ID: 961637541

View in Genome Browser
Species Human (GRCh38)
Location 3:128342712-128342734
Sequence TGCACCACAGGACCAGCCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 90}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961637541_961637552 10 Left 961637541 3:128342712-128342734 CCCTCGGCTGGTCCTGTGGTGCA 0: 1
1: 0
2: 1
3: 6
4: 90
Right 961637552 3:128342745-128342767 GGCCCAGTGCTGGGTGGGATGGG 0: 1
1: 0
2: 2
3: 40
4: 407
961637541_961637547 1 Left 961637541 3:128342712-128342734 CCCTCGGCTGGTCCTGTGGTGCA 0: 1
1: 0
2: 1
3: 6
4: 90
Right 961637547 3:128342736-128342758 CAGCACCTGGGCCCAGTGCTGGG 0: 1
1: 1
2: 12
3: 46
4: 454
961637541_961637557 26 Left 961637541 3:128342712-128342734 CCCTCGGCTGGTCCTGTGGTGCA 0: 1
1: 0
2: 1
3: 6
4: 90
Right 961637557 3:128342761-128342783 GGATGGGCCTGCCACTAGGGTGG 0: 1
1: 0
2: 1
3: 15
4: 148
961637541_961637551 9 Left 961637541 3:128342712-128342734 CCCTCGGCTGGTCCTGTGGTGCA 0: 1
1: 0
2: 1
3: 6
4: 90
Right 961637551 3:128342744-128342766 GGGCCCAGTGCTGGGTGGGATGG 0: 1
1: 0
2: 13
3: 81
4: 676
961637541_961637546 0 Left 961637541 3:128342712-128342734 CCCTCGGCTGGTCCTGTGGTGCA 0: 1
1: 0
2: 1
3: 6
4: 90
Right 961637546 3:128342735-128342757 TCAGCACCTGGGCCCAGTGCTGG 0: 1
1: 1
2: 6
3: 29
4: 321
961637541_961637555 22 Left 961637541 3:128342712-128342734 CCCTCGGCTGGTCCTGTGGTGCA 0: 1
1: 0
2: 1
3: 6
4: 90
Right 961637555 3:128342757-128342779 GGTGGGATGGGCCTGCCACTAGG 0: 1
1: 0
2: 2
3: 24
4: 233
961637541_961637549 5 Left 961637541 3:128342712-128342734 CCCTCGGCTGGTCCTGTGGTGCA 0: 1
1: 0
2: 1
3: 6
4: 90
Right 961637549 3:128342740-128342762 ACCTGGGCCCAGTGCTGGGTGGG 0: 1
1: 0
2: 2
3: 38
4: 391
961637541_961637548 4 Left 961637541 3:128342712-128342734 CCCTCGGCTGGTCCTGTGGTGCA 0: 1
1: 0
2: 1
3: 6
4: 90
Right 961637548 3:128342739-128342761 CACCTGGGCCCAGTGCTGGGTGG 0: 1
1: 0
2: 4
3: 44
4: 448
961637541_961637556 23 Left 961637541 3:128342712-128342734 CCCTCGGCTGGTCCTGTGGTGCA 0: 1
1: 0
2: 1
3: 6
4: 90
Right 961637556 3:128342758-128342780 GTGGGATGGGCCTGCCACTAGGG 0: 1
1: 0
2: 0
3: 12
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961637541 Original CRISPR TGCACCACAGGACCAGCCGA GGG (reversed) Intronic