ID: 961642318

View in Genome Browser
Species Human (GRCh38)
Location 3:128372350-128372372
Sequence TGCCATGGCAGTCCAGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 345}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961642318_961642324 -10 Left 961642318 3:128372350-128372372 CCATGCCCTGGACTGCCATGGCA 0: 1
1: 0
2: 2
3: 28
4: 345
Right 961642324 3:128372363-128372385 TGCCATGGCAGCTGGTCAAGGGG 0: 1
1: 0
2: 0
3: 15
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961642318 Original CRISPR TGCCATGGCAGTCCAGGGCA TGG (reversed) Intronic
900363250 1:2300072-2300094 TGCCAGGGCAGGGCAGGGCTGGG - Intronic
901142159 1:7042271-7042293 TGCCAGGGCAGCCCAGGGAAGGG - Intronic
901216747 1:7559356-7559378 TGCTGTGGCCGTCCAGGGCCAGG - Intronic
902122270 1:14176437-14176459 TGCCACAGCTGCCCAGGGCAGGG + Intergenic
902361213 1:15943561-15943583 TGCCCTCCCAGTCCTGGGCATGG + Intronic
903375636 1:22864082-22864104 TGCCATTGCATTCCAGAGCCTGG - Intronic
904614474 1:31742573-31742595 TGCAAGGGCAGCCCAGGGCTTGG + Intronic
904681892 1:32234956-32234978 CTGCCTGGCAGTCCAGGGCATGG - Intergenic
905275178 1:36812995-36813017 TGCCAGGGCTGTGCAGGGCTGGG + Intronic
905361873 1:37426361-37426383 TGTCATGGCAGTACTGTGCATGG + Intergenic
906232501 1:44176644-44176666 TGCCATTGCACTCCAGGCCCAGG + Intergenic
907307884 1:53523633-53523655 TCCCATGGAACTCCAGGGCCAGG - Intronic
910415426 1:86992406-86992428 TGCCATTGCACTCCAGGCCTGGG - Intronic
911326109 1:96471488-96471510 TCCCATGACTTTCCAGGGCAAGG - Intergenic
911745900 1:101441931-101441953 TGCCATTGCACTCCAGCCCAGGG - Intergenic
912487415 1:110040125-110040147 AACCGTGGCAGTCCAGTGCATGG + Intronic
913476887 1:119246315-119246337 GGCCAGGGCAGTCTAGGACAAGG - Intergenic
914757537 1:150572484-150572506 TGCCATTGCACTCCGGGGCCTGG - Intergenic
916806763 1:168267516-168267538 TGCCATCCCAGTCCAGGGGGTGG + Intergenic
917494944 1:175531876-175531898 TGCCTAGGCAGTCAGGGGCAGGG - Intronic
917737735 1:177935971-177935993 TTCCATGGCAGGACAGGGTAGGG + Intronic
918408677 1:184236117-184236139 CTCCATGCCAATCCAGGGCAAGG + Intergenic
919902042 1:202051061-202051083 TGCCATTGCACTCCAGCCCAGGG - Intergenic
923113302 1:230910340-230910362 AGCCAAGGCAAACCAGGGCAGGG + Intronic
923410893 1:233708026-233708048 TGCCTTGGGAGACCAGGGCCAGG + Intergenic
923516192 1:234699848-234699870 TGCCATGTCTGTTTAGGGCAGGG + Intergenic
1062878966 10:963138-963160 TACCATGGTAGTCCAGGCCTTGG + Intergenic
1062983591 10:1745940-1745962 TCAGATGGCAGTGCAGGGCATGG + Intergenic
1063035789 10:2285546-2285568 AGCCATGGCTCTCCAGGGCTTGG + Intergenic
1063968941 10:11367925-11367947 GACCATGGCAGGCCAGGGGAGGG - Intergenic
1064294141 10:14062842-14062864 TGCCATTGCACTCCAGTGAAAGG + Intronic
1066604122 10:37142624-37142646 TGCCATTGCACTCCAGCCCAGGG - Intronic
1066768015 10:38820417-38820439 TTCCATTGCAGTCCATGGAAAGG + Intergenic
