ID: 961641003

View in Genome Browser
Species Human (GRCh38)
Location 3:128364820-128364842
Sequence GCTGCCATGCAGGCTGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 507
Summary {0: 1, 1: 0, 2: 5, 3: 40, 4: 461}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961641003_961641008 -5 Left 961641003 3:128364820-128364842 CCCTCCACAGCCTGCATGGCAGC 0: 1
1: 0
2: 5
3: 40
4: 461
Right 961641008 3:128364838-128364860 GCAGCGTGGCCCCAACCCACAGG 0: 1
1: 0
2: 1
3: 10
4: 113
961641003_961641009 0 Left 961641003 3:128364820-128364842 CCCTCCACAGCCTGCATGGCAGC 0: 1
1: 0
2: 5
3: 40
4: 461
Right 961641009 3:128364843-128364865 GTGGCCCCAACCCACAGGTGAGG 0: 1
1: 0
2: 0
3: 17
4: 193
961641003_961641013 7 Left 961641003 3:128364820-128364842 CCCTCCACAGCCTGCATGGCAGC 0: 1
1: 0
2: 5
3: 40
4: 461
Right 961641013 3:128364850-128364872 CAACCCACAGGTGAGGAAACAGG 0: 1
1: 0
2: 5
3: 46
4: 457

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961641003 Original CRISPR GCTGCCATGCAGGCTGTGGA GGG (reversed) Intronic
900101865 1:965412-965434 CCCCCCATGCAGGCAGTGGAGGG - Exonic
900120763 1:1047772-1047794 GGTGCCCTGAAGGCTGTGGCTGG - Exonic
900784323 1:4638194-4638216 GCTGCCAGGCAGGCTGCGCTGGG + Intergenic
901052093 1:6430323-6430345 CCTGCCAGGGAGGCTGTGGGTGG + Intronic
901430199 1:9209515-9209537 GCTGTCATGCGGGCTGTGGGAGG - Intergenic
901432709 1:9227064-9227086 GCTACCATGGAGGCTGAGGTGGG + Intergenic
902580266 1:17403624-17403646 TCTGCTATGCAGGCAATGGAGGG - Intergenic
902590525 1:17470951-17470973 GCTGCTCTGGAGGCTGTGGTGGG - Intergenic
902614883 1:17618386-17618408 GCTGCGAGGCAGGCTGGGGTGGG + Intronic
902727569 1:18347269-18347291 TCTGCCCTGCAGGCTGTAGGGGG - Intronic
903036055 1:20493286-20493308 CCTGCCTTGGAGCCTGTGGAAGG - Intergenic
903488299 1:23707884-23707906 GCCGCTGTGCAGGCTGTGTAGGG + Intergenic
904327682 1:29738218-29738240 GCTGAGATGCATGCTGGGGATGG - Intergenic
904359903 1:29964431-29964453 GCTGCCATGGAGGTTTTGCAGGG - Intergenic
904866332 1:33581915-33581937 ACTGCCATGCAAACTGTGAAGGG + Intronic
904969525 1:34408217-34408239 ACTTCCAGGAAGGCTGTGGAAGG - Intergenic
906126126 1:43428028-43428050 GGTTCCATCCAGGCTGAGGATGG - Exonic
906135000 1:43492624-43492646 GCTACCCTGGAGGCTGAGGAAGG - Intergenic
906718743 1:47990277-47990299 TCTGCCATGCAGGGAGTTGAAGG + Intronic
906934935 1:50206234-50206256 GCTTTCATGAAGGCTGTGGAAGG - Intergenic
907850393 1:58249967-58249989 GCTGCCGCGGCGGCTGTGGAGGG - Intronic
910459836 1:87436989-87437011 GCTACTCTGCAGGCTGTGGTGGG + Intergenic
911165658 1:94722326-94722348 GCAACCAGGCAGGCTGTGGGTGG - Intergenic
911231297 1:95364333-95364355 TATGCTATGCATGCTGTGGAGGG + Intergenic
912001572 1:104842135-104842157 GCTACTATGGAGGCTGAGGAAGG - Intergenic
912331504 1:108824231-108824253 CCTGTCTGGCAGGCTGTGGACGG + Intronic
912491203 1:110063809-110063831 GGTGGCAAGCAGGCTGGGGATGG - Intronic
913551194 1:119918462-119918484 GCTGCCCGCCTGGCTGTGGAGGG - Exonic
914899684 1:151705111-151705133 GCTGCCATCCAGGCCATGAATGG - Exonic
915226443 1:154415137-154415159 CCTGTCCTGCAGGCTGAGGACGG - Intronic
915493155 1:156262913-156262935 GCTGCCATGGAGGCTGGGTGGGG - Intronic
915732237 1:158061864-158061886 GTTGCATAGCAGGCTGTGGATGG + Intronic
916398514 1:164419093-164419115 GAGGCCATGCAGGCTGTGCTGGG - Intergenic
916895310 1:169156199-169156221 GCTGCTAGGGAGGCTGAGGAGGG + Intronic
917444571 1:175096180-175096202 GGGGTCATGCAGGCTGTGGGAGG + Intronic
919879216 1:201891251-201891273 TCTGCCAAGCAGGGTGTGGGAGG + Intronic
920571166 1:207019067-207019089 GCCGCCCTGTAGGCTGGGGATGG - Exonic
921049284 1:211499608-211499630 GCTGCCCTGTAGGCAGAGGAGGG - Intergenic
921866481 1:220092461-220092483 GCTGCTTTGGAGGCTGTGGTGGG - Intergenic
922189456 1:223304488-223304510 GTTACCATGCAGGGTGTGTATGG - Intronic
922532513 1:226355232-226355254 GCTGCTAGGGAGGCTGTGGTCGG - Intergenic
922579167 1:226684394-226684416 CCTTCCATGCAGGCTTTCGAGGG - Intronic
923087113 1:230710285-230710307 TCTGCCCTGCAGGCTGTACAGGG - Exonic
923248130 1:232153877-232153899 GAGGCCTTGCTGGCTGTGGAGGG + Intergenic
923519256 1:234723259-234723281 AAGGCCATGCTGGCTGTGGACGG - Intergenic
923685921 1:236153926-236153948 GATGCCAGGATGGCTGTGGAGGG + Intronic
924435656 1:244038741-244038763 TCTTCCCTGCAGCCTGTGGAAGG + Intergenic
1062823441 10:551389-551411 GGTGCCACGGAGGCTGTGGAAGG + Intronic
1063048922 10:2424242-2424264 GCTGGCATTCTGGCTGTGGGCGG + Intergenic
1063298798 10:4833294-4833316 GGTGCCATGCTGGCTCTGGGTGG + Intronic
1063451682 10:6154355-6154377 GCTGCCCTGGAGGCTGAGGCAGG - Intronic
