATGCTGAGGG - Intergenic
1131299718 15:91186696-91186718 CTGGAGACTCAGAAGGCTGTGGG + Intronic
1131327208 15:91459487-91459509 CTGGGGAAGCTGGAAGCTGAGGG - Intergenic
1132372749 15:101309559-101309581 CTGAACAGGCAGGAGGCTGATGG - Intronic
1132990188 16:2788294-2788316 GTGGCAGAGCAGAAGGCTGAGGG - Intergenic
1133077224 16:3289223-3289245 CTGGAGAAGCATCAGGATAAAGG - Intronic
1133542189 16:6766959-6766981 CGGGGGAGGCTGAAGGCTGAAGG + Intronic
1133967665 16:10543363-10543385 GTGGAGAAGCCGGAGGCTGGAGG - Intronic
1135181837 16:20281576-20281598 CTGGAGGAGAGGAAGCCTGAGGG + Intergenic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1136509066 16:30724680-30724702 CTGGAGAAGCTGGAGCCAGAGGG - Exonic
1136654757 16:31703200-31703222 CTGAAGAAGAAGGAGCCTGAAGG + Intergenic
1136685979 16:31995189-31995211 CTGCAGAACCAGAAGGCATAAGG - Intergenic
1136786591 16:32938722-32938744 CTGCAGAACCAGAAGGCATAAGG - Intergenic
1136883178 16:33915072-33915094 CTGCAGAACCAGAAGGCATAAGG + Intergenic
1137627186 16:49916618-49916640 ATGGAGAACCAGGAGGCTGCTGG - Intergenic
1138295803 16:55884240-55884262 GAGGAGTAGCACAAGGCTGAGGG - Intronic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138719673 16:59064883-59064905 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1139388154 16:66587741-66587763 GTGGAGAAGGCAAAGGCTGAGGG + Intronic
1141031919 16:80596599-80596621 ATGGAGGAACAGAAGGATGATGG + Intergenic
1141436481 16:84002548-84002570 CTGGTGAAGCCCAAGGTTGAAGG + Exonic
1203088826 16_KI270728v1_random:1200388-1200410 CTGCAGAACCAGAAGGCATAAGG - Intergenic
1142675240 17:1509208-1509230 CTGGAGATGCAGAATTGTGAGGG - Exonic
1143236643 17:5407524-5407546 CTGCAGAGGCATAAGGCTAAGGG - Intronic
1143323106 17:6080744-6080766 CTGCAGCAGCAGCAGGCTGCCGG - Exonic
1143431531 17:6891129-6891151 CTGGAGAAACTGCAGTCTGATGG - Intronic
1143481637 17:7230561-7230583 CTCCAGAAGGAGAAGGCTGAGGG + Intronic
1143532905 17:7516072-7516094 CTGGAGAACCAGGAAGCTGGTGG + Intergenic
1145014539 17:19387671-19387693 CTGGGGGAGCAGAAGGCTGAGGG + Intergenic
1145895490 17:28455344-28455366 CTGGAGAACCAGGAAGGTGAGGG - Intergenic
1146122456 17:30207732-30207754 CAGGAGAAACAGAGGGCTGATGG + Exonic
1147146939 17:38490854-38490876 CTGCAGAACCAGAAGGCATAAGG - Intronic
1148083093 17:44978185-44978207 GTGGAGAGGGAGAAGGCTCAGGG - Intergenic
1149662094 17:58339354-58339376 CTTGAGTAGCAGAAGGCAGAGGG - Intergenic
1151153138 17:72105034-72105056 CAGGAGAAGCGGATGGCGGATGG - Intergenic
1151300913 17:73224740-73224762 CCAGAGAAGCAAAAGGCAGAGGG - Intronic
1151326865 17:73385066-73385088 GTGGAGTGGCAGATGGCTGAAGG + Intronic
1151621790 17:75250133-75250155 CTGGGGAGGCAGTAGGCAGATGG - Intronic
1151937312 17:77270522-77270544 CAGGAAAAACAGAGGGCTGAGGG - Intergenic
1152976691 18:228066-228088 CTGGAGGAAGGGAAGGCTGATGG - Intronic
1153499597 18:5734651-5734673 CTGGAGACTCAGAAGGGTGGAGG + Intergenic
1153709374 18:7782516-7782538 CTGGAGAAGGACAATGGTGATGG - Intronic
1154083855 18:11282863-11282885 TTGGAGACTCAGAAGGGTGAGGG - Intergenic
1154140619 18:11821622-11821644 CAGCAGAAGCCGAAGCCTGAAGG + Intronic
1155098605 18:22585538-22585560 CTGAAGAAACAGAAGTCTAAGGG + Intergenic
1155382129 18:25235373-25235395 CTGGGGAAGCAGAAGGTAAAGGG + Intronic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1157116059 18:44863880-44863902 CTGGACAAGCTGAAGACTGGTGG - Intronic
1157313001 18:46566307-46566329 CTGGACAAGAACCAGGCTGACGG - Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1157974140 18:52306829-52306851 CTTGAGAAGAATAAAGCTGAAGG + Intergenic