1067333846 10:45346265-45346287 AACCATGGGAGCCCAGGGCAGGG - Intergenic
1067850834 10:49752608-49752630 TGCCATGGCCGTCCTGAGGAAGG + Intronic
1069775331 10:70923889-70923911 TGCCAGTCCAGGCCAGGGCAGGG + Intergenic
1070020796 10:72583524-72583546 TGCCTTGGGAGGCCAAGGCAGGG - Intronic
1070153542 10:73819652-73819674 AGCCAGGGCAGGGCAGGGCAGGG + Intronic
1071288718 10:84172781-84172803 TGGCATGGTAGGCCAGGTCATGG - Intergenic
1072633819 10:97164757-97164779 TGCCACGGCAGTCCTGGGCAGGG - Intronic
1074036589 10:109745331-109745353 TGTTATGTCAGACCAGGGCATGG - Intergenic
1074165024 10:110867509-110867531 TACCATGGGAGTCCTGGGAATGG - Intergenic
1074563993 10:114560013-114560035 TGGCATGGCAGGCTATGGCATGG - Intronic
1075034445 10:119052426-119052448 TGCCATTGCACTCCAGTGCTTGG - Intronic
1076868717 10:133182281-133182303 GGCCAGGGCAGCCCAGGACACGG + Intronic
1076890543 10:133281073-133281095 GGCCAGGGCAGTGCTGGGCAGGG + Intronic
1077467888 11:2742270-2742292 GGGCAGGGCAGTCCAGGGCAGGG + Intronic
1078516478 11:12027052-12027074 TGCACTGGCAGCCCAGGACACGG - Intergenic
1079075782 11:17384799-17384821 GGCCTGGGCAGTCCAGGCCAAGG + Intergenic
1079649927 11:22915113-22915135 TGCCATGGCAGCCCATGGAGGGG + Intergenic
1081567582 11:44269635-44269657 GGCCCTGGGAGGCCAGGGCAGGG - Intronic
1081777788 11:45688021-45688043 TGCCAAGTCAGTCCCTGGCAGGG - Intergenic
1081891797 11:46548947-46548969 TGCCATTGCACTCCAGTGCCTGG + Intronic
1081944004 11:46972423-46972445 TGGGATGGCAGTGCAGGGCTGGG + Intronic
1083300693 11:61738299-61738321 TGCCCTGGCCTTCCATGGCAGGG - Intronic
1083300696 11:61738302-61738324 TGCCATGGAAGGCCAGGGCAGGG + Intronic
1083707959 11:64529698-64529720 TGCCATGGAGGCCTAGGGCAGGG + Intergenic
1083735105 11:64675709-64675731 TGCCATGGCAGTCAGGAACAGGG - Intronic
1084469308 11:69346795-69346817 TGCCATGGCAATTCAGTGGAGGG - Intronic
1085474071 11:76778542-76778564 TGCCATGGCAGCACAGAGGAAGG + Intergenic
1085673850 11:78495968-78495990 TTCCCTGGCAATGCAGGGCAAGG + Intronic
1085834339 11:79936275-79936297 TGCCATGTGAGTCCTGGGAAAGG - Intergenic
1085848197 11:80090157-80090179 TCCCATGGCTGCCCAGGTCACGG - Intergenic
1089294214 11:117458300-117458322 TGCCTTGACAGTCCAGGGCCAGG + Intronic
1090228757 11:125087018-125087040 TTCCAGGGCAGGGCAGGGCAGGG - Intronic
1096466435 12:51849338-51849360 GGCCAAGGCAGTCCTGGGAAAGG - Intergenic
1096486456 12:51985259-51985281 TGCCATAGCAGACCTGGGCCTGG + Exonic
1096814607 12:54193993-54194015 TTCCCTGGGAGTGCAGGGCAAGG - Intergenic
1097109115 12:56645207-56645229 TGCCCTGGAAGTGCAAGGCAGGG - Exonic
1098227742 12:68342114-68342136 TGCCATGCCTGTCCAAGGCTGGG - Intergenic
1100821758 12:98438518-98438540 TGCTTTGGCAGGCCAGGGTAGGG + Intergenic
1101736196 12:107465105-107465127 TGCTATGGCAGTCCCTGCCATGG - Intronic
1102177020 12:110883437-110883459 TACCATGCCCGGCCAGGGCAGGG + Intronic
