ID: 961642197

View in Genome Browser
Species Human (GRCh38)
Location 3:128371678-128371700
Sequence GTTGGGGTGCAGAATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 371}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961642197 Original CRISPR GTTGGGGTGCAGAATGAGGA GGG Intronic
900948837 1:5846191-5846213 AGTGGGGCGCTGAATGAGGAGGG - Intergenic
901788956 1:11643287-11643309 GCTGGGGTACAGAATCAGAAGGG - Intergenic
902202496 1:14844428-14844450 GTTGCTGTTCATAATGAGGAGGG - Intronic
902814276 1:18907355-18907377 GTCGAGGAGCAGAAAGAGGATGG + Exonic
904095238 1:27971796-27971818 GTTGGGGTGGAGAAAAAGGCAGG + Exonic
904578348 1:31521119-31521141 GGAGGGGTGGATAATGAGGAGGG + Intergenic
904682546 1:32239667-32239689 GTTGGGGTGCCTAAAGAGTAAGG + Intergenic
904929412 1:34074444-34074466 GGTGAGGTGCAGAATGACAATGG - Intronic
905310688 1:37046903-37046925 GTGGGGGGTCAGAAGGAGGAGGG + Intergenic
905565639 1:38962334-38962356 GTTGGGGTGGGGAATGATGATGG - Intergenic
906159479 1:43637155-43637177 GATGGGGTGCAGAATGGGCAGGG + Intergenic
908360053 1:63359993-63360015 GCTGAGGTTCAGAAGGAGGAGGG - Intergenic
908888882 1:68819927-68819949 GTTGGGGGTGGGAATGAGGAAGG + Intergenic
909608312 1:77528768-77528790 GCTGGAGTGGGGAATGAGGATGG - Intronic
910029110 1:82694757-82694779 TATGTGTTGCAGAATGAGGAGGG - Intergenic
910062134 1:83106535-83106557 GTTAGGGGGCAGAAGAAGGAGGG + Intergenic
910667617 1:89741741-89741763 GTTGAGGTGGGGAATGGGGAAGG + Intronic
910819255 1:91328531-91328553 GATGTGCTGCAGAACGAGGAGGG + Intronic
910914566 1:92275460-92275482 GTTGGGGTGCAAACTGTTGAGGG - Intronic
911117497 1:94260990-94261012 ATGGGGGTGCAGAATTAGGAAGG - Intronic
912333472 1:108841283-108841305 GTTGGAGAGCAGACTAAGGAAGG + Intronic
912588120 1:110785561-110785583 GCTGGAGGGTAGAATGAGGAGGG + Intergenic
913190320 1:116407885-116407907 GTTGGGGTCCAGTGTGAAGATGG - Intronic
913394181 1:118348117-118348139 GTTGGGGTGTGGGATGAGGGTGG + Intergenic
914905896 1:151743557-151743579 GTAGGAATGCAGAATGAGGTAGG - Intergenic
915048589 1:153042081-153042103 GTAGGTGTGCAGAGTGAGGAAGG + Intergenic
916524669 1:165598363-165598385 GTTAGGGTGCAGAAACAGGACGG + Intergenic
917194348 1:172449983-172450005 GCTGGAGTGGAGAATGGGGAAGG + Intronic
917240159 1:172939535-172939557 GTAGGGGTGGAAAATAAGGAAGG + Intergenic
918216317 1:182394486-182394508 GTGGGGGTGAAGAATGGGGGCGG - Intergenic
918553480 1:185771375-185771397 TTTGGTGTGAAGTATGAGGAGGG + Intronic
920089939 1:203445267-203445289 GTTGGAGTGAAGACGGAGGATGG + Intergenic
921637623 1:217514489-217514511 GTTGGGATAGAGAATAAGGATGG + Intronic
922154252 1:223029016-223029038 GATGGGGTGCAGAAATAGGTCGG + Intergenic
922339979 1:224647468-224647490 GTCGGGGTGGAGACTGGGGATGG + Intronic
922431501 1:225559631-225559653 GTTGGGGTGCAGGGAGAGTAGGG - Intronic
922987552 1:229877640-229877662 GTTGGGGTGCACAAGGGAGAGGG + Intergenic
1064010038 10:11728191-11728213 GGTGGGGAGGAGATTGAGGAGGG + Intergenic
1065918639 10:30372175-30372197 GGTAGGGTGCAGACTGAGGGAGG - Intronic
1066455743 10:35569881-35569903 CTTGGGGTGAGGAATAAGGAGGG - Exonic
1067157497 10:43794420-43794442 ACAGGGGTGCAGAATGAGGGAGG - Intergenic
1067717890 10:48703889-48703911 GGTGGGGTGCAGGGTGAGGGTGG + Intronic
1067972998 10:50992523-50992545 GTTGGGATGAAGAAGGCGGAGGG + Intronic
1068685892 10:59869678-59869700 GTGGGTGTGCAGAATGAGCACGG - Intronic
1069604837 10:69732550-69732572 GGTGGGGTCCAGAGAGAGGAGGG - Intergenic
1070868667 10:79727981-79728003 TTTGGGGTGCAGAGGAAGGATGG + Intergenic
1070994966 10:80770150-80770172 GTGGGGGTGCAAAGAGAGGAAGG + Intergenic
1071635580 10:87250196-87250218 TTTGGGGTGCAGATGAAGGATGG + Intergenic