1064450540 10:15438464-15438486 GCTACCATGGAGGCTGAGGCAGG + Intergenic
1064970744 10:21063958-21063980 GCTACCAGGAAGGCTGAGGAAGG + Intronic
1065721967 10:28636045-28636067 GCTGCATTGGAGGCTGTGGATGG + Intergenic
1066536059 10:36393361-36393383 GCTGCTCTGCAGGCTGAGGCAGG + Intergenic
1067426993 10:46217876-46217898 TCTGCCAGGCAGGCTGAGCAGGG - Intergenic
1067751081 10:48971668-48971690 GGTGCCATGCAGGGCATGGAGGG + Intronic
1068655391 10:59569574-59569596 GCTACCAGGAAGGCTGAGGAAGG + Intergenic
1070973601 10:80587389-80587411 GCTGCTAGGCAGGCTGAGGCAGG - Intronic
1071906484 10:90179999-90180021 GCATCCATGCAGACTGTGGAAGG - Intergenic
1074122471 10:110503103-110503125 GCTGCCAAGCATCCTGTGGCTGG - Intronic
1074700148 10:116085556-116085578 ACAGCCATGCAGGCAGAGGAGGG + Intronic
1075388510 10:122075326-122075348 GGTGCCATGAAGGATGGGGAAGG + Intronic
1075718294 10:124569706-124569728 GATGCCATGAAGGCTGTGAAGGG + Intronic
1076527579 10:131121935-131121957 GCTGACAGACAGTCTGTGGAGGG + Intronic
1077064446 11:634198-634220 GCTGCTTGGCAGGCTGAGGAAGG - Intergenic
1077123165 11:920167-920189 GCTGCCAGGCTGGCTGGGCAGGG + Intergenic
1077233240 11:1468070-1468092 GCTGCCTTGGAGGCTCTGGCTGG + Intergenic
1077359947 11:2136463-2136485 GTGGCCCTGCAGCCTGTGGAGGG - Intronic
1077969757 11:7177003-7177025 GCTGCCATGCAGTCAGTGTCGGG - Intergenic
1078147272 11:8730468-8730490 GCTGCCATGCCCCCTGAGGAAGG + Exonic
1080522868 11:33082891-33082913 GCTACTCTGCAGGCTGTGGTGGG - Intronic
1080526137 11:33121592-33121614 GCTGCCATGAAGGCTTTAGTAGG + Intronic
1080917211 11:36672473-36672495 GCTACCAGGGAGGCTGTGGCAGG - Intergenic
1083248167 11:61446305-61446327 GCTGGCATGCAGGCTTTGCCTGG + Exonic
1083390610 11:62347127-62347149 GCTGATATACAGGTTGTGGAGGG - Intronic
1083840577 11:65302017-65302039 GCTGTCAGGCAGGCTCTGGGTGG - Intronic
1084175050 11:67418638-67418660 GCTGCCATGCTGAATGGGGATGG + Intronic
1084419595 11:69053686-69053708 GCTGGCAGGAAGGCTGTGGCTGG - Intronic
1084470648 11:69357185-69357207 GCTGCCTTGGAGGGTGGGGAAGG - Intronic
1084700299 11:70782471-70782493 GCTGCCCTGCTGTCTGTGGGAGG + Intronic
1084731686 11:71077698-71077720 GCTGCCATGCAGGGGGGTGAGGG + Intronic
1086341843 11:85855193-85855215 CCGCCCCTGCAGGCTGTGGAGGG + Exonic
1088127494 11:106446513-106446535 GCTGCCAGGAAGATTGTGGAAGG + Intergenic
1088312398 11:108473921-108473943 GGTGGCATGGAGACTGTGGAGGG - Exonic
1088486818 11:110348666-110348688 GCTGCCAAGCAGGCTGAGGCAGG + Intergenic
1088503420 11:110506894-110506916 GTTTCCCTGCAGGCTCTGGAGGG - Intergenic
1088792359 11:113237053-113237075 TCTGCCATGCATGCTAGGGAAGG + Intronic
1089145895 11:116329504-116329526 GCTGCCAGGGAGGCTGAGGCAGG + Intergenic
1089499219 11:118922824-118922846 GCTGCCATGCTGGCTGTTTCTGG - Intronic
1090405801 11:126475274-126475296 GTTCCCATGCAGGCTGAGGCTGG - Intronic
1090915713 11:131160377-131160399 GCTGGGATGCTGGCTGGGGAAGG + Intergenic
1091222304 11:133936672-133936694 GCTTCCATCCAGGCTGCTGAGGG + Intronic
1091223498 11:133944586-133944608 GTTGCCTTGCAGGCTGGGGCAGG - Intronic
1091993771 12:4977050-4977072 GCTGCCCTGAAGGCTGGGGAAGG + Intergenic
1091995115 12:4987264-4987286 GCTGCCAGGCAGGCAGGAGAAGG - Intergenic
1092026916 12:5248381-5248403 TGTGCCAGGCTGGCTGTGGAGGG + Intergenic
1092039198 12:5368625-5368647 TCTGCAGTGCAGGCTGTGGAGGG - Intergenic
1092056098 12:5509618-5509640 GATGCCCTGCAGTCTTTGGAAGG + Intronic
1094034737 12:26056071-26056093 GCTACTATGGAGGCTGAGGAAGG + Intronic
1094633254 12:32198747-32198769 GCTGGCAAGAAGGATGTGGAAGG - Intronic
1094676601 12:32626957-32626979 GCTGCTAGGCAGGCTGAGGCAGG - Intronic
1095054120 12:37580360-37580382 GCTACTATGTAGGCTGAGGAGGG + Intergenic
1095275567 12:40278662-40278684 ATGGCTATGCAGGCTGTGGATGG + Intronic
1096256272 12:50064009-50064031 ACTGCCATGCAGACAGGGGAAGG + Intronic
1096269912 12:50156798-50156820 GCTACCATGGAGGCTGAGGCAGG + Intronic
1096874829 12:54619918-54619940 GCTACCAGGCAGGCTGAGGCAGG - Intergenic
1097117459 12:56708255-56708277 GCTACCAGGGAGGCTGTGGCAGG - Intergenic
1097277752 12:57824681-57824703 GCTCCCATAGAGGCTGTGGCTGG - Intronic
1101632649 12:106510731-106510753 CCTGCCATGAGGGCTGAGGAAGG - Intronic
1101707031 12:107230382-107230404 GCCTTCATGCAGGCTATGGAGGG - Intergenic
1102819189 12:115893630-115893652 GCTGCCATTGAGGCTGGGGAAGG - Intergenic
1102916696 12:116759750-116759772 GTTGCCATGGAGGTGGTGGAGGG + Intronic
1103432955 12:120903885-120903907 GCTCCGCTGCAGGCTGTGGCCGG + Exonic
1103780953 12:123398658-123398680 GCAGCCATGCAAGCTGTTGCTGG + Intronic
1103818090 12:123674987-123675009 GCTACTATGGAGGCTGTGGCAGG - Intronic