1103158261 12:118706214-118706236 TGCCAGGGCAGAGCAGGGGAGGG - Intergenic
1105944988 13:25181514-25181536 TACCAGGTCAGTCTAGGGCAGGG - Intergenic
1106969919 13:35126874-35126896 TGCCATTGCATTCCAGAGCCTGG + Intronic
1108494377 13:51009263-51009285 TGTCATGAGAGCCCAGGGCAAGG - Intergenic
1110206294 13:72918427-72918449 TGCCATTGCACTCCAGGCCTGGG - Intronic
1112316168 13:98363669-98363691 TTCCATGGCAGGGCAAGGCAGGG - Intronic
1112641440 13:101279920-101279942 TACCATGGTAGTCCAAGCCAGGG + Intronic
1112641855 13:101284454-101284476 TACCATGGTAGTCCAAGCCAGGG - Intronic
1112731531 13:102368046-102368068 TTCCTTGGCAGTCGAGGCCAAGG - Intronic
1113787516 13:113010396-113010418 GGCAATGGCAGTCCAGGGAGGGG - Intronic
1113879240 13:113614464-113614486 TGCCCTGGGAGCCCAGGGCATGG + Intronic
1113899751 13:113789742-113789764 TGCCCGGTCAGTCCAGGGCTAGG - Intronic
1113899767 13:113789838-113789860 TGCCCAGTCAGTCCAGGGCTAGG - Intronic
1115426673 14:33268740-33268762 TTCCATGCCAGTCTAGGTCATGG + Intronic
1115859875 14:37672495-37672517 TGCCACAGCACTCCAGGGCTAGG - Intronic
1117615857 14:57532937-57532959 TGCTATGGGAGCCCAGGGAAAGG + Intergenic
1118688632 14:68316446-68316468 TCCCATGGCAGGCCAGGGAGAGG + Intronic
1119210786 14:72830255-72830277 TGCTATGGCAGTGGAGGGGAAGG + Intronic
1119233124 14:72996708-72996730 TGCTGTGGGAGTCCAGAGCAAGG - Intronic
1119508160 14:75190580-75190602 TGCCATTGCACTCCAGGCCTGGG + Intergenic
1119754636 14:77106871-77106893 GGCCAGGACAGTCCAGGGAAGGG + Intronic
1119918856 14:78427374-78427396 TTCCATGGCAGAGCAGGGCCAGG + Intronic
1121328560 14:93035704-93035726 AACCATGGCTGTCCAGGGCCTGG + Intronic
1121592943 14:95133361-95133383 TGCCATGGCAGTCCAAAGAAAGG + Exonic
1121683877 14:95817296-95817318 GGCCATGGCTGTCCCAGGCATGG - Intergenic
1122009756 14:98736441-98736463 GTCCATGGCAGCCCAGGCCAGGG + Intergenic
1122024372 14:98864451-98864473 TGCCATCGCAGGGCAGGGCCTGG + Intergenic
1122163381 14:99802642-99802664 AGAGATGGCAGTCCAGGCCACGG + Intronic
1122208626 14:100160704-100160726 TCCCATGGAAGTCCATGGCCCGG + Intergenic
1122300805 14:100730068-100730090 TGCCCTGGCTGTACAGGGCAGGG - Intronic
1122605942 14:102947867-102947889 TGGCAGGGCAGGGCAGGGCAGGG - Intronic
1122605944 14:102947872-102947894 GGACATGGCAGGGCAGGGCAGGG - Intronic
1124601196 15:31134027-31134049 TGCCCTGGCAGTCCATGCAAAGG + Intronic
1126134490 15:45377761-45377783 TGCCAGGGCAGCCGAGGGCGGGG + Intronic
1126368656 15:47922537-47922559 GGCCATGTGAGTCCAGAGCAAGG + Intergenic
1128228995 15:66021940-66021962 GGACAGGGCAGTCCAGGGAAGGG + Intronic
1128231544 15:66038957-66038979 TGCCAGTGCAGTCTAGGGAATGG + Intronic
1128393543 15:67200038-67200060 TTCCATGGCAGGCCAAGGCAAGG + Intergenic
1128526617 15:68416574-68416596 TGAGATGGCTGTCCAGGGCTCGG - Intronic
1128892342 15:71342564-71342586 TGCCAGGGCACACCAGGGCAGGG - Intronic