1158045890 18:53154785-53154807 CAGGAGGAGAAGCAGGCTGAGGG + Intronic
1158852079 18:61504606-61504628 TTTGAGAAGCAGATGCCTGAAGG + Intronic
1159706991 18:71702855-71702877 CTGGGGAAGCAGAAGACACATGG + Intergenic
1159936416 18:74371657-74371679 CTGGAGATGCAGAAGGCTAGGGG + Intergenic
1160311005 18:77790069-77790091 CTGTGGGAGCAGAAGGCTGCAGG + Intergenic
1160479053 18:79221334-79221356 CTGTGGAAGCAGATGGCTGCAGG - Intronic
1161085341 19:2332636-2332658 CTGCAGCCCCAGAAGGCTGAGGG + Intronic
1161438646 19:4278777-4278799 TTGGAGCAGCAGAAGGAAGAGGG - Exonic
1161698194 19:5782015-5782037 CTGGGGAAGGGGTAGGCTGAAGG + Intergenic
1161842767 19:6692967-6692989 CTGGAGAAGCAGAAGCCCGACGG - Exonic
1162119422 19:8453680-8453702 CTGGGGAAGCAGAAGGTGCAAGG + Intronic
1163015428 19:14451429-14451451 CTGGAGGGGTAGATGGCTGAGGG - Intronic
1163162716 19:15475151-15475173 GTGGAGATTCAGAAGGGTGAGGG + Intronic
1163779448 19:19238935-19238957 ATGGATGAGCAGAAGGCAGAGGG - Intronic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1165245753 19:34497616-34497638 CAGGAGAACCAGGAGGCTGCCGG + Intronic
1165258093 19:34592132-34592154 CTGGAGGAGATGACGGCTGAGGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166864970 19:45830310-45830332 CTGGAGAGGCAGCAGGGGGATGG - Intronic
1166936917 19:46339637-46339659 CTGGGGGAGGAGAAGGCAGATGG - Exonic
1167058851 19:47130934-47130956 GTGGAGAAGGAGGAGGCTGGCGG + Exonic
1167093018 19:47357784-47357806 CTGGGGAGGCTGCAGGCTGACGG - Intronic
1167294149 19:48639668-48639690 CTGGGGGAGGAGAAGGTTGAGGG - Intronic
1167637348 19:50662518-50662540 GTGGAGGAGGAGGAGGCTGAGGG + Exonic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
925078154 2:1037161-1037183 AGAGAGAAGCAGAAGGCAGATGG - Intronic
925358552 2:3261341-3261363 ATGAATGAGCAGAAGGCTGAGGG + Intronic
925482647 2:4293224-4293246 GTGGAGAAGGATAAGGATGAGGG - Intergenic
926111662 2:10187823-10187845 CTGCAGAAGCAGGAAGCGGATGG - Intronic
926696071 2:15770935-15770957 CTGGGGCAGCAGCAGCCTGAAGG + Intergenic
926724118 2:15984255-15984277 CTGGAGAAGCAAGAGGGAGAAGG - Intergenic
927003223 2:18821475-18821497 TTGGAGGAGAAGAAAGCTGATGG + Intergenic
927423840 2:22959188-22959210 ATGGCCAAGAAGAAGGCTGAAGG - Intergenic
927485958 2:23488517-23488539 CTGGGGAAGGAGAGGCCTGATGG + Intronic
927951757 2:27175023-27175045 CTGAGGATGCAGAAGGCAGAGGG - Intergenic
927992445 2:27457739-27457761 CTGCAGGAGCTGGAGGCTGAAGG - Exonic
928100826 2:28436609-28436631 CACGAGAAGCAGCAGGCTGCAGG - Intergenic
928226117 2:29449641-29449663 CTGTAGAAGCTGAGGGCTTACGG + Intronic
928284248 2:29975181-29975203 CTCCAGAGGCAGAAGGATGATGG + Intergenic
929112332 2:38415399-38415421 CTGGAAGAGCAGAAGAGTGATGG - Intergenic
929594464 2:43167742-43167764 CTGGAGCAGAAGAAGGAAGAAGG - Intergenic
930196123 2:48512205-48512227 CTGGGCAAGCAGAAGGATTATGG - Intronic
930463176 2:51710059-51710081 GTGGAGACTCAGAAGGGTGAGGG + Intergenic
930768413 2:55108397-55108419 CAGGAGAGGGAGAAGGGTGAAGG + Intronic
930892919 2:56412005-56412027 CTGGAGACTCAGAAGGGTGAGGG + Intergenic
931686725 2:64800326-64800348 CTGGAGGAGTCAAAGGCTGAAGG - Intergenic
931893689 2:66704510-66704532 CTGCAGAAACAGCAGCCTGAAGG - Intergenic
935037343 2:99391488-99391510 ATGGAGAATCAGAACGCTGCTGG + Intronic
935341318 2:102062116-102062138 CTGGAGAAGCTGAAGTCCCAGGG - Intergenic
936160053 2:110078058-110078080 CTGGAGAAGCAGCAGGATTTGGG - Intergenic
936184611 2:110293295-110293317 CTGGAGAAGCAGCAGGATTTGGG + Intergenic