1071659659 10:87487778-87487800 TTTGGGGTGCAGATGAAGGATGG - Intergenic
1072312669 10:94171668-94171690 GTTGGGGTACAGTGAGAGGAAGG - Intronic
1073632016 10:105158663-105158685 GTTGGGGGGCAGAGGCAGGAGGG + Intronic
1074079005 10:110152677-110152699 GATGGGGTTCTGAATGGGGAAGG + Intergenic
1074272747 10:111971155-111971177 GGTGGGGTGCAGGTTGTGGAGGG - Intergenic
1074496590 10:113984777-113984799 CTTGGGGAGCAGGATAAGGAAGG - Intergenic
1074723678 10:116285782-116285804 GGAGGGGTGCAGGATGAGGCTGG - Intergenic
1074869180 10:117563751-117563773 GTTGGGGAGATGAATGAGGGTGG + Intergenic
1074894338 10:117762008-117762030 GCGGGGGTGAAGAGTGAGGAGGG + Intergenic
1075092353 10:119450922-119450944 GTTGGCGTGCAGCCTGGGGAGGG - Intronic
1075144121 10:119868895-119868917 GCTGGGATGGAGTATGAGGAGGG + Intronic
1075306103 10:121368764-121368786 GTTGAGGTGCAGAAGTGGGAAGG - Intergenic
1075359055 10:121813327-121813349 GTTGAGATGGAGAATGAGGAGGG - Intronic
1076305013 10:129460038-129460060 GTGAGGATGCAGAAAGAGGATGG + Intergenic
1077219963 11:1411462-1411484 CTTGGGGAGCAGAGGGAGGAAGG - Exonic
1077329613 11:1978277-1978299 CTTGAGGTGCAGAGAGAGGATGG + Intronic
1077418969 11:2440612-2440634 ATGGGGGTGCAGATTGTGGAGGG - Intergenic
1078567266 11:12426907-12426929 TTCTGGGGGCAGAATGAGGATGG + Intronic
1080921391 11:36713009-36713031 GTTGGGATGCATTCTGAGGAAGG + Intergenic
1083049282 11:59762592-59762614 GTTGGGGAGAAGGCTGAGGATGG + Intronic
1083313050 11:61795512-61795534 GATGTGCTGCAGAATGAGGAGGG + Exonic
1083345949 11:61992187-61992209 GTGGGGGTGGAGAAAGAAGATGG - Intergenic
1083846676 11:65338615-65338637 GTTGGAGAGCAGAATGGAGAAGG - Intronic
1084612439 11:70212211-70212233 CTTGGGGTGGATAGTGAGGAAGG - Intergenic
1085265555 11:75236016-75236038 GTTGGGGGGAAGACTGAGGTGGG + Intergenic
1085817751 11:79758929-79758951 GTTGGGGGGCAGATTTTGGAAGG - Intergenic
1085829083 11:79880523-79880545 GTGGGGGTGCAGAATGGGCATGG + Intergenic
1086954089 11:92917527-92917549 GATAGGCTGCAGAATAAGGAAGG - Intergenic
1088412213 11:109546964-109546986 GTAGAGGTTCAGAATGGGGAAGG + Intergenic
1088916431 11:114231388-114231410 GTTGGGGTGGGGAATATGGAGGG - Intronic
1089629264 11:119773910-119773932 GGTGGGGTGCAGAGTGTGTATGG + Intergenic
1089740586 11:120579256-120579278 GTGGGGGTGCGGAATGATGGGGG + Intronic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090865178 11:130693652-130693674 GGTGCGGAGCAGAATGAGTAGGG - Intronic
1202812592 11_KI270721v1_random:33456-33478 CTTGAGGTGCAGAGAGAGGATGG + Intergenic
1092205779 12:6613623-6613645 ATGGTGGTGCAGAATGGGGAGGG - Intergenic
1092746020 12:11673229-11673251 GTGGGAGTGGTGAATGAGGAGGG + Intronic
1094825170 12:34264182-34264204 GTTGGGGTGGAGTTTGGGGACGG - Intergenic
1095263676 12:40128414-40128436 GGTGGGGTGCAGAAAGAGGCAGG - Intergenic
1095864487 12:46956631-46956653 GGTGGGGGGAAGAATGCGGAAGG + Intergenic
1096615842 12:52833180-52833202 TTTGGGGTGGACAATGAGGAGGG - Intronic
1096635081 12:52953017-52953039 ATTGGGGTGTAGAAGGAAGAGGG + Intergenic
1097300228 12:58010131-58010153 GTGGGGGTGCAGAATGATGATGG + Intergenic
1097322181 12:58238077-58238099 GTTGGGGGGAATAAAGAGGAAGG + Intergenic
1098284269 12:68892334-68892356 GTCGAGGGGCACAATGAGGATGG + Intronic
1099426977 12:82535415-82535437 GTGGTCCTGCAGAATGAGGATGG - Intergenic
1100229159 12:92589652-92589674 AGTGGGGTGGAGAATGAGGTGGG - Intergenic
1100930712 12:99606916-99606938 GCTGGGGTGAACAATGGGGAGGG - Intronic
1101001013 12:100357183-100357205 GGTGGGGAGCAGAGAGAGGAGGG + Exonic
1102596945 12:114000137-114000159 GTTGGGAAGCAGAAACAGGAGGG - Intergenic
1103073480 12:117963890-117963912 TTTGGAGTGAAGGATGAGGAGGG - Intronic
1105418765 13:20234694-20234716 GTGGGGGTGGAGAGAGAGGAAGG + Intergenic
