ID: 961637711

View in Genome Browser
Species Human (GRCh38)
Location 3:128343441-128343463
Sequence TTGGACCCTTAGCTCCGGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 84}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961637703_961637711 -8 Left 961637703 3:128343426-128343448 CCTCAGACCCAGAGCTTGGACCC 0: 1
1: 0
2: 0
3: 34
4: 267
Right 961637711 3:128343441-128343463 TTGGACCCTTAGCTCCGGGGGGG 0: 1
1: 0
2: 0
3: 7
4: 84
961637701_961637711 -4 Left 961637701 3:128343422-128343444 CCTTCCTCAGACCCAGAGCTTGG 0: 1
1: 0
2: 4
3: 33
4: 305
Right 961637711 3:128343441-128343463 TTGGACCCTTAGCTCCGGGGGGG 0: 1
1: 0
2: 0
3: 7
4: 84
961637699_961637711 2 Left 961637699 3:128343416-128343438 CCTCTCCCTTCCTCAGACCCAGA 0: 1
1: 1
2: 6
3: 81
4: 622
Right 961637711 3:128343441-128343463 TTGGACCCTTAGCTCCGGGGGGG 0: 1
1: 0
2: 0
3: 7
4: 84
961637697_961637711 7 Left 961637697 3:128343411-128343433 CCCTTCCTCTCCCTTCCTCAGAC 0: 1
1: 1
2: 8
3: 143
4: 1074
Right 961637711 3:128343441-128343463 TTGGACCCTTAGCTCCGGGGGGG 0: 1
1: 0
2: 0
3: 7
4: 84
961637698_961637711 6 Left 961637698 3:128343412-128343434 CCTTCCTCTCCCTTCCTCAGACC 0: 1
1: 0
2: 9
3: 154
4: 1328
Right 961637711 3:128343441-128343463 TTGGACCCTTAGCTCCGGGGGGG 0: 1
1: 0
2: 0
3: 7
4: 84
961637696_961637711 8 Left 961637696 3:128343410-128343432 CCCCTTCCTCTCCCTTCCTCAGA 0: 1
1: 0
2: 10
3: 200
4: 1235
Right 961637711 3:128343441-128343463 TTGGACCCTTAGCTCCGGGGGGG 0: 1
1: 0
2: 0
3: 7
4: 84
961637700_961637711 -3 Left 961637700 3:128343421-128343443 CCCTTCCTCAGACCCAGAGCTTG 0: 1
1: 0
2: 2
3: 22
4: 306
Right 961637711 3:128343441-128343463 TTGGACCCTTAGCTCCGGGGGGG 0: 1
1: 0
2: 0
3: 7
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961637711 Original CRISPR TTGGACCCTTAGCTCCGGGG GGG Intronic