1129405328 15:75313205-75313227 TGCAATGGCAGGGCATGGCAGGG + Intergenic
1129659341 15:77544284-77544306 AGCCAGGGCAGGGCAGGGCAGGG - Intergenic
1129800162 15:78407731-78407753 GGCCCTGGCAATCTAGGGCATGG + Intergenic
1130274781 15:82470672-82470694 TTCCATAGCAGAGCAGGGCAGGG + Intergenic
1130467128 15:84198046-84198068 TTCCATAGCAGGGCAGGGCAGGG + Intergenic
1130497136 15:84475490-84475512 TTCCATAGCAGGGCAGGGCAGGG - Intergenic
1130510106 15:84582237-84582259 TGCAATGGCAGGGCATGGCAGGG - Intergenic
1130584972 15:85173760-85173782 TGCAATGGCAGGGCATGGCAGGG + Intergenic
1130589425 15:85202639-85202661 TTCCATAGCAGAGCAGGGCAGGG + Intergenic
1130730720 15:86489165-86489187 TGCCAGGGCAGTGCAGTGCCAGG - Intronic
1132626730 16:894933-894955 TGACAGGGCTGTCCTGGGCAGGG + Intronic
1132709599 16:1260460-1260482 TGCCCTGGGAGGCCAGGGCCCGG + Intergenic
1134820958 16:17247032-17247054 TTACTTGGCAGTCCAGGGCTAGG - Intronic
1136417642 16:30113430-30113452 TGGCATAGCTGCCCAGGGCAGGG + Exonic
1136538191 16:30912836-30912858 TGCCATTGCAGTCCAGCCTAGGG - Intergenic
1137355862 16:47763209-47763231 TGGCATGGCGGGGCAGGGCAGGG - Intergenic
1137823297 16:51465948-51465970 TGCCATTGCACTCCAGGCCTGGG - Intergenic
1138071490 16:53997069-53997091 TGCCATTGCACTCCAGGCAATGG + Intronic
1138200227 16:55082946-55082968 GGCCATGGCAGACCACTGCAAGG + Intergenic
1139635824 16:68257888-68257910 TGCCTTGGCAGTCCAGGACTGGG + Intronic
1140616782 16:76674848-76674870 TTCAATGGCAGTCTAGCGCACGG + Intergenic
1140685452 16:77429807-77429829 TGCCATAGCAGTTCCTGGCAGGG - Intronic
1141820202 16:86440433-86440455 TTGCATGGCAGTGCACGGCAGGG - Intergenic
1141956596 16:87376081-87376103 TGCTGTGGCAGTGGAGGGCAGGG - Intronic
1142317268 16:89355796-89355818 TGCCACGGCGGTTCACGGCAAGG + Intronic
1142851609 17:2707372-2707394 TGCCATGGCAGCCCCAGGAAGGG + Intronic
1143104147 17:4520019-4520041 GGACATGGCAGTCCAGGGTCAGG - Intronic
1143322479 17:6077039-6077061 TGTGGTGGAAGTCCAGGGCAGGG + Intronic
1143997466 17:11019671-11019693 TACCTTGGTAGACCAGGGCATGG - Intergenic
1145952187 17:28827314-28827336 TGCCATGGCACTCCAAGCCTGGG + Intronic
1146031883 17:29373202-29373224 TGCCATGGGAGCCCATTGCAGGG - Intergenic
1148212651 17:45817689-45817711 TGACTTGGGAGGCCAGGGCAGGG + Intronic
1148874009 17:50675849-50675871 AGCCATGGCAGTCAGGGACAGGG - Intronic
1150329934 17:64286554-64286576 TGTCCTGGGAGTCCAAGGCAGGG + Intergenic
1150813233 17:68373269-68373291 TGCCATTGCACTCCAGCCCAGGG - Intronic
1151527825 17:74682988-74683010 TCCCATGGTAATCCAGGGCAAGG + Intronic
1152522313 17:80863876-80863898 TGCCATGGCACTCCAGCCTAGGG + Intronic
1152639183 17:81442591-81442613 TGCCGTGGCAGGGGAGGGCAAGG + Exonic
1153728660 18:7983472-7983494 TGCCATGGCAGGACAGGGGCAGG - Intronic
1154943640 18:21138385-21138407 AACCATGGGAGCCCAGGGCAGGG + Intergenic