936444698 2:112586411-112586433 CTGAACAACCAGAAGGATGAAGG - Intronic
936765948 2:115848661-115848683 CTGAGGAGGCAGAAGGCAGAAGG - Intergenic
936915969 2:117639417-117639439 GTGGATAATCAGGAGGCTGAAGG - Intergenic
937313696 2:120917685-120917707 CAGGAGAAGCCCAAGGCAGAAGG - Intronic
937369375 2:121286812-121286834 CTGGAGAAGCCGATGGCTGGGGG - Intergenic
937642343 2:124228037-124228059 CTGGAGAAGAGGGAGGCTGGTGG + Intronic
937665846 2:124485713-124485735 CTGCAGAAGCTGACGGCTGTGGG + Intronic
937922719 2:127143225-127143247 TTGGAGGAGCAGAAGGATGGTGG - Intergenic
938526005 2:132131705-132131727 CTGTAGACTCAGAAGGGTGAGGG - Intergenic
939026118 2:137015462-137015484 CTGGAGCAGCAGAAAGCTGCTGG - Intronic
940013139 2:149075967-149075989 CTGATGAGGCAGGAGGCTGACGG + Intronic
940018720 2:149134166-149134188 CTGGAGAAGGATCAGGCAGAGGG + Intronic
940241356 2:151566561-151566583 CTGCACATGCAGAAGGCTGGTGG + Intronic
940774569 2:157873448-157873470 CTGGAGAAGCAAACCACTGATGG - Intronic
940848723 2:158668138-158668160 CTGGAGAGGCAGAAGGCCAGTGG - Intronic
941203109 2:162539035-162539057 CTGAAGAAGCTGAAGACTGAAGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942087590 2:172457889-172457911 ATGAAGAAGCAGAAAGCAGATGG + Intronic
943748320 2:191485464-191485486 CTTGAGAAGCAGAAGGGTTCAGG - Intergenic
944446742 2:199799417-199799439 CTACAGAAGCAGAAGGCAGCCGG - Intronic
944908740 2:204288359-204288381 AAGCAGAAGAAGAAGGCTGAGGG + Intergenic
945268711 2:207917017-207917039 CTGGAGAAAAAGAAGGGAGAGGG + Intronic
946022868 2:216653637-216653659 CTGGAGATGAGGAAGGCAGATGG - Intronic
946053205 2:216880819-216880841 GTGGGGAAGCAGAAGGGGGAGGG - Intergenic
946448173 2:219757562-219757584 CAGGAGTAGCAGAGGGCTGTGGG - Intergenic
947597955 2:231425863-231425885 CTGGGGAAGCACCAGCCTGAGGG + Intergenic
947815623 2:233034488-233034510 CTGAGGAAGCAGAAGGCAGAGGG - Exonic
947922787 2:233892951-233892973 CTGGAGGGGCAGACAGCTGATGG - Intergenic
948104456 2:235401888-235401910 CTGGAGAAGGAGAAAGTTGTAGG - Intergenic
948160782 2:235822401-235822423 CTGGAGAAGCCCAGGGGTGAGGG + Intronic
948906533 2:240982285-240982307 TTGGACAAGCTGAAGGCAGAGGG + Intronic
1168932837 20:1637839-1637861 CTGGAGAATCAGAAAAATGAGGG + Intronic
1169138889 20:3215291-3215313 CTGGAGAAGTTAAAGCCTGAAGG + Exonic
1169170324 20:3459686-3459708 CTGGAGATTCAGGAGCCTGATGG - Intergenic
1170142381 20:13137899-13137921 CTTGAGTAGCAGAAAGCTCAGGG - Intronic
1173302442 20:41816228-41816250 ATGTGGAAGCAGAAGGCAGAAGG - Intergenic
1174162179 20:48559310-48559332 CTGGAGCATCAGGAGGCTGTGGG + Intergenic
1175283545 20:57821194-57821216 TTGGAGAAGGAGAAGCCTGGGGG + Intergenic
1175412182 20:58777617-58777639 GTGGAGAAGCAGACAGCTGTTGG - Intergenic
1176373060 21:6074053-6074075 GTGGAGAACCAGCTGGCTGAAGG + Intergenic
1177856444 21:26405683-26405705 CCTGAGAAGCTGATGGCTGAAGG - Intergenic
1178480328 21:32974644-32974666 TTGGGGAAGGGGAAGGCTGAAGG + Intergenic
1178820036 21:35966668-35966690 CTGGGGAAGCAGGAGTATGAGGG + Intronic
1179295069 21:40054441-40054463 GTGGGGCAGCAGAAGGGTGATGG + Intronic
1179750417 21:43464190-43464212 GTGGAGAACCAGCTGGCTGAAGG - Intergenic
1179984824 21:44914368-44914390 CAGGGGAAGCAGGGGGCTGAGGG + Intronic
1180088811 21:45523616-45523638 CTGGAGGGGCAGATGCCTGAGGG - Intronic
1180324268 22:11354597-11354619 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
1180435420 22:15298439-15298461 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1181906406 22:26200674-26200696 CTGGAGGCTGAGAAGGCTGATGG - Intronic