1103936833 12:124481476-124481498 CCTGCCATGCAGGCCCTGGAGGG + Intronic
1103941044 12:124501385-124501407 GAAGCCATGCAGTCTGTGGTGGG - Intronic
1104550949 12:129756864-129756886 GCTTGCCTTCAGGCTGTGGAAGG + Intronic
1104770021 12:131355764-131355786 GAGGCCAGGCAGGCTTTGGAAGG + Intergenic
1105477257 13:20739317-20739339 GTTGCCTTCCATGCTGTGGAAGG - Intronic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1106568649 13:30907388-30907410 GGGGCCATGTGGGCTGTGGAAGG + Intronic
1108290434 13:48954941-48954963 GCTGAAAAGGAGGCTGTGGAAGG - Intergenic
1109340600 13:61053347-61053369 GCTGCTCTGCAGGCTGAGGCAGG - Intergenic
1110212777 13:72992697-72992719 GCTGCCAAGGAGGCTGAGGTGGG + Intronic
1110547907 13:76777089-76777111 GCTGCTCTGAAGGCTGAGGAAGG + Intergenic
1110996967 13:82122695-82122717 GCTGCTAGGGAGGCTGAGGAAGG - Intergenic
1111591623 13:90354386-90354408 GCTGCCAGGGAGGCTGAGGCAGG + Intergenic
1112366056 13:98756423-98756445 GCTCCCTGGCAGGCTGTGTAGGG + Intergenic
1113110877 13:106822319-106822341 GCTGCCCTGGAAGCTGCGGACGG - Intergenic
1113333029 13:109349816-109349838 GCTGCAATGTTTGCTGTGGATGG + Intergenic
1113385343 13:109843046-109843068 TCTGCCAGGCGGGGTGTGGACGG - Intergenic
1113472853 13:110559102-110559124 CCTGCAAGGCAGGCAGTGGATGG - Intronic
1114199628 14:20507857-20507879 GCTACCAGGCAGGCTGAGGTGGG - Intronic
1114224100 14:20723121-20723143 GATGCCATGCTGGCCGGGGAGGG + Intergenic
1115475363 14:33808193-33808215 GCTACCAGGGAGGCTGAGGAAGG + Intergenic
1115544488 14:34453427-34453449 GCTGCCATTGAGGCAGTGTAGGG - Intronic
1115587861 14:34833128-34833150 GCTGCTAGGGAGGCTGTGGTGGG + Intronic
1116455558 14:45117081-45117103 GCTACCCTGGAGGCTGTGGCAGG - Intronic
1116953558 14:50900118-50900140 GCTACTATGGAGGCTGAGGAGGG + Intronic
1118425019 14:65651025-65651047 GCTGCCATGGAAACTGTGGATGG + Intronic
1118985248 14:70748880-70748902 GTTGTCCTGCAGGCAGTGGAAGG + Exonic
1119270910 14:73303466-73303488 GCTGCTCTGGAGGCTGTGGCAGG + Intronic
1119758050 14:77132573-77132595 TCTGCCAGGCATGCTGTGGAAGG - Exonic
1120761765 14:88291767-88291789 CCTGTAATGCAGGCTGAGGAGGG + Intronic
1120827944 14:88971950-88971972 TCTCCCATGAAGGCTGGGGAAGG + Intergenic
1120853079 14:89188081-89188103 GCTTTCATGAAGGCTGTGGCTGG + Intronic
1121855259 14:97263595-97263617 GCTGCTCTGGAGGCTGAGGAAGG - Intergenic
1122054181 14:99081349-99081371 GCTGCCATGCCGGTTCTGGTGGG - Intergenic
1122594374 14:102879055-102879077 GGAGCCATGCAGGCTGCAGATGG + Intronic
1122625899 14:103085241-103085263 GCTGGCATGCAGGCAGTAGGGGG - Intergenic
1122784125 14:104156050-104156072 GGTGCCACGCTGGCTGTGGGTGG + Intronic
1122854758 14:104554720-104554742 CCTGCAATGCTGGCTGTGGGTGG + Intronic
1123492894 15:20796949-20796971 CCTGCCATGCAGCCTGAGGCTGG - Intergenic
1123549395 15:21366047-21366069 CCTGCCATGCAGCCTGAGGCTGG - Intergenic
1123857381 15:24427079-24427101 GCTGCCACGCAGGCTGGGCTTGG + Intergenic
1124184921 15:27516475-27516497 GCTCCCAGGCTGGCTGTGGAAGG - Intronic
1124403114 15:29367669-29367691 ACTGCCTTGCAGAATGTGGAAGG + Intronic
1124406705 15:29399100-29399122 GCTTCCTTGCAAGCTGTGGGTGG - Intronic
1124573464 15:30886460-30886482 GCTGCCCTGAAGGCTGAGGCAGG - Intergenic
1125521118 15:40348368-40348390 GCTGCCCTGCAGGGTGGGGAGGG - Intergenic
1127130328 15:55855592-55855614 GCTGCCATCCAGGCTGTGGCTGG + Intronic
1129269998 15:74414584-74414606 GCTGGCTTGCATGCGGTGGACGG + Exonic
1129514759 15:76150600-76150622 GCTGCCAGGCTGTCTGTGGCTGG - Intronic
1131556812 15:93406755-93406777 GCTGCTCTGGAGGCTGTGGCGGG + Intergenic
1131558004 15:93415833-93415855 CTTGGCATCCAGGCTGTGGAAGG + Intergenic
1131690067 15:94817379-94817401 GCGGCCATGCTGGCTGGGGGAGG - Intergenic
1132152717 15:99474072-99474094 GCGGCCATGCAGGCTGAGGCTGG + Intergenic
1202957726 15_KI270727v1_random:93265-93287 CCTGCCATGCAGCCTGAGGCTGG - Intergenic
1132493653 16:249187-249209 GCTTCCAGGCTGGCTGTGGGGGG + Intronic
1133083392 16:3342137-3342159 GCTGCCTGGGAGGCTGAGGAGGG + Intergenic
1133222729 16:4325823-4325845 GCTGCTCTGCAGGCTGAGGCAGG + Intronic
1133583357 16:7167521-7167543 CCTCCCATGCAGTCTTTGGAGGG + Intronic
1133625074 16:7563577-7563599 GCTGCTATGGAGGCTGAGGCAGG - Intronic
1133726876 16:8546001-8546023 GCTGCCTTGGAGGCTGAGGCGGG + Intergenic
1134206776 16:12244495-12244517 GCTGCTCTGGAGGCTGTGGCAGG + Intronic
1135610800 16:23865412-23865434 GCTGCCCTGGAGGCTGAGGTGGG - Intronic
1136020916 16:27439272-27439294 CATGCCATGCAGGCTGGGGCTGG - Intronic
1137546670 16:49409399-49409421 GCTGCCAAGCAGGGAGTTGAAGG - Intergenic
1138196528 16:55056602-55056624 GCTGGCATGCATGCTCTGGGTGG - Intergenic