1155991533 18:32283853-32283875 TGCCATGGCAGTCAAAGAAAGGG - Intronic
1157180299 18:45491883-45491905 TGCCAGGGCATTCCAGAGCTAGG + Intronic
1157602761 18:48904258-48904280 TCCCATGGCAGACAAGGACAGGG + Intergenic
1157652425 18:49348052-49348074 TGCCCTAGCAGTGCAGTGCAGGG - Intronic
1160181373 18:76639418-76639440 TGCCACGGTAGTCAAGGGCCAGG + Intergenic
1160402331 18:78620139-78620161 GGCCATGGAAGTCCAGGCCCTGG + Intergenic
1160849573 19:1183865-1183887 TGCCACGTGAGTGCAGGGCAAGG + Intronic
1161729100 19:5948013-5948035 TGCCAAGGCGGCCCAGGGAAAGG + Intronic
1161845989 19:6712343-6712365 CCCCGTGGCAGTCCAGGGCGAGG - Exonic
1161979837 19:7624620-7624642 CACCCTGGCAGTGCAGGGCAGGG - Intronic
1161991342 19:7686035-7686057 TTCCAGGGCCGGCCAGGGCAGGG + Exonic
1162474036 19:10889132-10889154 TGACCTGGCAGTCTGGGGCAGGG + Intronic
1162753884 19:12845696-12845718 TGCCATTGCACTCCAGGCCTGGG - Intronic
1163348987 19:16763500-16763522 AACAATGGCATTCCAGGGCAAGG - Intronic
1163916398 19:20244349-20244371 TGCCTTGTCAGTGCAGTGCATGG + Intergenic
1164761544 19:30731961-30731983 TGTCATTTCAGTCCTGGGCAAGG + Intergenic
1165309785 19:35023016-35023038 TGGCATGGCAGTCAAGGGTATGG + Intronic
1166816483 19:45549360-45549382 TGTCAGGGCAGGGCAGGGCAGGG + Intronic
1166960499 19:46493638-46493660 TGCCAGGGCAGGCGAGGCCAAGG - Exonic
1167282036 19:48575148-48575170 TGCCATTGCACTCCAGCCCAGGG - Intronic
1167459047 19:49614790-49614812 TGCCATGGTGGCCCAGGGCACGG + Intronic
1168527834 19:57103005-57103027 TGCCATTGCACTCCAGCGCCTGG + Intergenic
927479879 2:23444364-23444386 TGCCATTGCACTCCAGGCCTGGG - Intronic
928281188 2:29947761-29947783 TCCCATGGCACTCCAGGGGGAGG - Intergenic
931830596 2:66047056-66047078 TGCCATGGCAGCTGAGGACATGG - Intergenic
932119312 2:69083474-69083496 TGCCACTGGAGTCCAAGGCAGGG - Intronic
932318647 2:70803375-70803397 TGCCATAACAGACCAGGCCAGGG + Intergenic
932586908 2:73036210-73036232 TGACATGGCAGCTCAGGGCTTGG - Intronic
932782726 2:74571952-74571974 TGCCATTGCACTCCAGGCCTGGG + Intronic
933997624 2:87681321-87681343 TGCTATGGCAACCCAGGGCAAGG - Intergenic
934053754 2:88233802-88233824 GGCCATGCCAATCCAGGCCATGG - Intergenic
934169441 2:89327335-89327357 TGCCATGGCAGTGCAGAGGCAGG - Intergenic
934197853 2:89855250-89855272 TGCCATGGCAGTGCAGAGGCAGG + Intergenic
934477341 2:94602382-94602404 TGCCAGGGAGGCCCAGGGCATGG + Intronic
934567114 2:95347016-95347038 TGCCATGGGCATCCAGGGCATGG + Intronic
934604300 2:95682574-95682596 AGCCAGGGGAGTCCAGGGAAAGG - Intergenic
934777399 2:96948235-96948257 AGCCATGCCCCTCCAGGGCAGGG + Intronic
934790218 2:97053549-97053571 TGCCATGGCAGTGCAGAGGCAGG + Intergenic
934816250 2:97328988-97329010 TGCCATGGCAGTGCAGAGGCAGG - Intergenic
934821446 2:97379496-97379518 TGCCATGGCAGTGCAGAGGCAGG + Intergenic
935164756 2:100560903-100560925 TGCCATTGCACTCCAGGGTGGGG + Intergenic