1105749253 13:23407099-23407121 TTCGGGTGGCAGAATGAGGATGG - Intronic
1106735084 13:32580895-32580917 GTTTGGGTGCCCAAGGAGGAAGG - Intergenic
1107217186 13:37935082-37935104 GTTGGGGTGCAGGCGGTGGATGG + Intergenic
1111598951 13:90447175-90447197 GCTGGAGTGGAGAAGGAGGATGG - Intergenic
1112797032 13:103068282-103068304 GTTGGGGTGGGGAAGGAGGTGGG - Intergenic
1116232442 14:42234867-42234889 GATGGGGGGCAGACAGAGGATGG - Intergenic
1121553616 14:94820303-94820325 CTGGGGGTGGAGAGTGAGGAGGG - Intergenic
1122427959 14:101622698-101622720 GCTGGGGTCCAGAATGGGTAGGG - Intergenic
1122607692 14:102958455-102958477 GATGGGGTGCAGGGTGGGGAAGG - Intronic
1122641211 14:103160733-103160755 GTTGGGGTGCAGGCTGTGGGGGG - Intergenic
1123068062 14:105628097-105628119 GGTGGGGGGCAGAAGGAGTAGGG - Intergenic
1123091795 14:105745260-105745282 GGTGGGGTGCAGGAGGAGCAGGG - Intergenic
1123097446 14:105773216-105773238 GGTGGGCGGCAGAATGAGCAGGG - Intergenic
1123468172 15:20531234-20531256 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1123649943 15:22469830-22469852 GTGGGGGTGCTGAGGGAGGAGGG - Intergenic
1123728488 15:23126444-23126466 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1123740346 15:23278649-23278671 GTGGGGGTGCTGAGGGAGGAGGG - Intergenic
1123746652 15:23323909-23323931 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1124278920 15:28347225-28347247 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1124303779 15:28564383-28564405 GTGGGGGTGCTGAGGGAGGAGGG - Intergenic
1125144473 15:36450893-36450915 GTTGGGGTGGGGAATATGGAGGG - Intergenic
1125829408 15:42703301-42703323 GAGGGAGTGCAGAATGAGAACGG - Intronic
1126169057 15:45679331-45679353 TTTGGGGTGCAGATTGAGGATGG + Intronic
1126577257 15:50209372-50209394 GAAGGGGAGCAGAATCAGGAAGG + Intronic
1126963164 15:54021335-54021357 GTTGGGGTAGAGAGTGAGGTGGG - Intronic
1127124260 15:55796884-55796906 GTGGGGGTGCTGAATGGGGTGGG - Intergenic
1127818370 15:62632790-62632812 GTGGTTGTGCAGAATGTGGAGGG + Intronic
1128068548 15:64779231-64779253 CTGGGGGTGGAGAGTGAGGATGG - Intergenic
1128127715 15:65205225-65205247 GTGAGGCTGAAGAATGAGGAGGG - Intronic
1128744640 15:70104734-70104756 GTTGGGATGGGGAATGGGGAGGG + Intergenic
1129464377 15:75715773-75715795 GTTGGAGGGCAGAAGGAAGAAGG - Intergenic
1129684567 15:77677744-77677766 GGTGTAGTGAAGAATGAGGAAGG - Intronic
1129720868 15:77877239-77877261 GTTGGAGGGCAGAAGGAAGAAGG + Intergenic
1130033976 15:80341442-80341464 TTTGGAGTGCAGGATGAGGCTGG - Intergenic
1131062519 15:89412689-89412711 TGTGGGGTCCAGAATGAGAATGG - Intergenic
1131969909 15:97881595-97881617 GATGGGGTGGAGAGTGAGGATGG - Intergenic
1132392582 15:101450028-101450050 TTTGGGGTGCAGGATGGCGAGGG - Intronic
1133028173 16:2997620-2997642 GTTGGGGTACAGAAGGGGGCTGG - Intergenic
1134692071 16:16197631-16197653 GAAGGGGTGCAGGAAGAGGAGGG + Intronic
1135109258 16:19677973-19677995 ACTGGGGTGCAGAAAGATGAAGG + Intronic
1135768697 16:25199750-25199772 GTTGGGGAGCTGAATGATGGTGG + Intergenic
1136246175 16:28977539-28977561 ATTGGGATGCAGACAGAGGAAGG + Intronic
1137762261 16:50950269-50950291 GATGGGGAGCAGGCTGAGGAAGG - Intergenic
1138323893 16:56144758-56144780 GTTGGGGAGGCGAAGGAGGAAGG + Intergenic
1138801844 16:60041519-60041541 TTTGGTGTGCAGACTGAGAACGG - Intergenic
1138961299 16:62033733-62033755 TGTGGGGATCAGAATGAGGAAGG + Intronic
1138966485 16:62090631-62090653 GATGTGGAGCAGAATGAGCAAGG - Intergenic
1139289500 16:65844674-65844696 AGTAGGGTACAGAATGAGGAAGG + Intergenic
1139354956 16:66362012-66362034 TTTGGGTTGCAGAAGGAGGAAGG + Intergenic
1139474617 16:67196846-67196868 GGTGGGCAGCAGAAGGAGGAGGG - Intronic
1141152332 16:81572779-81572801 GTTTGAGTGCAGAATGACGGCGG + Intronic