1182550752 22:31099664-31099686 CTGGAATAACAGAATGCTGAGGG + Intronic
1182558466 22:31141503-31141525 CTGGAGAAGCAGCAGGCTAATGG - Intergenic
1183723383 22:39574994-39575016 CTGGAGAGCCAGCAGGCTGCTGG + Intronic
1184345516 22:43910316-43910338 CTGCAGAAGCAGAGGGCAGGGGG - Intergenic
1184439712 22:44501773-44501795 CTGGAGGGGTAGAAGGCTGCAGG - Intergenic
1184757687 22:46526161-46526183 ATGGAGGAGCAGGAGGCGGACGG - Intronic
1184855416 22:47143921-47143943 CTGGAGCAGAAGAAGGCAGCGGG - Intronic
1184964236 22:47956210-47956232 CTTGAGAAGCATAAGTCTCAAGG - Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185181380 22:49365459-49365481 CTGGAGGAGCAGGAGGATGGTGG - Intergenic
1185226152 22:49654030-49654052 CTGGAGAAGCTGGCGCCTGAGGG - Intronic
1185263529 22:49884944-49884966 CCTGAGAAGCAGCAGGCTGATGG + Exonic
1185347657 22:50317479-50317501 CTGGAGAACCAGGAGGCTCCTGG + Intronic
950199374 3:11032291-11032313 CTGGAGACTCAGAAGGGTGGGGG - Intronic
951565866 3:24012070-24012092 CTGGAGAGGCTGAAGGCGGGAGG - Intergenic
952199010 3:31106130-31106152 CTGGAGACTCAGAAGGGTGAAGG - Intergenic
952422813 3:33146455-33146477 GTGGAGAAGCGAAGGGCTGAGGG + Exonic
952460597 3:33521598-33521620 CTGGAGGAGAAGAACACTGATGG + Intronic
953277297 3:41514762-41514784 ATGGAGACTCAGAAGGGTGAGGG + Intronic
953380464 3:42467520-42467542 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
953485323 3:43289153-43289175 CTGCAGAAGCACAAGGATGGCGG + Intronic
953715193 3:45311522-45311544 CTGGAGAGGCAGGGGGCAGAAGG + Intergenic
953978357 3:47399692-47399714 CTGGAAAAGCACAGGTCTGAAGG - Intronic
953996052 3:47520908-47520930 CTGGAGGAACAAAAGGGTGAAGG + Intergenic
954578047 3:51687618-51687640 CTGCCAAAGCAGAAAGCTGACGG - Intronic
955232351 3:57110257-57110279 CTGGAGGAGCTGAAGTCGGAGGG - Exonic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
955663582 3:61327186-61327208 GTGGAGAAGCAGAAAGCTGGTGG + Intergenic
955824900 3:62935342-62935364 CTGGACAAGCAGAATTCAGAGGG - Intergenic
956000367 3:64723584-64723606 CTGGAGAAGGATGATGCTGATGG + Intergenic
956031075 3:65038772-65038794 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
956784427 3:72630576-72630598 GGGGAGAAGCAGAAGGAAGAAGG + Intergenic
959407431 3:105977373-105977395 TTGGAGAAGCAGGAGGTAGATGG - Intergenic
959795881 3:110427863-110427885 ATGGAGAAGAAGGAGGCTGAGGG - Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960044872 3:113186899-113186921 ATGGAGGAGCAGGAGGCTGAGGG + Intergenic
961371557 3:126434777-126434799 CTGGAGGGGCTGGAGGCTGAGGG + Intronic
961633375 3:128317792-128317814 CAGCTGGAGCAGAAGGCTGAAGG - Intronic
961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG + Intronic
961732507 3:128976619-128976641 CTGGAGACTCAGGAGTCTGAAGG + Intronic
961817778 3:129560170-129560192 CTGGAGGGGCAAGAGGCTGAAGG - Intronic
962288065 3:134105264-134105286 CTGGAGGAACACATGGCTGAAGG + Intronic
962695397 3:137942745-137942767 ATGGATAATTAGAAGGCTGAAGG - Intergenic
962888302 3:139648443-139648465 CTCCTGAAGCAGGAGGCTGAAGG + Intronic
963353698 3:144183759-144183781 CAGGAGAGGGAGTAGGCTGAAGG - Intergenic
964116290 3:153139556-153139578 CAGGAGAAGCTTCAGGCTGAAGG - Intergenic
964548930 3:157865479-157865501 CTGGAGAAGCAGCAGGGCCAGGG - Intergenic
964561097 3:157997421-157997443 AAGTAGAAGCAGAAGGCAGAAGG - Intergenic
965689798 3:171343451-171343473 CTGGGGAAAGAGAAGCCTGAAGG + Intronic
965774249 3:172211594-172211616 CTGTAGAAGAGGAGGGCTGATGG + Intronic
966726633 3:183114785-183114807 GTGGAGAGGCAGGAGGCTAAGGG - Intronic