935327843 2:101954086-101954108 TGCCCTGGAAGTGCAGTGCAAGG + Intergenic
936062777 2:109306484-109306506 TGCCATGGAGGGGCAGGGCAGGG + Intronic
936296228 2:111269549-111269571 TGCTATGGCAACCCAGGGCAAGG + Intergenic
937056767 2:118944049-118944071 TGCAATGGCAGGACAGGGCTGGG + Intronic
937242366 2:120470563-120470585 TGCCAAGACAATCCAGGGCAAGG - Intergenic
937857152 2:126680683-126680705 TGCAATTGCAGCCCAGGGAAAGG + Intronic
938343587 2:130550793-130550815 TGCCATGACAGTTCACGGCAAGG - Intergenic
938346246 2:130569929-130569951 TGCCATGACAGTTCACGGCAAGG + Intergenic
938782624 2:134599229-134599251 TGCCATGGAAGCCCAGGAAAGGG + Intronic
938896078 2:135752087-135752109 TGCCATTGCACTCCAGCTCAGGG - Intronic
939237855 2:139520740-139520762 TACAATGTCAGTTCAGGGCAAGG + Intergenic
939366594 2:141241163-141241185 TTTCATGGCAGGACAGGGCAAGG - Intronic
940567390 2:155384719-155384741 AGGCACAGCAGTCCAGGGCAGGG + Intergenic
941021597 2:160412670-160412692 TGCTATGGGAGTCCACAGCAGGG + Intronic
941355767 2:164489230-164489252 TGCCTGGACAGTACAGGGCATGG - Intergenic
942293929 2:174499533-174499555 GGCCCAGGCAGTCCTGGGCAGGG - Intergenic
944469342 2:200036252-200036274 AGACAGGGCAGTCCAGAGCAAGG - Intergenic
946815826 2:223577708-223577730 TGCCATGCAAGTCAAGGGGAGGG + Intergenic
946828341 2:223702086-223702108 TGCCATAGCAATCCAGAGTAGGG - Intergenic
946973031 2:225116763-225116785 TACCATGCCAGTCCATGGCCAGG + Intergenic
947231223 2:227888582-227888604 TACCTTGGCATTCCAGGCCAGGG - Intronic
947714245 2:232331892-232331914 TGCCATCGGATTCCCGGGCAAGG - Intronic
947720326 2:232366089-232366111 TGCCATCGGATTCCCGGGCAAGG - Intergenic
947733455 2:232443271-232443293 TGCCATCGGATTCCCGGGCAAGG - Intergenic
947911452 2:233803507-233803529 GGCCTTGCCAGGCCAGGGCATGG - Intronic
948591554 2:239053906-239053928 TGCCCTGGGTGGCCAGGGCAGGG + Intronic
948894732 2:240922796-240922818 TGGCCTGGCAGGGCAGGGCAGGG + Intronic
1169500467 20:6155710-6155732 TGCCATTGCACTCCAGGCCTAGG - Intergenic
1171231429 20:23489833-23489855 TACCCTGGCAGGACAGGGCAGGG + Intergenic
1171498401 20:25574313-25574335 TGCCATGGCATGGCTGGGCAAGG + Intronic
1172191582 20:33064881-33064903 TGCCAAGGCACAGCAGGGCAAGG - Intronic
1172508129 20:35479308-35479330 TGCCAGGGCAGTCCAGGAGAAGG + Exonic
1173280466 20:41622415-41622437 TTCCGTGTCACTCCAGGGCAGGG + Intergenic
1174738378 20:52986995-52987017 TGCAATGCCAGGGCAGGGCAAGG + Intronic
1177125138 21:17184771-17184793 TGCTTAGGCAGGCCAGGGCAAGG - Intergenic
1178819308 21:35960968-35960990 TTCCATGGCAGTCCATTGTATGG + Intronic
1179307289 21:40166451-40166473 TGCCATGGCCCACCAGGTCAGGG + Intronic
1180188717 21:46152804-46152826 TGCAAGAGCAGTCAAGGGCAGGG + Intronic
1180549490 22:16528977-16528999 GGCCAAGGCAGGCCAGGGCCAGG - Intergenic
1180958290 22:19750866-19750888 TGGCAGGGCAGGGCAGGGCAGGG - Intergenic