1141187792 16:81800360-81800382 GTTGGGGAGCAGGGTAAGGATGG - Intronic
1141450492 16:84097192-84097214 GGTGGGATGCAGAGTGAGAATGG + Intronic
1141589412 16:85057917-85057939 GTTGGGGTCACCAATGAGGAGGG - Intronic
1143636023 17:8164029-8164051 TTTGGGGTCCAGAGAGAGGAGGG - Intergenic
1143852590 17:9823861-9823883 GGTGCTGTGCAGAATGGGGAGGG + Intronic
1144888168 17:18477853-18477875 GTGGGGAGGCAGAATGGGGAGGG + Intronic
1146490650 17:33279200-33279222 GATGGGGTGCAGAAAGAGAGAGG - Intronic
1146947116 17:36881102-36881124 GTGGGGGTGCACAGTGAGGTTGG - Intergenic
1147363401 17:39945039-39945061 GTGGGGGGGCAGGTTGAGGAGGG + Intergenic
1147742041 17:42675300-42675322 GTTGAGGTGGAGCATGAGGGAGG + Intronic
1148382029 17:47206898-47206920 GTGGAGGTGGAGAAGGAGGAGGG + Intronic
1148911845 17:50947107-50947129 GTGGGGGTGCAGGCTGGGGAAGG + Intergenic
1149592450 17:57841482-57841504 GCTGGGGTGCAGAAGTGGGAGGG - Intronic
1151055320 17:71023930-71023952 GTGGGAGTGCAGAAGGAGCACGG - Intergenic
1151717695 17:75839874-75839896 TGTGGCGTGCAGAAAGAGGACGG + Exonic
1151765200 17:76130147-76130169 GTGGGGGTGCAGCGTGAGGAAGG + Intergenic
1151945885 17:77319642-77319664 GTTGGGGTACAGGGTGAAGAAGG + Intronic
1152128120 17:78459638-78459660 CTTGGGGTGCTGTATGGGGAAGG + Intronic
1152354180 17:79798636-79798658 GATGGGGTGGAGAAAGAGGGGGG + Intronic
1154002100 18:10490607-10490629 GCTGGGGAGCAGGCTGAGGAGGG + Intergenic
1155505186 18:26526248-26526270 TTTGGGGAGCAGCAGGAGGAGGG + Intronic
1155746104 18:29357944-29357966 GTTGGGAGACAGAAGGAGGATGG + Intergenic
1157126490 18:44961034-44961056 GCTGGTGTCCAGAATGATGAGGG + Intronic
1157412956 18:47479153-47479175 GTTTGTGGGCAGAATGAGTATGG + Intergenic
1157741254 18:50095497-50095519 GCTGGGGTTCAGAATGAGAGTGG + Intronic
1158175352 18:54650278-54650300 GTAGGGGTGAGAAATGAGGAAGG + Intergenic
1158452622 18:57580726-57580748 GGTGGGGTGCAGTGGGAGGAGGG - Intronic
1159362821 18:67427352-67427374 GTAGGAATGCAGAAGGAGGAAGG - Intergenic
1160462801 18:79052191-79052213 GTTGGGTGGCATATTGAGGATGG + Intergenic
1160971431 19:1769463-1769485 GATGGGGTTCAGAGTGGGGACGG - Intronic
1161535755 19:4817709-4817731 GCTGCGGTGCAGGCTGAGGAAGG + Exonic
1162053108 19:8046845-8046867 GATGGGGAGGAGAAGGAGGAGGG - Intronic
1163580360 19:18135110-18135132 GGTGGGGTGCTGAGTGAGGCGGG + Intronic
1163594875 19:18215225-18215247 CAGGGTGTGCAGAATGAGGAAGG - Intronic
1164909318 19:31992809-31992831 GGTGGGGTCCAGACTGAGGGAGG - Intergenic
1165062795 19:33212960-33212982 GGTGGGGTACATGATGAGGACGG + Exonic
1165115671 19:33527075-33527097 GTCGGGGCTCAGAATGAGAAGGG - Intergenic
1165848705 19:38836253-38836275 GGTGGGCTGCAGACTGAGAATGG - Intronic
1166736386 19:45087765-45087787 GTTGGGGTGCAGACGGCGGGGGG + Intronic
1167347534 19:48955648-48955670 GTGAGGGTGCAGAATCAGAACGG - Intronic
1167517698 19:49932801-49932823 GTTGAGGTGGAGAAGGAGGAGGG - Exonic
1167666657 19:50826370-50826392 GTTGGGGTTGAGAATGGGAATGG - Intronic
1167727422 19:51225766-51225788 GAGGGGATGCAGAATCAGGAGGG - Intronic
1167750234 19:51374944-51374966 GTGGGGTTTCAGAATGAGAATGG - Intergenic
1168231449 19:55034920-55034942 GTTGGGGTGCAGAGGGAGCCTGG - Intronic
925002015 2:410513-410535 GGTGGTGTGGACAATGAGGATGG - Intergenic
926712648 2:15894290-15894312 GCTGAGGTGCAGACTGGGGAGGG - Intergenic
927500876 2:23582424-23582446 GTGGGGGTGGAGGATGGGGATGG + Intronic
927702236 2:25275927-25275949 GAGGGGGTGCGGAAGGAGGAGGG + Intronic
928249693 2:29664671-29664693 GCTGGGTTGCAGCATGAGGATGG - Intronic
929066401 2:37979428-37979450 GTTGGGGTTCAGCATGAGGGAGG + Intronic
932128876 2:69169464-69169486 GTTGGGGTCAAGAGGGAGGAGGG + Intronic