1140039569 16:71397087-71397109 GGGGCCAAGCAAGCTGTGGAGGG + Intergenic
1140934002 16:79653807-79653829 GCTGCCCTGCCTGCTGTGGCTGG + Intergenic
1141521204 16:84580790-84580812 GCTCCCATGCAGCCTGTGAATGG - Intronic
1141521662 16:84584238-84584260 GCTGCCAGGCAAGCTGGGCAGGG - Intronic
1141711535 16:85702274-85702296 GCTGCTAAGCAGGCAGTGGAGGG + Intronic
1142014248 16:87735491-87735513 GTTCCCATGCAGGCAGTGAAAGG - Intronic
1144021975 17:11245699-11245721 GCTCCTGTGCAGGCAGTGGAAGG - Intronic
1144103166 17:11961957-11961979 GCTGCCAGGCCTGCTGTGGAAGG - Exonic
1144155087 17:12492326-12492348 TAAGCCATGCAGGCTGTGGTGGG + Intergenic
1144596949 17:16577920-16577942 GCAGGCATGGAGGCTGTGCATGG + Intergenic
1144778025 17:17794660-17794682 ACTGCCGTGTAGGCTCTGGAAGG - Exonic
1146323282 17:31863812-31863834 GCTGCCCTGGAGGCTGAGGCAGG - Intronic
1146373840 17:32281351-32281373 GCTGCCTCCCAGGCTGGGGAGGG - Intronic
1146655362 17:34631735-34631757 GATGCCCTGAAGGCTCTGGAAGG - Intronic
1146725854 17:35155224-35155246 GCTGCCATGCAGGTTAGAGAGGG - Intronic
1146793425 17:35765560-35765582 GCAGCCCTGCAGGCTGAGGGTGG - Intronic
1147744379 17:42686246-42686268 CCTGGCATTCAGGCTGTGGGTGG + Intronic
1147968882 17:44209055-44209077 GCTACTCTGGAGGCTGTGGAAGG + Intronic
1148204957 17:45774406-45774428 GCGTCCATGCAGGCTGCAGAAGG - Intergenic
1149078161 17:52621825-52621847 ACTGTCATGCAGGCTATGAAGGG + Intergenic
1149370652 17:55990855-55990877 GCTGTAGTGGAGGCTGTGGAGGG - Intergenic
1149657499 17:58318076-58318098 GCTTGCAGGCAGGCAGTGGAGGG + Intronic
1150270782 17:63863261-63863283 GCTGCCAGGGAGGCTGAGGCAGG - Intergenic
1150522952 17:65888822-65888844 GCTTCCATGCAGCTTGTGGTTGG + Intronic
1150877156 17:68982892-68982914 GCTACCATGGAGGCTGAGGCAGG + Intronic
1152163716 17:78686891-78686913 GCTACCAGGGAGGCTGTGGCAGG - Intronic
1152408519 17:80110668-80110690 GCTTCCATGCAGGCCCTGGGTGG + Intergenic
1152679591 17:81659485-81659507 GCTGCCAGGGAGGCTGCGGCAGG + Intronic
1152731875 17:81976632-81976654 GCTGCCCAGTAGCCTGTGGAAGG - Intergenic
1152762487 17:82116341-82116363 CCTGCCATGCACCCTGTGGGTGG - Intronic
1152776850 17:82207219-82207241 GCTACCAGGCAGGCTGAGGTGGG + Intronic
1153358567 18:4166445-4166467 GCTGCTATGGAGGCTGAGGCAGG + Intronic
1154059125 18:11042346-11042368 GCAGGCCTGCAGGCTGGGGATGG + Intronic
1154240258 18:12646930-12646952 GCTACCATGGAGGCTGAGGCAGG + Intronic
1154310773 18:13264626-13264648 ACTGCCATGCAGGTTGAAGACGG + Intronic
1154450435 18:14471482-14471504 CCTGCCATGCAGCCTGAGGCTGG - Intergenic
1155167284 18:23241417-23241439 GCTACCCTGCAGGCTGAGGCAGG + Intronic
1156257401 18:35410921-35410943 GCTCCCAAGCAAGCTGTTGAAGG + Intergenic
1156478352 18:37420584-37420606 TCTGCCTGGCAGGCTGTGGCAGG + Intronic
1157406381 18:47425374-47425396 GCTGCATTGGAGGCTGTTGATGG + Intergenic
1157552510 18:48591271-48591293 GGTCCCAGGCTGGCTGTGGATGG + Intronic
1157566640 18:48683035-48683057 TCTGCCCAGCACGCTGTGGATGG - Intronic
1158345333 18:56510678-56510700 GCTGCTCTGGAGGCTGAGGAAGG - Intergenic
1159809644 18:73002315-73002337 GCTGCTCTGCAGGCTGAGGCAGG - Intergenic
1160153154 18:76410514-76410536 GCAGGAATGCAGGCTGTGTAGGG - Intronic
1161051618 19:2166866-2166888 GCTCCCAGGCAAGCTGAGGATGG - Intronic
1161250606 19:3278076-3278098 GCTCCCATGCAAGGCGTGGATGG - Exonic
1161535755 19:4817709-4817731 GCTGCGGTGCAGGCTGAGGAAGG + Exonic
1161852761 19:6746168-6746190 GCTGCCTCGAAGGCTGCGGAAGG - Intronic
1161976023 19:7608052-7608074 GCGGTCATGCAGGCTGGGCAGGG - Intronic
1162707164 19:12563692-12563714 GCTGCCAGGGAGGCTGAGGCAGG + Intronic
1163036803 19:14574403-14574425 GCAGCTGTGCAGGCTGTGCACGG - Intergenic
1163182541 19:15614761-15614783 CCTGCCAGGCTGGCAGTGGAGGG + Intergenic
1163668529 19:18614094-18614116 GCTTCCACGCAGGCTGTGGGAGG - Exonic
1164573977 19:29394689-29394711 GCTGCCCAGGAGGCTGAGGAAGG - Intergenic
1164624279 19:29715806-29715828 GCTGCCAGTGAGGCTGAGGAGGG + Intergenic
1165024503 19:32949797-32949819 GCTGCACTGCAGGCAATGGAAGG + Intronic
1165911515 19:39231432-39231454 GCTACTATGCAGGCTGAGGCAGG - Intergenic
1166646391 19:44534925-44534947 GCTGTCATTCAGGCTGTGGTTGG + Intergenic
1166666229 19:44682136-44682158 GCTACCAGGGAGGCTGAGGAGGG + Intronic
1166751471 19:45165760-45165782 GCTGCCATGTAGTGTCTGGAGGG + Intronic
1166997760 19:46727953-46727975 GCTGACCTGCGGGATGTGGATGG - Exonic
1167309184 19:48727079-48727101 GCGGCCACTCATGCTGTGGATGG - Exonic
1167989335 19:53344740-53344762 GCTACCTGGGAGGCTGTGGAAGG - Intronic
1168236589 19:55067501-55067523 GCTGGCATGCAGGGTATGGGAGG + Intronic