1180958294 22:19750871-19750893 GCCCATGGCAGGGCAGGGCAGGG - Intergenic
1181262372 22:21607598-21607620 TGCCATGGCAGACCTGGGTGAGG + Intronic
1182608181 22:31523973-31523995 TGCCATTGCACTCCAGGTCAGGG + Intronic
1183058293 22:35320182-35320204 TGGCATGGCAGAACAGGCCAGGG + Intronic
1183058863 22:35323183-35323205 TGCCAGGACAGGGCAGGGCACGG + Intronic
1183252198 22:36738063-36738085 TGGCAGGGCAGGGCAGGGCAGGG - Intergenic
1183252200 22:36738068-36738090 GGGCATGGCAGGGCAGGGCAGGG - Intergenic
1183598997 22:38829241-38829263 TGCAATTGCTGTCTAGGGCAGGG + Intronic
1184071877 22:42151808-42151830 TCCTCTGGCAGCCCAGGGCAAGG - Intergenic
1184113992 22:42411509-42411531 TGACCTGGCAGTCCAGGGTGTGG + Exonic
1185015167 22:48338748-48338770 TGCCAGGGCAGAGCAGGCCACGG + Intergenic
1185235729 22:49711849-49711871 TGCCAAGGCAGCCCAAGGCCAGG + Intergenic
1185380870 22:50507057-50507079 TGCAAGGGCTGTCCAGGGCCTGG - Intronic
950120583 3:10480052-10480074 TGCCATTGCACTCCAGAGCCTGG + Intronic
951153953 3:19326278-19326300 TGTCATGGCAGGCAGGGGCACGG - Intronic
951527716 3:23669825-23669847 TGCCATGGTAATACTGGGCATGG - Intergenic
952449304 3:33416199-33416221 TTCCATAGCATTACAGGGCAGGG - Intronic
954144974 3:48630034-48630056 TGCACTGGGAGCCCAGGGCAGGG - Intronic
954652234 3:52172159-52172181 TGCCATGGGACTCCATGGAAAGG - Intergenic
955510277 3:59673256-59673278 TCCCATGGTACTCCATGGCAAGG - Intergenic
957605699 3:82396252-82396274 TGCCATTGCACTCCAGTGCCTGG - Intergenic
961037960 3:123656069-123656091 TGGGATGACAGTCCAGGGGAGGG - Intronic
961642318 3:128372350-128372372 TGCCATGGCAGTCCAGGGCATGG - Intronic
963450579 3:145475986-145476008 TGCCATTGCACTCCAGTGCTGGG + Intergenic
964716966 3:159732656-159732678 TTCCAGGGCAGGGCAGGGCAGGG + Intronic
966269149 3:178083834-178083856 TGACAGGGCAGGGCAGGGCAGGG - Intergenic
967873597 3:194251645-194251667 TGCCACGTCAGTCCAGCCCAAGG - Intergenic
967993961 3:195152992-195153014 TTCCATGGAAGTCCCAGGCAGGG + Intronic
968716547 4:2164147-2164169 TGTCACTGCAGTCCAGGTCATGG - Intronic
969148488 4:5145065-5145087 TGCCCTTGCTGTCAAGGGCAGGG + Intronic
969509202 4:7608021-7608043 TGCCATGCCCTGCCAGGGCATGG + Intronic
972012247 4:34199451-34199473 TGCCAAGGGAGGGCAGGGCAGGG - Intergenic
973547329 4:51995090-51995112 AGCCAAGGCTGTCCGGGGCAAGG - Exonic
973676394 4:53268146-53268168 GACAATGGCAGTCCAGAGCATGG + Intronic
975937566 4:79600239-79600261 TGTGGTGGCAGTGCAGGGCAGGG - Intergenic
976769037 4:88631411-88631433 TGCCACTGCACTCCAGGGCCTGG + Intronic
977924801 4:102687663-102687685 TGCCATGGAAGTGCAGAGCAGGG - Intronic
984710337 4:182879332-182879354 CTCCAGGGCAGACCAGGGCATGG - Intergenic
985590546 5:762241-762263 TGGCATGACTGTCCAGGGCTGGG - Intronic
986533756 5:8765199-8765221 TGCCTCAGCATTCCAGGGCAGGG - Intergenic
987099370 5:14578714-14578736 CTACATGCCAGTCCAGGGCATGG + Intergenic