932424382 2:71619862-71619884 CTTGGGCTGCAGCCTGAGGAGGG - Intronic
932691486 2:73917429-73917451 GTTGGGAGGCAGTATGGGGAAGG - Intronic
932794544 2:74682989-74683011 GTTGGGATGCAGAGGGAGCAGGG - Intronic
934767155 2:96886071-96886093 GTTGGTGGGAAGGATGAGGAGGG - Intronic
934868577 2:97838312-97838334 TTTGGGGTGAAGTATGAGAATGG + Intronic
934937096 2:98473310-98473332 GGTGGAGTGGAGAGTGAGGAGGG + Intronic
934937103 2:98473340-98473362 GGTGGAGTGGAGAGTGAGGAGGG + Intronic
935594959 2:104871160-104871182 GTTTGGATGCAGAATTGGGATGG - Intergenic
935946878 2:108294697-108294719 GTTGGGGTACAGATAGAAGAAGG - Intronic
937366328 2:121264509-121264531 CTGGGAGTGCAGAATCAGGAGGG + Intronic
937377451 2:121347360-121347382 TCTGGGGTGCAGAAGCAGGAGGG + Intronic
938000049 2:127726391-127726413 GGTGGGGAGGAGGATGAGGAGGG - Intronic
938069108 2:128299202-128299224 GTTGTGGTGCAGAGCAAGGAGGG - Intronic
938245341 2:129772402-129772424 GTTGAGGTCCGGAATAAGGAAGG - Intergenic
938985976 2:136576830-136576852 GTTGGGGTTTAGAATAAGGTGGG - Intergenic
940508543 2:154585064-154585086 GTGGTGGTGCAGGATGTGGAAGG + Intergenic
942411682 2:175716133-175716155 GTTGGTGAGCAGAGTGCGGACGG - Intergenic
942965469 2:181888074-181888096 GCTGGGGTGGAGGAAGAGGAGGG + Intergenic
943205551 2:184889047-184889069 GTTGGAGTGAATAATGTGGAGGG - Intronic
946144442 2:217718451-217718473 GTTGGGCTGGAGAAGGAGAAAGG - Intronic
946182695 2:217958477-217958499 GCTGGGATGGAGAATGACGATGG + Intronic
946963132 2:225006143-225006165 GGTGGGGAGAAGAATGAAGATGG - Intronic
947648971 2:231768267-231768289 GTTGGAGTCAGGAATGAGGAAGG - Intronic
948662451 2:239515672-239515694 GTGGGTGTGCAGAATGAGCAGGG - Intergenic
948696906 2:239737367-239737389 GTTGGGGTGCGGCAGGAAGAGGG - Intergenic
1168761862 20:354803-354825 GAAGGGGTGCAGGATGAGGAGGG - Exonic
1169575166 20:6951512-6951534 GCTGTGTTGCTGAATGAGGATGG + Intergenic
1169613969 20:7417660-7417682 GTTGGAGTGCAAATTGAGGTGGG + Intergenic
1170294825 20:14812643-14812665 GTAGGGGTGCAGAAAGATAAAGG - Intronic
1170295138 20:14816180-14816202 GTTGCGGGGCAGAGGGAGGATGG + Intronic
1172047913 20:32093851-32093873 TTTGGGGTGCAGATTGCAGAAGG + Exonic
1172356155 20:34281412-34281434 CTTGAGTTGAAGAATGAGGAAGG - Intronic
1172439776 20:34957128-34957150 TTTGGTGTGGATAATGAGGAAGG + Intergenic
1173852491 20:46227770-46227792 GTTGGGGCTCAGAGTGGGGATGG - Intronic
1174393318 20:50231510-50231532 GGAGGAGTGGAGAATGAGGATGG + Intergenic
1176850387 21:13908258-13908280 GTGGGGATGCAGACAGAGGAGGG + Intergenic
1178845132 21:36168366-36168388 TTTGGGGTGCATACTTAGGAGGG + Intronic
1178982140 21:37273564-37273586 GGAGGGGTGGAGAAGGAGGAGGG + Intergenic
1179286703 21:39983816-39983838 GATGTGGTGCAGAAGGGGGAAGG - Intergenic
1180049403 21:45324444-45324466 GGTGGGGTGAAGGATGTGGAGGG + Intergenic
1180201521 21:46227596-46227618 GTGGGGCTGCAGGCTGAGGATGG - Exonic
1180721063 22:17908769-17908791 GGTTGGGTGCAGACAGAGGAAGG + Intronic
1181481476 22:23201905-23201927 GTTCCTGTGCAGTATGAGGAAGG + Intronic
1181688387 22:24544392-24544414 GCTGGGGTGCAGTAGGAGGATGG - Intronic
1182430545 22:30296263-30296285 GTTGGGGAGCAGGATCAGTAAGG - Intronic
1182679024 22:32063851-32063873 GAGGGAGTCCAGAATGAGGAAGG + Intronic
1182921048 22:34079549-34079571 GTAGGGGTGCAGGAGGAGGGTGG + Intergenic
1183320866 22:37164312-37164334 GGAGGGGAGCAGAGTGAGGAGGG + Intronic
1183394624 22:37564255-37564277 GTGGGGGTGGGGAATCAGGAAGG + Intronic
1184115094 22:42417614-42417636 GTTGGGGCAGAGAGTGAGGAGGG + Intronic
1184170860 22:42759022-42759044 GTTGGGGAGCAGTTTGAGGAGGG - Intergenic
1184648529 22:45908982-45909004 TTTGGGGTGCAGAGTGTGGGAGG - Intergenic
1184712826 22:46263137-46263159 GCTGGGCCGCAGACTGAGGAGGG + Exonic