967037008 3:185655508-185655530 CTGGGGAAGTAGAAGGTTGCTGG + Intronic
967384893 3:188901676-188901698 TGGGAGAGGCAGAAAGCTGAGGG - Intergenic
967540775 3:190665139-190665161 CTGGAGAAGGATAGGGCGGATGG + Intergenic
967699119 3:192571004-192571026 CTGAAGAATCAGAAGGTTAATGG - Intronic
969301368 4:6299271-6299293 CAAGAGGAGCAGAGGGCTGAGGG - Intronic
969457458 4:7308299-7308321 CTGGAGCAGCAGAAGGGGCAGGG - Intronic
969923108 4:10559427-10559449 CTGGAGAAATTGAAAGCTGATGG - Intronic
970194367 4:13541033-13541055 CTGGAGTCGCAGAGGGCAGAAGG + Exonic
971385679 4:26138870-26138892 CTGGAGAAGAGCAAGGCTTAGGG + Intergenic
971424489 4:26502720-26502742 CTGGAAACGCAGAGGGATGAAGG - Intergenic
971577401 4:28293226-28293248 TTGAAGAAGCAGAAAGATGAAGG + Intergenic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
971807407 4:31377344-31377366 CTGTAGATCCAGAAGGCTTAGGG - Intergenic
973981893 4:56314583-56314605 CAGGAGGAGGAGGAGGCTGAGGG + Exonic
974132809 4:57777457-57777479 CTGGGAAAGAAGGAGGCTGAGGG - Intergenic
974201048 4:58641002-58641024 TTGGAGAAGCAGAGTACTGAGGG - Intergenic
975586135 4:75951663-75951685 CTAGAGAAAAAGAAGACTGAAGG + Intronic
976249490 4:83035452-83035474 TGGGAGAAGCAGAAAGCTGGAGG + Intronic
977050141 4:92119382-92119404 CTGCAGAAGCAGAACCCTCATGG + Intergenic
977708158 4:100094249-100094271 CAGTAAAACCAGAAGGCTGAAGG - Intergenic
977830550 4:101586357-101586379 CTGGAGAAATAGAAAGCAGAGGG - Intronic
978151671 4:105443332-105443354 GTGAAGAAGCAGAAGGCAGAAGG + Intronic
978175010 4:105719231-105719253 CTCAAGCAACAGAAGGCTGATGG + Exonic
979932068 4:126643210-126643232 ATGGAGGAGCAGAGGGATGAGGG + Intergenic
980992329 4:139748524-139748546 CTGAAGGAGCAGGAGGCTGCTGG + Intronic
981477210 4:145198958-145198980 GTAGAGCAGCATAAGGCTGATGG + Intergenic
981656428 4:147117069-147117091 CTGGTGTAGCAGAAGGATCATGG - Intergenic
981831547 4:149007464-149007486 CTGGAAGACCTGAAGGCTGAAGG - Intergenic
982255452 4:153447057-153447079 AAGGAGAAGCAGGAGGTTGATGG - Intergenic
983301067 4:165926530-165926552 CTCAGGAAGCAGAAGGCAGAGGG + Intronic
983660700 4:170128050-170128072 ATGGTGCAGCAGCAGGCTGAAGG + Intergenic
984269542 4:177534208-177534230 CTGGAGAAGCAGGAGGGAGTAGG + Intergenic
984652607 4:182286550-182286572 CTGTAGATGCAGAAGGTTGTGGG + Intronic
984947338 4:184980045-184980067 CTGCAGGAGCAGCAGGCTGCAGG - Intergenic
985689569 5:1299618-1299640 CTGGAGAAGCTGAGGCCTGGAGG + Intergenic
985803420 5:2021275-2021297 CTGGAAAGGCAGAGGGCAGAGGG - Intergenic
985803450 5:2021423-2021445 CTGGAGAAGCAGGTGGCGGAGGG - Intergenic
986178584 5:5372867-5372889 CTGAGGAGGCAGAAGGCAGAAGG + Intergenic
986455104 5:7910791-7910813 CTGGAGAAACACCAGGTTGATGG + Intergenic
987492090 5:18594170-18594192 CTGCAGAAGCAGAGGCCTCATGG - Intergenic
987671960 5:21022160-21022182 CTGGAGAAACTGCAGACTGAGGG - Intergenic
987712954 5:21527861-21527883 CTAGAGAAACAGAAAGCTGATGG - Intergenic
988739276 5:34054074-34054096 GTGCAGAAGCAAAAGGCTCAAGG - Intronic
989238896 5:39180760-39180782 CTGGAGAAGTAGAAAGTAGATGG - Intronic
989322359 5:40151199-40151221 CTGGAGGAGCAAAAGGAAGAAGG - Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990311488 5:54543229-54543251 ATGGAGGTGCAGAAGGCTGACGG + Intronic
991164924 5:63554507-63554529 CTGGAGGGGCATAAGGCAGAAGG - Intergenic
991325173 5:65423154-65423176 CTGGAGATTCAGAAGGGGGAAGG + Intronic
992073896 5:73173663-73173685 CTGGAGAACCATAAGGAGGAGGG - Exonic
993440302 5:87948785-87948807 CTGTAGAAGCTGAAGGCTTACGG - Intergenic