1168537191 19:57180843-57180865 GCTACCCTGCAGGCTGAGGTGGG + Intergenic
925328931 2:3043390-3043412 GCGGCCAGGCATGCTGTGGCAGG + Intergenic
925429446 2:3778455-3778477 GAGGGCAGGCAGGCTGTGGAGGG + Intronic
926364279 2:12118781-12118803 GGTGACAATCAGGCTGTGGAAGG - Intergenic
926693566 2:15754498-15754520 GCTGCCATGGAGGCCGTGCTGGG + Intergenic
926762627 2:16292233-16292255 GCTGCCACGCACATTGTGGAGGG - Intergenic
929311760 2:40433845-40433867 GCTTCCATGCAGGGTCAGGAGGG + Intronic
929621946 2:43364110-43364132 GCTACCAGGGAGGCTGAGGAGGG + Intronic
930106523 2:47644636-47644658 GTTGCAATGCAGACTGTGGTTGG + Intergenic
930234412 2:48875061-48875083 ACTACCATGCAGGCTAAGGAAGG + Intergenic
930662704 2:54070846-54070868 GCTACCAGGCAGGCTGAGGTGGG - Intronic
932998879 2:76895798-76895820 ACTTCCATGCAGTCTGTGGAGGG + Intronic
933006378 2:77000835-77000857 GCCTCCATGGTGGCTGTGGAGGG + Intronic
933450252 2:82440290-82440312 ACTGCCATGCAGTCTGCAGAAGG + Intergenic
934072447 2:88396919-88396941 GCTGCCTAGGAGGCTGAGGATGG + Intergenic
934560099 2:95308730-95308752 GCTTCCCTGCAGGCTGTGACTGG + Intronic
934575163 2:95395627-95395649 GCTGACAGGCTAGCTGTGGAAGG + Intergenic
934613221 2:95755901-95755923 GCTCCCAGGCAGGGTGTGCAGGG - Intergenic
934841048 2:97624339-97624361 GCTCCCAGGCAGGGTGTGCAGGG + Intergenic
936055231 2:109257480-109257502 GCTGCCCTGAAGTCTGTGAAGGG + Intronic
936351073 2:111713051-111713073 CCTGCCATGGAGGCTGTGCAGGG + Intergenic
936521139 2:113212825-113212847 GCAGCCAGCCAGGCTGTGGAGGG - Intergenic
936587395 2:113770334-113770356 GCTACCAAGGAGGCTGAGGAAGG - Intergenic
937012061 2:118571890-118571912 GCATGCATGCAGGCTGGGGAGGG - Intergenic
937095203 2:119230827-119230849 GCTGGCGTGCAGGCTGCGGGAGG + Exonic
937237550 2:120439944-120439966 GCTATGATGCAGGTTGTGGAGGG - Intergenic
937958627 2:127438074-127438096 GAGACCATGGAGGCTGTGGAAGG + Intronic
938015852 2:127866653-127866675 TCTGCCCTGCAGGCTGTGGATGG - Intronic
938096209 2:128465770-128465792 CCTGCCCTGCAGGGTGGGGAAGG + Intergenic
938101028 2:128498348-128498370 GAGGGCATGCAGGCTGCGGAGGG + Intergenic
938284206 2:130095137-130095159 GCTGCTATGGAGGCTGAGGCAGG - Intronic
938334847 2:130483704-130483726 GCTGCTATGGAGGCTGAGGCAGG - Intronic
938354974 2:130636965-130636987 GCTGCTATGGAGGCTGAGGCAGG + Intronic
938431401 2:131243754-131243776 GCTGCTATGGAGGCTGAGGCAGG + Intronic
940133595 2:150411635-150411657 GCTGTCAGGCAGGCTGAGGAAGG - Intergenic
940541026 2:155018308-155018330 GCTACCAGGGAGGCTGAGGAAGG - Intergenic
941361491 2:164557260-164557282 GGTGCCAGGCAGCCTGAGGAGGG + Intronic
941526281 2:166610568-166610590 GCGGCCAGGCAGGCAGTAGATGG + Intergenic
941800651 2:169656176-169656198 GCTACCAGGCAGGCTGAGGTGGG + Intronic
942232305 2:173872007-173872029 GGGGCCATGGAAGCTGTGGATGG - Intergenic
944749095 2:202689804-202689826 GCTGCTATGGAGGCTGAGGTGGG + Intronic
945532024 2:210967473-210967495 GTGGTCATGCAGGCTATGGAGGG + Intergenic
946426656 2:219602001-219602023 GAGGCCATGCAGACAGTGGAGGG - Exonic
946983506 2:225246098-225246120 GCTGCCATGCTAACTCTGGAGGG - Intergenic
947721447 2:232371825-232371847 GCTGCCAGGGAGGCTGAGGCAGG - Intergenic
947841322 2:233209586-233209608 GCTGCCCTCCAGGCTGCGGGGGG - Intergenic
948164536 2:235851017-235851039 GCTCCCAGGCAGGCTGTTCATGG + Intronic
948200453 2:236126575-236126597 TCTGGCATTCAGGTTGTGGAAGG - Exonic
948272860 2:236687565-236687587 GCTTCCATGCAGGCTGAGGAAGG - Intergenic
948300196 2:236900325-236900347 GCTCCCATGTAGGCTGGGCATGG + Intergenic
948308568 2:236968483-236968505 GCTGACAGCCAGGCTTTGGAAGG - Intergenic
948528528 2:238588369-238588391 TCTCCCATGCAGGCTGTAGTGGG - Intergenic
949048794 2:241885877-241885899 GCAGGGCTGCAGGCTGTGGACGG + Intergenic
1169430039 20:5528263-5528285 GCTGCTCTGGAGGCTGAGGAAGG + Intergenic
1170593289 20:17787279-17787301 CCTGCCCTGCAGCCTTTGGAGGG - Intergenic
1170808327 20:19653709-19653731 GCTGGCACGCAGTCTGAGGAAGG - Intronic
1171243331 20:23588597-23588619 GCAGCCATGAATGCTGTGTATGG + Intergenic
1172250814 20:33477836-33477858 TCTGCACTGGAGGCTGTGGAAGG + Intergenic
1172458495 20:35096240-35096262 GCTGCCCTGGAGGCTGAGGCAGG + Intergenic
1173171320 20:40726362-40726384 GCTGCAAAGCAGGCTGTCCAAGG - Intergenic
1173617117 20:44410493-44410515 GCTTCCCAGCAGGCTGAGGAGGG - Intronic
1173814846 20:45980624-45980646 GCTGCCTGGGAGGCTGTGGTGGG - Intergenic
1175414405 20:58792420-58792442 ACTGCCATCCAGGCTCTGGCTGG - Intergenic
1175426692 20:58871916-58871938 GCTGCCAAGGAGGGTGTGGCTGG + Intronic
1175467198 20:59197442-59197464 GCTGGCACACAGGCTATGGAAGG - Intronic