1185092790 22:48785336-48785358 GTTGGGGAGCAGAGTGAGAAGGG - Intronic
1185101536 22:48843381-48843403 TGTGGGGTGCAGAATGTGGGGGG + Intronic
1185128072 22:49022741-49022763 CTTGGTGTGGAGAAAGAGGAGGG + Intergenic
949365347 3:3274667-3274689 GGTGGGGTGAAGGATCAGGAGGG - Intergenic
949904585 3:8848347-8848369 GATGGGGTCCTGACTGAGGAAGG - Intronic
951106521 3:18750222-18750244 GTTGGGAGGCAGAATTGGGAGGG + Intergenic
951691651 3:25402821-25402843 GTTGGGGTGGGGCATGAGGATGG + Intronic
952515842 3:34104148-34104170 GTTGGGGTATAGAATGAAGCGGG - Intergenic
952945735 3:38477059-38477081 GATGGGCTGCAGAATGAGGTGGG + Intronic
954419892 3:50413182-50413204 GTGGTGGTGGAGCATGAGGAGGG + Intronic
954834695 3:53455602-53455624 GTGGAGCTGCATAATGAGGATGG - Intergenic
955408317 3:58639781-58639803 GTTGGGATGGAGATGGAGGAGGG + Intronic
956231221 3:67018776-67018798 CTTGGTGTTCAGAATGAAGACGG + Intergenic
956797336 3:72728804-72728826 ATTTGGGGGAAGAATGAGGAGGG - Intergenic
957038832 3:75320472-75320494 TTTGGGGTGCAGCTTGAGGCAGG + Intergenic
959234188 3:103696964-103696986 CTTGGGATGCTGTATGAGGAAGG + Intergenic
960067688 3:113392423-113392445 GGTGGGGTGCAAATTGGGGATGG + Intronic
960968796 3:123124431-123124453 GTTGGGGGAAAGAATGAGGAAGG + Intronic
961086870 3:124075777-124075799 TTTGGGGTGCAGCTTGAGGCAGG + Intergenic
961597718 3:128032124-128032146 GCTGGGGTGCAGAGTGAGGCAGG - Intergenic
961642197 3:128371678-128371700 GTTGGGGTGCAGAATGAGGAGGG + Intronic
961805221 3:129484276-129484298 CCTGGGGTGCAGAAGGTGGAGGG - Intronic
961817866 3:129560538-129560560 GATGGGGCCCAGAATCAGGAGGG - Intronic
962103474 3:132366595-132366617 TTTGGTGTGGGGAATGAGGATGG + Intronic
962319829 3:134381476-134381498 TTGGGAGAGCAGAATGAGGAGGG + Intergenic
963895835 3:150684056-150684078 TTTGTGGTGCAGAAAAAGGAAGG + Intronic
964267475 3:154915093-154915115 GGTGGGGTGGAGAGTGAAGATGG + Intergenic
967535035 3:190592370-190592392 GCTGTTGTGCAGAATAAGGAAGG - Intronic
967880660 3:194298993-194299015 GTTGGGGTGGGCACTGAGGAAGG + Intergenic
968350204 3:198046985-198047007 GTTGGGGTGCAGGGAGAGGCAGG - Intergenic
968671278 4:1853109-1853131 GGGGAGGAGCAGAATGAGGAGGG - Intronic
969467319 4:7365414-7365436 GTTGGGGTGCAGGCTGAGATGGG + Intronic
972696619 4:41452691-41452713 CTTGCGGTGCAGAAGAAGGAAGG - Intronic
975442077 4:74422300-74422322 GTTGGGGTAGAGAGTGTGGAGGG + Intergenic
975477925 4:74844316-74844338 GTGGGGGTGAAGGGTGAGGACGG - Intergenic
976105764 4:81615298-81615320 GTTTGGGTGGAGAATGGGCAAGG + Intronic
976416975 4:84787834-84787856 TTTGGGGTGGAGAAACAGGAAGG + Intronic
979960513 4:127015311-127015333 ATTGGGATGAGGAATGAGGAAGG - Intergenic
982097551 4:151936695-151936717 GCTGGGGTGCAAAATAAGAACGG - Intergenic
982495898 4:156091832-156091854 GTGGGTGTGGAGGATGAGGAGGG + Intergenic
982563588 4:156961801-156961823 GATGGCGTGCAGAATGAGGCTGG - Intronic
984925321 4:184801361-184801383 ATGGGGGTGCAGAATGAGGGTGG + Intronic
1202762128 4_GL000008v2_random:121879-121901 GTTGGGGTTCAGAGAGAGGCAGG - Intergenic
985652281 5:1112560-1112582 GAGGGGGCGCAGAAGGAGGAGGG - Intergenic
985749677 5:1667179-1667201 GTTGGGGCGCAGGAGGAGGGCGG - Intergenic
987191279 5:15480877-15480899 GTTGAGGAGGAGGATGAGGATGG + Intergenic
987329814 5:16846747-16846769 GTTGGTTTGCAGAATAGGGAGGG - Intronic
991597467 5:68320328-68320350 GCTGGGGTGGAGAAGGAGGGAGG + Intergenic
992140254 5:73789381-73789403 GCTGGGGTGTGGAAGGAGGATGG + Intronic
994066228 5:95545682-95545704 GTGGGGTTGCTGAAGGAGGAAGG - Intronic
996024086 5:118624291-118624313 GTTGGGGTTCGGAATGGGGAGGG + Intergenic
997645545 5:135479249-135479271 GCTGGTGGGCAGAATGAGGCAGG - Intergenic
999083173 5:148863486-148863508 ATTGGGGTTGAGAGTGAGGAAGG + Intergenic