993628031 5:90249586-90249608 CTGGAGACTCAGAGGGGTGAGGG + Intergenic
993681964 5:90889859-90889881 GTGGAGAAAGAGAGGGCTGATGG + Intronic
993714454 5:91261634-91261656 CTGAGGCAGCAGAAAGCTGAAGG + Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
995909009 5:117163305-117163327 CTGTAGAAGCAGAAGTTTCATGG + Intergenic
996330193 5:122320039-122320061 CAAGAGAAGCTGAAGGCTGAGGG - Intronic
997716388 5:136046312-136046334 CTGCAGGAGCAGAAGACAGAAGG - Intronic
998181404 5:139947993-139948015 CTGGAGATGGAGAATGGTGATGG - Intronic
998513422 5:142732496-142732518 CTGAAGGAGCAGGAGACTGAGGG - Intergenic
998537732 5:142950216-142950238 CAGGACAGGCAGAAAGCTGAAGG + Intronic
999471311 5:151857578-151857600 CTGGACACCCAGAAGGCAGAGGG - Intronic
1000621271 5:163489336-163489358 TTGGAGAAGCTGAAGCCTAAGGG - Intronic
1000701826 5:164460939-164460961 CTGGAGAAGCAAATGGTTTATGG + Intergenic
1001276522 5:170355321-170355343 CTGGAGAAGGAGAAAGCAAAGGG + Intronic
1001946576 5:175783816-175783838 CCTGAGAACCAGAAAGCTGATGG + Intergenic
1002100333 5:176854535-176854557 CTGGGGAAGCAGAGGGGTCAGGG - Intronic
1002137045 5:177114076-177114098 AGGGAGAAGCAGAGGGCTCATGG - Intergenic
1002426778 5:179181313-179181335 CTGGAGAGGCAGAGGGCAGGGGG - Intronic
1002782828 6:380116-380138 CTGGAGAAAAGGGAGGCTGAAGG - Intergenic
1003085119 6:3054416-3054438 CGGGAGATCCAGCAGGCTGATGG - Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1005857029 6:29870435-29870457 ATTGAGAAGCAGGAGGGTGAAGG + Intergenic
1005862848 6:29914586-29914608 ATTGAGAAGCAGGAGGGTGAAGG + Intergenic
1006056307 6:31387071-31387093 ATTGAGGAGCAGGAGGCTGAGGG - Intergenic
1006066659 6:31467103-31467125 ATTGAGGAGCAGGAGGCTGAGGG - Intergenic
1006099371 6:31676644-31676666 CTGGTGGAGGTGAAGGCTGAGGG - Intergenic
1007409700 6:41654576-41654598 CTGGAGAAGCTGAAGTCAGCAGG - Intergenic
1007410514 6:41658684-41658706 AAGGTGAAGCAGCAGGCTGAAGG + Intergenic
1007582870 6:42969594-42969616 CTGGAGGAGCAGCAGCCAGATGG - Intronic
1009003769 6:57754051-57754073 CTAGAGAAACAGAAAACTGATGG + Intergenic
1009828249 6:68896635-68896657 CTTGAGAAGCAGAAAGCGTATGG + Intronic
1010073603 6:71773390-71773412 TTGGAGAAGCAGAAGGGGAAAGG - Intergenic
1011428966 6:87264707-87264729 CTGAAGAAGCAGATGGGTGGTGG + Intergenic
1013716390 6:112967884-112967906 CTGCAGAAGCAGAGCCCTGATGG - Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015359825 6:132327090-132327112 CTGGAGATGCTGAAGGGTTAGGG - Intronic
1015763753 6:136693349-136693371 CTGGAAAAGCACAAGGTGGAAGG - Intronic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016693040 6:146961360-146961382 CTGGAGACTCAGAAGGGTAAGGG + Intergenic
1017272315 6:152522213-152522235 TTGGAGACTCAGAAGGATGAGGG - Intronic
1017478711 6:154827735-154827757 CTTGAGAAGCAAAATGCTGTAGG + Intronic
1017848707 6:158283747-158283769 CTGCTGAAGCAGAAGGCTGGAGG - Intronic
1018050836 6:160006272-160006294 CTGGAGACGCGGAAGGCGCATGG - Intronic
1018607958 6:165618453-165618475 CTGGAGAAGAGGAAGGCTGATGG - Intronic
1019215264 6:170439040-170439062 CTGGGGGGACAGAAGGCTGAGGG + Intergenic
1019391927 7:793180-793202 GTGGAGACTCAGAAGGGTGAAGG + Intergenic
1019513359 7:1429321-1429343 CCTGAGACGCAGGAGGCTGACGG - Intronic
1019701362 7:2476331-2476353 CTGGAGAAGGAGAACGGTGCAGG - Intronic
1019721317 7:2573706-2573728 CTGGAGAAGCAGAGCACGGATGG - Intronic
1019898245 7:3999679-3999701 CAGGAGAAGCTGGAGGCTGGAGG + Intronic
1020415465 7:7940961-7940983 AGGTAGAAGCAGAAGACTGAAGG - Intronic
1020809861 7:12838603-12838625 TTTCTGAAGCAGAAGGCTGAGGG - Intergenic