1175897721 20:62346715-62346737 GGTGCCATCCAGGCTCTGGCTGG + Exonic
1175958466 20:62623198-62623220 GCGGCCTCGGAGGCTGTGGAGGG - Intergenic
1175971260 20:62687804-62687826 GCTGCCCTGGAGGCTGTGCTAGG - Intergenic
1175994449 20:62805796-62805818 GCGGCCAGGCAGGCTGGGCAGGG + Intronic
1176012436 20:62906222-62906244 GCTGCCAAGCAGGCGCAGGATGG - Intronic
1176089817 20:63313791-63313813 GCTGACCTGCAGGCTGTCGGGGG - Exonic
1178285392 21:31321462-31321484 GCTACCCTGGAGGCTGAGGAAGG - Intronic
1178528271 21:33351420-33351442 GCTCCCACGGAGGCTGTGCATGG - Intronic
1178717347 21:34978047-34978069 GCTGCCCTGGAGGCTGAGGCAGG - Intronic
1178943532 21:36927205-36927227 GCTGAGATGCAGGCTGTGGGCGG - Intronic
1179641732 21:42752163-42752185 GCCTACATGGAGGCTGTGGAAGG - Intronic
1180025845 21:45161611-45161633 GATGCCATGCACACTGTGGATGG + Intronic
1180057597 21:45366986-45367008 GCGGCCCTCCAGGCTCTGGAGGG + Intergenic
1180130122 21:45821740-45821762 GCTGTCATGCAGACTGGGGTTGG + Intronic
1180198193 21:46209661-46209683 GCAGCCATGCTGGCCGTGCAAGG - Intronic
1180760885 22:18203388-18203410 GCTGCCATGCAGACAGGTGAGGG + Intergenic
1180774784 22:18421272-18421294 GCTGCCATGCAGACAGGTGAGGG - Intergenic
1180843561 22:18970218-18970240 GCGGCCCTGCAGGCGGCGGAGGG - Intergenic
1181059073 22:20273343-20273365 GCGGCAAGGGAGGCTGTGGAGGG - Intronic
1181552344 22:23647780-23647802 GCTGCCAGGGAGGCTGAGGAGGG - Intergenic
1181610208 22:24006933-24006955 CCTGTCATGCAGGCTGGGGCAGG - Intergenic
1183377898 22:37475714-37475736 GAGGGCATGCAGGCTGGGGAGGG - Intronic
1183556135 22:38528672-38528694 GCTGCCTTGGAGGCTGAGGTGGG + Intronic
1183838255 22:40475423-40475445 GCTACCAGGGAGGCTGTGGCAGG + Intronic
1184256894 22:43292225-43292247 GCTGCCAAGATGGCTGTGGAAGG + Intronic
1184451505 22:44585541-44585563 CCTGCCCTGCAGGCCATGGAGGG + Intergenic
1184470580 22:44693348-44693370 GCTACCAGGGAGGCTGTGGGAGG + Intronic
1184725742 22:46344648-46344670 GCTGTCAGGCACGCTGTGGAAGG + Intronic
1184824460 22:46938695-46938717 GCTACCCTGCAGGCTGAGGCAGG - Intronic
1184960544 22:47925337-47925359 GCTGCCATCCAGGATGGGGGAGG + Intergenic
1185176760 22:49332062-49332084 CCAGCCATGCAGCCTGTGCACGG + Intergenic
1185179448 22:49350636-49350658 GGTGCCCTGGAGGATGTGGAGGG - Intergenic
950149951 3:10679152-10679174 GCTGCAATCCAGGATGTGGCTGG - Intronic
950426762 3:12928517-12928539 GCTGTCAGGGAGGCTGTTGAGGG - Intronic
950537632 3:13589267-13589289 GCTCCCTGGAAGGCTGTGGAAGG + Intronic
953135395 3:40177366-40177388 CCTGACCTACAGGCTGTGGAGGG + Intronic
954215868 3:49124248-49124270 ACTGCCGTGCCGGCTTTGGAGGG - Exonic
954538718 3:51380066-51380088 GCTGGCATGAAGTCTGTGCAGGG + Intronic
954778780 3:53045032-53045054 GCTGAAAAGGAGGCTGTGGAGGG - Intronic
954796483 3:53163844-53163866 GCTGTCATGCAGGCTGAACAGGG - Intronic
954902009 3:54027939-54027961 GCTGCCAGGGAGGCTGGGAAAGG - Intergenic
955376130 3:58398641-58398663 GGTGCCAGCCTGGCTGTGGAGGG - Intronic
955672671 3:61418371-61418393 GCTGCTATGGAGGCTGAGGCAGG - Intergenic
956250031 3:67226212-67226234 TTTGGCATGCAGCCTGTGGAAGG - Intergenic
957819171 3:85347751-85347773 GCTACTATGCAGGCTGAGGCAGG - Intronic
959229443 3:103629717-103629739 GGTGCCAGGCAGGTTGGGGAAGG + Intergenic
959268556 3:104174383-104174405 GCTGCCAGGGAGGCTGAGGCAGG - Intergenic
960839840 3:121945877-121945899 GCTGCTAGGGAGGCTGAGGAGGG - Intergenic
961641003 3:128364820-128364842 GCTGCCATGCAGGCTGTGGAGGG - Intronic
968285290 3:197505074-197505096 GCTGCCAAGCAGGCGGTGCTGGG - Intergenic
968472542 4:788637-788659 GCTGCCCTTCCCGCTGTGGATGG - Intronic
968726145 4:2248674-2248696 CCTGCCCTGCAGGCTGTAGGGGG - Exonic
968751581 4:2392260-2392282 CCAGCCAGGCTGGCTGTGGAGGG - Intronic
969065687 4:4478690-4478712 ACTGCCATGCATCATGTGGAGGG + Intronic
969131872 4:4996091-4996113 GAAGCCAGCCAGGCTGTGGAGGG - Intergenic
969181636 4:5446452-5446474 GCTGCTCGGCAGGCTGAGGAAGG + Intronic
969657894 4:8508587-8508609 CCGGCCATGAAGGCTGAGGATGG - Intergenic
970526374 4:16936652-16936674 GCTGCTAGGGAGGCTGAGGAGGG + Intergenic
971290722 4:25336596-25336618 GCTGCTGGGGAGGCTGTGGAAGG - Intronic
971512767 4:27447550-27447572 GCTGCTAAGCAGGCTGAGGCAGG + Intergenic
971884333 4:32423851-32423873 ACTGCAATGCAGGCCCTGGAGGG + Intergenic
972304333 4:37817473-37817495 GCTACCATGGAGGCTGAGGCAGG + Intergenic
972524064 4:39891143-39891165 GCTGCTATGGAGGCTGAGGCAGG - Intronic
974318446 4:60312362-60312384 GCTACCCTGGAGGCTGAGGAAGG - Intergenic
974915412 4:68172971-68172993 GCTGCTAGGGAGGCTGAGGAAGG + Intergenic
977067811 4:92341481-92341503 ATTGCAATGTAGGCTGTGGATGG - Intronic