1000155965 5:158552078-158552100 GTTGGAGAGGAGAATCAGGAGGG + Intergenic
1000983864 5:167845977-167845999 GATGGGGTGAAGGATGAGGCTGG - Intronic
1001074323 5:168614383-168614405 GCTGGAGTGCAGAATGAATAGGG + Intergenic
1001651759 5:173320722-173320744 GTTGGGTTGAAGAATGGGGGTGG + Intronic
1002416657 5:179124357-179124379 GCTGGGAGGAAGAATGAGGATGG - Intronic
1002618354 5:180469209-180469231 TTTGGGGTGCAGAATCAGTGAGG + Intergenic
1002832247 6:833163-833185 GTTGGGGTGAAGTGTGAGGAGGG + Intergenic
1004097549 6:12573295-12573317 GCTGGGGGGAAAAATGAGGATGG + Intergenic
1005609105 6:27506450-27506472 GCAGGGGTGCAGGATGAGAAGGG + Intergenic
1006735149 6:36268080-36268102 CTGGGGCTGGAGAATGAGGAAGG - Intronic
1007345284 6:41224258-41224280 GTTGGGGTGAAGGAAGTGGATGG - Intergenic
1008237527 6:49068324-49068346 GTGGGTGGGCAGACTGAGGATGG + Intergenic
1010451919 6:76013248-76013270 GGTGGGGTGCAGATTCTGGAGGG - Intronic
1012779693 6:103542021-103542043 GTTGGGGTAACGAAAGAGGATGG - Intergenic
1013300283 6:108798864-108798886 GTTGCACTGCAGAATGAGGGAGG + Intergenic
1015450968 6:133365584-133365606 GTCAGGATGCAGAAGGAGGAAGG + Intronic
1015554980 6:134451786-134451808 GTTGGGGAGCAGAGAGTGGAGGG + Intergenic
1015712678 6:136159381-136159403 GCTGGGGTTCAGATTGGGGATGG - Intronic
1016058880 6:139607656-139607678 GGTGGGGTGAAGGATAAGGAAGG - Intergenic
1016765794 6:147792100-147792122 GGTGGAATGCAGAATGAGAAAGG + Intergenic
1018426288 6:163685689-163685711 GTTGGGATTCAGGCTGAGGATGG + Intergenic
1018844703 6:167547495-167547517 GATGGGGTGAAGAGGGAGGAGGG - Intergenic
1018844711 6:167547517-167547539 GATGGGGTGAAGAAGGAGGAGGG - Intergenic
1018960991 6:168448429-168448451 GATGGGGAGAAGGATGAGGATGG + Intronic
1018961017 6:168448516-168448538 GATGGGGAGGAGGATGAGGATGG + Intronic
1019445445 7:1068634-1068656 GTTGGGGGGAAGACTGGGGATGG - Intronic
1019925118 7:4186631-4186653 GTTGGGGTGAATCAGGAGGAAGG + Intronic
1020660461 7:10974671-10974693 GTTGGGGTGCAGAAGCAGGGTGG - Intronic
1021581919 7:22164221-22164243 GTTGGGATGCAGAGACAGGAGGG + Intronic
1021685538 7:23182159-23182181 CTAGGGGTGCAGGAGGAGGACGG + Exonic
1021800935 7:24305657-24305679 GCTGGGGAGAAGATTGAGGAAGG + Intergenic
1022074710 7:26956017-26956039 TTTGGGGTTCATAATGGGGAGGG - Intronic
1022082977 7:27042508-27042530 GTAGGGGAAGAGAATGAGGACGG - Intergenic
1023714459 7:43029170-43029192 GCTGAGGTGGAGAATGAGGTGGG + Intergenic
1025111037 7:56216411-56216433 GAAGGGTTGCAGAAGGAGGAGGG + Intergenic
1026302190 7:69107634-69107656 GTTGGGGTGCAGGATGTTTATGG - Intergenic
1028006320 7:85573686-85573708 GATGGGATGCAGACTGACGAGGG + Intergenic
1028687606 7:93609654-93609676 GTGGGGCAGGAGAATGAGGATGG + Intronic
1029304680 7:99610283-99610305 ATTGGGGGGCAGAATGAGGGAGG + Intergenic
1029576858 7:101409121-101409143 CTTAGGTAGCAGAATGAGGAGGG + Intronic
1030161804 7:106516880-106516902 GTCTGGTTGGAGAATGAGGAAGG - Intergenic
1030679451 7:112419382-112419404 GGTGGGGAGGAAAATGAGGATGG + Intergenic
1036426373 8:8648640-8648662 GTTGGAGTTAAGAATGAGTAGGG - Intergenic
1036497235 8:9280355-9280377 CTGGGGGAGCAGAATGAGGGAGG + Intergenic
1037147004 8:15584701-15584723 GTGGGGGTGGTGAAGGAGGAGGG + Intronic
1038114503 8:24538178-24538200 GTTGAGGAACAGAATGAGGTAGG + Intergenic
1042395580 8:68287951-68287973 GTTGGGGTGAGGGAGGAGGATGG + Intergenic
1042411734 8:68474098-68474120 GTAGGGGTGATAAATGAGGAGGG - Intronic
1044333644 8:90950189-90950211 GTGGGGGTGGAGAAAAAGGATGG + Intronic
1045503091 8:102758160-102758182 GTGGGGGTGGAGAAAGAGGGAGG - Intergenic
1045691998 8:104769020-104769042 TTTCGGTTGCAGAATGAGGATGG - Intronic
1046381598 8:113457989-113458011 GTTGGGTTGATGAATGGGGAAGG + Intergenic