1021488785 7:21196218-21196240 CTGGTGAAGCAGCAGGAAGATGG - Intergenic
1022134250 7:27432341-27432363 AGGGAGAGGCGGAAGGCTGAAGG - Intergenic
1022190233 7:28010387-28010409 TAGGAACAGCAGAAGGCTGAAGG - Intronic
1022794659 7:33722530-33722552 CTGGGGCAGCAGCAGGCAGAAGG - Intergenic
1023054287 7:36279174-36279196 CTGGTGAAGCAGAAAACTCAAGG - Intronic
1023534595 7:41194945-41194967 CTGGAAAACCAGGAGCCTGATGG + Intergenic
1023905218 7:44517003-44517025 CTTCAGAAGGAGAATGCTGAGGG + Intronic
1026886306 7:73949414-73949436 CAGGAGAAGAAGAAAGCAGAAGG - Intergenic
1027288433 7:76674923-76674945 CCTGAGAACCAGGAGGCTGATGG + Intergenic
1028123910 7:87089354-87089376 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1028519931 7:91718626-91718648 CTGAAGAAGAAGAAGGATAATGG - Intronic
1029111919 7:98217083-98217105 CTGGAAAGGCAGAAGGGAGAGGG + Exonic
1030536403 7:110772312-110772334 CTTGAGAACAAGAAGGCCGATGG - Intronic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1032147234 7:129395199-129395221 CAGAAGTAGCTGAAGGCTGAGGG - Intronic
1034270007 7:149798814-149798836 CTGGAGAGGAAGGAGGGTGAGGG + Intergenic
1034350446 7:150411669-150411691 CTGGAATAGCAGAATGCTCAGGG + Intronic
1034367944 7:150568007-150568029 CAGGAGAAGCTGGATGCTGATGG + Intronic
1034427986 7:151024420-151024442 CTGGAGAAGCCGTGGCCTGATGG - Exonic
1034841314 7:154400172-154400194 CTGGAGAAGCCAAGGCCTGAGGG + Intronic
1035247951 7:157577222-157577244 CAGGAAAAGCAAAAGGCTCACGG + Intronic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1036602265 8:10272318-10272340 CTGGAGAACAAGAGAGCTGATGG + Intronic
1036835830 8:12065290-12065312 GTGGAGAAGCATATGGCTAAGGG + Intronic
1037170634 8:15887342-15887364 CTGGACTTGCAGCAGGCTGAGGG + Intergenic
1038397604 8:27258613-27258635 CTGGAGAACCAGAGGGGTGAGGG + Intergenic
1038932233 8:32206791-32206813 CTGGAGACTCAGAAGGGTGGAGG - Intronic
1039239946 8:35545472-35545494 CTGGAGAGGCAGCCTGCTGAGGG + Intronic
1039517163 8:38143815-38143837 CGGGAGGAGCAGAGGGCTGCAGG + Exonic
1040071937 8:43195654-43195676 CTGGAGGAGGAGGAGGGTGAGGG + Intronic
1040288083 8:46110544-46110566 TTGGAGAAGCGCAAGACTGAAGG - Intergenic
1040857552 8:51963966-51963988 CTGGAGAAAAAGGAGGCTGAGGG - Intergenic
1041267616 8:56080364-56080386 GAGGAGAAGGAGAAGGCGGAAGG + Intergenic
1041842459 8:62288097-62288119 CTGTAGAAGCACAAGGCAAATGG - Intronic
1041954278 8:63540256-63540278 CTGGAGAACCAGAAAACTGATGG + Intergenic
1042434771 8:68750712-68750734 TTGGAGAATCAGAATGCTTAGGG + Intronic
1043218033 8:77620785-77620807 CTGGACCAGCTGCAGGCTGAGGG - Intergenic
1044363279 8:91313417-91313439 CTTGAGAAGAACAAAGCTGAAGG - Intronic
1044418592 8:91965130-91965152 CTTTAGAATTAGAAGGCTGATGG + Intronic
1044725104 8:95188300-95188322 GTGGAGAAGCAGAAGGCAGCAGG + Intergenic
1045490203 8:102662460-102662482 CTGAGGAAGAAGCAGGCTGAAGG + Intergenic
1046600825 8:116315252-116315274 CTGCAGAGGCAGAAGCCTCATGG - Intergenic
1047599023 8:126408043-126408065 CAGGAGAGGCAGTAGGATGAGGG - Intergenic
1047650748 8:126917530-126917552 CTTGTGAAGCAGAAGTCTGATGG - Intergenic
1047781155 8:128112236-128112258 CTGGAGAACCAGTAGCTTGAGGG - Intergenic
1047887331 8:129266140-129266162 CTGAAGAAGCTGATGGCTGGAGG + Intergenic
1048167931 8:132080148-132080170 CTGGAGAGGCTGAGGGCTGGAGG - Intronic
1048989707 8:139754145-139754167 ATGGAGCAGCAGCAGGCTGGGGG - Intronic
1049013408 8:139903247-139903269 CTGGAGAAGCCCAAGGCAAATGG - Intronic
1049180391 8:141219150-141219172 CTGGAGAAGGAGAAAGCAGTAGG + Intronic