978838425 4:113181685-113181707 GAGGCCGTGCATGCTGTGGAGGG + Intronic
979710588 4:123774248-123774270 CCTGCCATGAAGCCTCTGGAAGG + Intergenic
980125562 4:128770683-128770705 GCTACCATGGAGGCTGAGGAAGG + Intergenic
980579373 4:134729869-134729891 GCTGCCAAGAAGGTTGGGGATGG + Intergenic
982468416 4:155759180-155759202 GCTGCCAGGCCGGCCGAGGAGGG - Intronic
982844636 4:160234434-160234456 GCTGTTCTGCAGGCTGTGGTGGG - Intergenic
983881199 4:172935165-172935187 GCTGCCCTGCAGACTGTGAGTGG + Intronic
983993919 4:174158452-174158474 GCCCTCATGCAGGTTGTGGATGG + Intergenic
985244522 4:187966449-187966471 GCTACCCTGGAGGCTGAGGAGGG + Intergenic
985950341 5:3217943-3217965 GCTGCCATATGGGCTATGGAAGG + Intergenic
986702793 5:10427956-10427978 GCTGCCCTGCAGGCTGATGCAGG + Intronic
988521686 5:31951177-31951199 GCTACCAGGGAGGCTGTGGGTGG - Intronic
988973043 5:36488784-36488806 GCTACCCTGGAGGCTGAGGAAGG - Intergenic
989193760 5:38695823-38695845 GCTTCCAAGCAGGCTGTGGGCGG + Intergenic
990638976 5:57761512-57761534 GCTGCCATGCTGGCTGCAGCAGG + Intergenic
991405024 5:66293324-66293346 GGTGACATGCAGCCTGAGGACGG + Intergenic
992231723 5:74670638-74670660 GCTGTCAGTCAGGCTGTGGATGG + Intronic
992618433 5:78568793-78568815 GCTCCCATTCTTGCTGTGGATGG - Intronic
992769416 5:80033622-80033644 GCTGACAAGCATGCAGTGGAAGG + Intronic
992777263 5:80099245-80099267 GCTGTCAGGCAGGCTCTTGAGGG - Intergenic
995368227 5:111387991-111388013 GCTGCCATTCAGGCTATCCATGG - Intronic
996425061 5:123305196-123305218 GGGGCCAGGGAGGCTGTGGAAGG - Intergenic
996799135 5:127383354-127383376 GCTACCAAGCAGGCTGAGGTGGG + Intronic
997280633 5:132642039-132642061 GCTACCCTGCAGGAAGTGGAGGG - Intronic
997447854 5:133954665-133954687 ACTGTTTTGCAGGCTGTGGAGGG - Intergenic
997528736 5:134569565-134569587 GCTGACAAGCAGGCTGTGCAGGG + Intronic
998137340 5:139681094-139681116 CCTGACATGGAGGCTGTGGCAGG + Exonic
998209830 5:140187012-140187034 GCTGCCCTGGAGGCTGAGGCAGG + Intronic
998483092 5:142479342-142479364 GCTGCAAGGGAGTCTGTGGATGG + Intergenic
1001397106 5:171425353-171425375 GGTGGCATGCAGGCTGAGGCAGG - Intronic
1001916337 5:175563966-175563988 GCTGCTATGGAGGCTGAGGCAGG - Intergenic
1001976964 5:176007906-176007928 CCTGCCACGCAGGCTGGGAAAGG + Intronic
1002240464 5:177835874-177835896 CCTGCCACGCAGGCTGGGAAAGG - Intergenic
1002559427 5:180071630-180071652 GCTGACCTGCAGCCTGTGGCCGG - Exonic
1002795013 6:465265-465287 GCTGCCATGGACACTGTGGGGGG + Intergenic
1004178487 6:13361165-13361187 GCTGCCATGTAGGCTAAGGGGGG + Exonic
1005746469 6:28842721-28842743 GCTACTATGGAGGCTGAGGAAGG + Intergenic
1006650822 6:35549879-35549901 ACTGCCAGGCTGACTGTGGAAGG + Intergenic
1006761321 6:36464428-36464450 GCTGCTCAGGAGGCTGTGGAAGG - Intronic
1006796880 6:36737604-36737626 CCTGCCATGCACGCTGGGGCTGG + Intergenic
1007049321 6:38810478-38810500 GCTGCTAGGGAGGCTGTGGCAGG + Intronic
1007296196 6:40823225-40823247 GATGCCATTGAGGCTGTTGATGG + Intergenic
1007822422 6:44570488-44570510 CCTGCAATGCAGGCTGTCTATGG - Intergenic
1008976538 6:57434034-57434056 GCTGCCAGGGAGGCTGAGGCAGG - Intronic
1009601854 6:65811516-65811538 GCTGCTCTGGAGGCTGAGGAAGG - Intergenic
1009766253 6:68079660-68079682 GCTGCTAGGAAGGCTGAGGAGGG - Intergenic
1011043794 6:83059818-83059840 GAAACCAAGCAGGCTGTGGAGGG + Intronic
1011495533 6:87933597-87933619 CCTGGCATCCAGGATGTGGAGGG + Intergenic
1012531087 6:100237275-100237297 GCTCCAATGCAGGCGGTGGGAGG - Intergenic
1012965134 6:105666047-105666069 GCTACTATGGAGGCTGTGGTGGG + Intergenic
1014010294 6:116467721-116467743 GCTACCCTGGAGGCTGTGGTGGG + Intergenic
1014791838 6:125681477-125681499 GCTGCTCTGGAGGCTGAGGAAGG - Intergenic
1015134049 6:129847884-129847906 GCTACCAGGGAGGCTGAGGAAGG - Intronic
1015171968 6:130264166-130264188 GCTACCATGCAGCCTATGCATGG - Intronic
1015417734 6:132968858-132968880 GCTGCTAGGCAGGCTGAGGTGGG - Intergenic
1017547177 6:155465043-155465065 GCTTCCTTACAGGCTATGGATGG + Intergenic
1018405895 6:163482071-163482093 GCTGCTAGGTAGGCTGAGGAGGG + Intronic
1019064821 6:169288113-169288135 GCTTCCATGGAGTCTCTGGAGGG - Intergenic
1019272577 7:158697-158719 GCTGCCATGCTTCCTGTGCATGG - Intergenic
1019286973 7:228520-228542 ACTGCCATGGGGGCTGTGGAGGG + Exonic
1023091749 7:36624396-36624418 GCTGCCATTTAGGCTCTGCATGG - Intronic
1024516901 7:50266993-50267015 GCTGCAAGGCATGCTGGGGAGGG - Intergenic
1024667976 7:51564872-51564894 GCTGCCTTGAAGCCTGTGCAGGG + Intergenic
1025137353 7:56429495-56429517 GCTGCCAGGGAGGCTGAGGCAGG + Intergenic
1025220828 7:57106231-57106253 GCTGCTTTGCAGGCTGAGGCAGG - Intergenic