1047343915 8:124009209-124009231 GCTGGAGTGCAGAAGGAGGATGG - Intronic
1047348553 8:124051712-124051734 TCTGGGGAGCATAATGAGGAAGG + Intronic
1047719169 8:127622996-127623018 GTTTGGGCTCAGAATGAAGAAGG + Intergenic
1048480838 8:134791211-134791233 TTTAGGGTGGAGAAAGAGGAAGG - Intergenic
1048971817 8:139649388-139649410 CTGAGGGTGTAGAATGAGGAAGG + Intronic
1049421507 8:142518605-142518627 TTTGGGGTGGAGAGTGAGCAGGG - Intronic
1050184826 9:2962165-2962187 GGTGGCGTGGAGAAGGAGGACGG - Intergenic
1050224380 9:3434686-3434708 TTTGGAGTGCAGAAGGAGGGTGG - Intronic
1051016832 9:12487684-12487706 GTTGGGGTGGGCAGTGAGGATGG + Intergenic
1053666345 9:40320475-40320497 GTGGGGGTGAAAAATGAGGGGGG + Intronic
1053915928 9:42945522-42945544 GTGGGGGTGAAAAATGAGGGGGG + Intergenic
1054377498 9:64460503-64460525 GTGGGGGTGAAAAATGAGGGGGG + Intergenic
1054518264 9:66055808-66055830 GTGGGGGTGAAAAATGAGGGGGG - Intergenic
1055393811 9:75851960-75851982 GTTGGGGGGAAGAAAGGGGAGGG - Intergenic
1056365148 9:85897418-85897440 GCTGGGCTGCAGTCTGAGGAGGG - Intergenic
1057185246 9:93053820-93053842 CTTGGTGTGCAGGATGAGCATGG + Intergenic
1057210390 9:93198150-93198172 GTTGTGGTGCAGCTTGAGGAGGG + Intronic
1058354424 9:104066071-104066093 GCTGAGGTGCAGAAGGATGAAGG - Intergenic
1059909365 9:119025392-119025414 GTAGGGGTGCAGGATTAGGGAGG - Intergenic
1060732449 9:126047127-126047149 CATGGAGTGCAGAATGAGGCAGG - Intergenic
1060800879 9:126545340-126545362 GTTGGGGGGCAAAGTGGGGAGGG - Intergenic
1060812803 9:126619428-126619450 GTTGGGGTACACACTGGGGAAGG - Intronic
1061133893 9:128722631-128722653 GTTGGGGTGCAGTTGGAGGTGGG + Intronic
1061434799 9:130554415-130554437 GTTGGGGTGGGGGCTGAGGAAGG + Intergenic
1061799807 9:133107543-133107565 GATGGGGAGCAGACTGAGGCGGG - Intronic
1062028639 9:134352114-134352136 GCTGGGGTGCAGCAAGGGGAGGG + Intronic
1062327282 9:136018286-136018308 GCTGGGGAGCAGCCTGAGGAGGG + Intronic
1062407293 9:136403080-136403102 GGTGGGGGGCAGAAAGGGGAGGG + Intronic
1203542893 Un_KI270743v1:106760-106782 GTTGGGGTTCAGAGAGAGGCAGG - Intergenic
1185937637 X:4276721-4276743 GTTGGGGTGGACAGTGGGGATGG - Intergenic
1186428946 X:9488035-9488057 GTTGGGTTGGAGAATATGGAGGG + Intronic
1186509230 X:10117743-10117765 TGTGGGGTCCAGAGTGAGGATGG + Intronic
1187547414 X:20267150-20267172 GTTGGGGCGCAGAAGGAGGGGGG - Intergenic
1189214097 X:39308606-39308628 GTTGCTCTGCAGAATTAGGAGGG + Intergenic
1189590464 X:42505768-42505790 ATTTGGAAGCAGAATGAGGATGG + Intergenic
1189986880 X:46561447-46561469 GTTCTCGTGCAGAATCAGGAAGG - Intergenic
1190324638 X:49199336-49199358 GTTCGGGTAGAGAATGGGGATGG + Intronic
1191675187 X:63785449-63785471 GGTGGGGTGCAGGGAGAGGATGG + Intronic
1191694349 X:63974158-63974180 TGGGGGTTGCAGAATGAGGATGG + Intergenic
1192435247 X:71139358-71139380 CATGGGGACCAGAATGAGGATGG + Intronic
1192956460 X:76075932-76075954 GTTGGGGAGCAGAAAGTTGAGGG - Intergenic
1193846540 X:86479030-86479052 GTTGGGGAGCAGAAGGGGGATGG + Intronic
1196605902 X:117656721-117656743 GTGGTGGTGCAGGATGTGGAAGG - Intergenic
1197705312 X:129630473-129630495 ATTGAGGTACAGAATGGGGAGGG + Intergenic
1197783244 X:130177090-130177112 GATGGGGTGCTGGAGGAGGATGG - Intronic
1197917397 X:131551214-131551236 GATGAGGTGGATAATGAGGATGG - Intergenic
1197976035 X:132166905-132166927 GATGGGGAGCAGGTTGAGGATGG - Intergenic
1198388331 X:136148324-136148346 GGTGGGGTGCAGAATAAGGAGGG + Intronic
1199680500 X:150221252-150221274 GATGCGGTGCAGAGAGAGGAGGG - Intergenic
1199707731 X:150445299-150445321 GTGGGGGTGCTCAATGAGGGTGG + Intronic
1200212936 X:154354925-154354947 GACGTGGTGGAGAATGAGGACGG - Exonic
1200769135 Y:7107432-7107454 GTTAGGGTGGAGAATGAGTCAGG + Intergenic