1049851139 8:144831187-144831209 CTGGAGAAGCAAACTGCTGCTGG - Intronic
1050260507 9:3836515-3836537 CTGGAAAAGAAGAAATCTGAAGG - Intronic
1050460045 9:5869832-5869854 CTGGAGAAAGGGAAGGCTCATGG + Intergenic
1050920902 9:11199468-11199490 CTGTTCAAGCAGCAGGCTGAGGG - Intergenic
1051013543 9:12448087-12448109 CTGCAGAAGCAGAACGCTCATGG + Intergenic
1051194982 9:14554360-14554382 CTGGATGAGGAAAAGGCTGAAGG - Intergenic
1051552538 9:18346091-18346113 CTGAGGAAACAGAAGGCTAATGG - Intergenic
1051621495 9:19054389-19054411 CTGGATAGGGAAAAGGCTGAAGG + Exonic
1053020541 9:34691101-34691123 CCAGAGAACCAGCAGGCTGAGGG + Exonic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1055099210 9:72445866-72445888 CCAGAGAAGCAGACCGCTGAGGG - Intergenic
1057090328 9:92252164-92252186 CTGTAGGACCCGAAGGCTGAAGG + Intronic
1057314325 9:93958903-93958925 CTGGAGTAGGAGAAGGGTGTGGG - Intergenic
1057414121 9:94846225-94846247 CTGGAGAAGCACAACGTGGAAGG + Intronic
1057637744 9:96786606-96786628 TTGGAGATGTAGAGGGCTGAAGG - Intergenic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1058549784 9:106102309-106102331 CTTGGGAAGGAGAAGGCTGGAGG - Intergenic
1058776489 9:108289318-108289340 CTGGAGAAGCAGATGGAAGGGGG - Intergenic
1059528668 9:115016151-115016173 CAGGAGAGGCAGAAGGCAAAAGG - Intergenic
1059828225 9:118058118-118058140 ATGGAGACTCAGAAGCCTGAGGG - Intergenic
1059864823 9:118502616-118502638 TTGGAGATTTAGAAGGCTGAGGG - Intergenic
1060036640 9:120261534-120261556 CTGGAGAGGGAGAAGGCAGAGGG + Intergenic
1060208139 9:121694550-121694572 CTGGAGAAGCAGCAGGGTTGTGG + Intronic
1060235119 9:121857273-121857295 CTGGTGAAGCAGGAGTCAGAGGG - Intronic
1060709678 9:125846641-125846663 ATGTAGAAGGAGAAAGCTGATGG - Intronic
1060840151 9:126786563-126786585 CTGGAGAGGCAGAGGACTGCAGG - Intergenic
1062027563 9:134347541-134347563 CCGGAGGAGCACAAGGCTGGGGG + Intronic
1062165347 9:135104808-135104830 CTGGAGGAGCAGGAGGCAGGAGG - Intronic
1062268469 9:135698210-135698232 GTGGAGACCCAGAGGGCTGAAGG + Intronic
1062361550 9:136190654-136190676 CTGGAGAAGCACATGCCTGCTGG + Intergenic
1203733780 Un_GL000216v2:116245-116267 CAGGTGAAGCAGGAGGCTCAGGG - Intergenic
1186114622 X:6292503-6292525 CAGGAGAAGCCAAAAGCTGAGGG - Intergenic
1186835861 X:13437159-13437181 TTGGAGACTCAGAAGGGTGAGGG + Intergenic
1187034285 X:15521642-15521664 CTGCAGAACCAGAAGGTTGCAGG + Intronic
1187128626 X:16479274-16479296 TTGGAAAAGCAGATTGCTGAAGG + Intergenic
1187507536 X:19888762-19888784 CTGGAAATGGAGGAGGCTGAGGG + Intergenic
1189199091 X:39176389-39176411 CTTAAGAAGCAGAAGCCTGGAGG + Intergenic
1192016739 X:67339413-67339435 CTGGGGAAGCAGAAGAGAGAGGG + Intergenic
1192459571 X:71305279-71305301 ATTGAGCAGCAGGAGGCTGAAGG + Exonic
1192592872 X:72375482-72375504 CCTGAGAACCAGAGGGCTGATGG + Intronic
1195010283 X:100726931-100726953 ATGGAGACTCAGAAGGGTGAGGG - Intronic
1196425107 X:115561727-115561749 CTGGAGGAGTAGCAGGCTGCTGG - Intronic
1197179618 X:123520325-123520347 CTGGAGGTGCAAAAGGCAGAGGG - Intergenic
1197808031 X:130416032-130416054 GTGGAGGAGCAGGAGGCTAAGGG - Intergenic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1199005570 X:142692657-142692679 GGGGAGGAGCAGAAGGTTGACGG + Intergenic
1199012804 X:142777387-142777409 ATGGAAGAGCAGAAGGCTGAGGG + Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1200239883 X:154487849-154487871 CAGGAGGAGCACAAAGCTGAAGG + Exonic
1201144684 Y:11057758-11057780 CAATAGAGGCAGAAGGCTGAGGG + Intergenic
1202627233 Y:56872176-56872198 CAGGTGAAGCAGGAGGCTCAGGG + Intergenic