1025631641 7:63278049-63278071 GCTGCTTTGCAGGCTGAGGCAGG - Intergenic
1026524406 7:71141786-71141808 GCTACCAAGCAGGCTGAGGCAGG - Intronic
1026536660 7:71244162-71244184 GCAGCCAGGCAGGATCTGGACGG - Intronic
1027056041 7:75050168-75050190 GCTACCAGGGAGGCTGAGGAAGG + Intronic
1028952873 7:96656414-96656436 GCTGCCAAGGAGGCTGGGGTAGG - Intronic
1029192927 7:98784660-98784682 GCTGCCCTGGAGGCTGAGGCAGG + Intergenic
1032519066 7:132528958-132528980 GCTGCCATGAAGACTATGAAGGG + Intronic
1033243373 7:139699481-139699503 GCTGGGTTGGAGGCTGTGGATGG - Intronic
1035114991 7:156516988-156517010 GCTGTCATGGAGGCTGTGTGAGG + Intergenic
1035274764 7:157741125-157741147 GCCGTCATGGAGCCTGTGGAAGG - Intronic
1036690987 8:10944667-10944689 GGAGCCAGCCAGGCTGTGGAAGG - Intronic
1037552823 8:19991758-19991780 GATGCCATGGAGGCTCTGAAAGG - Intergenic
1037951132 8:23019356-23019378 GCCGCCCTGGAGGCCGTGGAGGG - Intronic
1039306262 8:36266675-36266697 GCTGATATGGAGGCTGTAGAAGG - Intergenic
1039472341 8:37821296-37821318 GCTGCCATGCGTTCTGTGTAAGG - Intronic
1039605002 8:38873064-38873086 GCTGCCCAGGAGGCTGAGGAGGG + Intergenic
1041521995 8:58767299-58767321 GCTGCCAGGCAGGCTTAGGAGGG + Intergenic
1043407747 8:79955592-79955614 GCTTCCATCCAGGTAGTGGATGG - Intronic
1046016090 8:108607021-108607043 GTTGCCATGCAGGCAGAGGCAGG - Intronic
1047211547 8:122844279-122844301 GCTGCCTTCGAGGGTGTGGATGG - Intronic
1048232083 8:132652237-132652259 TCTGCCAGGCAGGCTGAGGCTGG + Intronic
1048500355 8:134969724-134969746 GCTGCTATGGAGGCTGAGGCAGG - Intergenic
1049031866 8:140043973-140043995 GCTTACCTGCAGGCTGTGGCTGG - Intronic
1049216685 8:141411534-141411556 GCTGCCAAGCTGGCTGCGGAAGG - Intronic
1049218882 8:141419962-141419984 GCTGCCACCCAGGGTGTGGAGGG + Intronic
1049627670 8:143633231-143633253 GCTGCCATGCAAGATGAGGCTGG - Intergenic
1050387648 9:5108005-5108027 GCTGATAAGTAGGCTGTGGATGG - Intronic
1053251331 9:36576641-36576663 GCTGCTAGGGAGGCTGAGGAAGG - Intronic
1053358171 9:37464855-37464877 GCTGCCCTGCGGGATGTGGTCGG - Intronic
1056414377 9:86362205-86362227 GCTGCCATGCAGCCTATGCCTGG + Intergenic
1056492068 9:87118129-87118151 GCTGCTCTGCAGGCTGAGGCAGG - Intergenic
1057976440 9:99610434-99610456 GCTACAATGAAGGCTGCGGAGGG - Intergenic
1058773936 9:108265657-108265679 GCTCCCAGGAAGGCTATGGATGG - Intergenic
1060045015 9:120333011-120333033 GCTGCCATGCAAGCTTTGGAAGG + Intergenic
1060478494 9:124002037-124002059 GCTGCCAAGCAGGCTGGGGATGG + Intronic
1061238811 9:129357594-129357616 GCTGCCCTGCTCGCTGGGGAAGG - Intergenic
1061279212 9:129587412-129587434 GCTGCCAGGGAGGCTGAGGCAGG + Intergenic
1061544782 9:131298412-131298434 GATGCCCTGCAGGCTGCGAAGGG - Intronic
1061594304 9:131619066-131619088 GCTGCCGTGCCGGCTGAGAAAGG + Intronic
1061789707 9:133052490-133052512 GCAGCCCAACAGGCTGTGGAGGG - Intronic
1061982214 9:134112330-134112352 GCTGCCAGGGAGGCTGAGGTAGG + Intergenic
1062037805 9:134390440-134390462 GCTGCCGTGCCTGCTGTGTAGGG - Intronic
1062054178 9:134462419-134462441 CCGGCCATGCTGGCTGTGGGAGG + Intergenic
1062293594 9:135811086-135811108 GATGCCAGGCAGGGTGAGGATGG - Exonic
1062390374 9:136331403-136331425 GGTGCCAGGGAGGCTGGGGAGGG + Intronic
1185452452 X:290067-290089 GCTGCCCGGGAGGCTGAGGAAGG - Intronic
1185550610 X:980616-980638 GCTGCCATGGAGGAGGAGGAGGG + Intergenic
1185550642 X:980720-980742 GCTGCCATGGAGGAGGAGGAGGG + Intergenic
1187472992 X:19585951-19585973 GCAGCCATGGAGTGTGTGGAGGG + Intronic
1189956283 X:46278086-46278108 GCTGCCCTGGAGGCTGAGGCAGG - Intergenic
1190626386 X:52342326-52342348 GCTGCCAGGGAGGCTGAGGCAGG + Intergenic
1191225706 X:58040662-58040684 GAGGCCATGCAGGATGGGGAAGG - Intergenic
1192750224 X:73982761-73982783 GCTGCCAGGGAGGCTGAGGTGGG + Intergenic
1194079839 X:89447188-89447210 GATGCCATGGATGCTGTGAAAGG + Intergenic
1196751860 X:119125654-119125676 GCTGCTATGAAGGCTGAGGTGGG - Intronic
1198083487 X:133261718-133261740 GCTGCCCTGCTGGCTTTGAAGGG + Intergenic
1198892235 X:141410604-141410626 GCTACCATGGAGGCTGAGGCAGG + Intergenic
1199746672 X:150776072-150776094 GGTCTCAGGCAGGCTGTGGAGGG + Intronic
1199779661 X:151046574-151046596 GCTGCCAGGAAGTTTGTGGAAGG - Intergenic
1200046941 X:153408258-153408280 GCTGCCACTCAGGCAGTGGACGG + Intergenic
1200060253 X:153480831-153480853 GCTGCCATGAGGGCTGGGGCAGG + Intronic
1200064716 X:153498810-153498832 GCTGCCCTGCTGGCTGTGTTGGG + Intronic
1200432459 Y:3102466-3102488 GATGCCATGGATGCTGTGAAAGG + Intergenic
1200706768 Y:6449744-6449766 CCTGCCATCCAGGTTGTGGGTGG - Intergenic
1201027344 Y:9714964-9714986 CCTGCCATCCAGGTTGTGGGTGG + Intergenic