987274592 5:16348577-16348599 TGCCATTGCACTCCAGAGCCTGG + Intergenic
990249889 5:53902960-53902982 TGCCATGTCAGTCACGGGAAGGG + Intronic
990295217 5:54394888-54394910 TGCCCAGGCAGTCAAGGCCAGGG - Intergenic
990942396 5:61215805-61215827 TCCCATCCCAGTCCAGGGCAGGG + Intergenic
991472328 5:66982631-66982653 AGCCAAGGCAGCCCAGGGTATGG - Intronic
991586572 5:68208153-68208175 TGCCACTGCACTCCAGGGCCAGG - Intergenic
992160623 5:73997364-73997386 TAGCATGGCAGCCAAGGGCATGG - Intergenic
992204671 5:74419877-74419899 TTCCAAGGGAGTCCAGGGCCTGG - Intergenic
992622925 5:78611262-78611284 TGCAGGGCCAGTCCAGGGCAGGG + Intronic
992690120 5:79233773-79233795 TGCCATTGCACTCCAGTGCCTGG - Intronic
993482105 5:88436473-88436495 TGCCATGCCAATTCAAGGCAGGG + Intergenic
994166764 5:96616927-96616949 TCTCATGGCAGGGCAGGGCATGG + Intronic
994662096 5:102666416-102666438 CTCCATGGCAGTCCTGAGCACGG + Intergenic
995650289 5:114361830-114361852 AGCCAGGGCGCTCCAGGGCAGGG - Intronic
996353507 5:122571958-122571980 TGCCAAGGCAGTGCTGGGGATGG + Intergenic
996728695 5:126696071-126696093 TGCCATTGCACTCCAGGCCTGGG + Intergenic
996808540 5:127486623-127486645 TGCCATGGCAGTCAAGCTGAAGG + Intergenic
997211345 5:132078816-132078838 TCCCGTGGCTGTCCAGGACAGGG - Intergenic
998024473 5:138803193-138803215 TGCCACTGCACTCCAGCGCATGG - Intronic
998116022 5:139538072-139538094 TGCCATTGCACTCCAGCCCAAGG - Intronic
998836779 5:146210112-146210134 GGCCATGGGCGTGCAGGGCAAGG + Intronic
998857094 5:146404145-146404167 TGGCATAGCAGTGCAGTGCATGG + Intergenic
999153202 5:149440507-149440529 GGCCAAGGCAGTGCAGGGAAGGG - Intergenic
999736314 5:154515982-154516004 TGCCATTGCACTCCAGGCCTGGG - Intergenic
1000880076 5:166687091-166687113 TGAGATGGCAGCCCAGGGCCAGG + Intergenic
1001694509 5:173660175-173660197 AGCCCTGGCAGCCCTGGGCAGGG - Intergenic
1002026750 5:176400971-176400993 GGCCAGGGCAGGCCAGGACAGGG + Intronic
1002101985 5:176862276-176862298 TGCCCGGGAGGTCCAGGGCAAGG - Intronic
1003045785 6:2731583-2731605 TGCCATAGGAGTCCAGAGCAGGG - Intronic
1003211296 6:4069786-4069808 GGCATTGGCAGTCCAGGGTAAGG + Exonic
1005596861 6:27388178-27388200 TGCCCTGGGAGTTCAGAGCAGGG - Intronic
1006173785 6:32109837-32109859 TCCCCTGGCAGTCTGGGGCAGGG + Intronic
1007369919 6:41420046-41420068 TACACTGGGAGTCCAGGGCAGGG + Intergenic
1007426153 6:41747455-41747477 GGTCATGGCTGCCCAGGGCAGGG - Intronic
1009621617 6:66085017-66085039 TGCAATGGCAGTGCAGGGTGGGG + Intergenic
1014433808 6:121399617-121399639 TGCCATTGCACTCCAGAGCCTGG + Intergenic
1014964502 6:127730223-127730245 TGCCACTGCAGTCCAGGCCTGGG + Intronic
1015326420 6:131928844-131928866 TGCCATTGCACTCCAGCGCCTGG + Intergenic
1016685193 6:146873104-146873126 TGCCATCTCAGTCGATGGCAAGG + Intergenic
1017249323 6:152262750-152262772 TGCGAAGGTAGTACAGGGCATGG + Intronic
1017718876 6:157231171-157231193 TTCAATGGCAGCCCAGGACAAGG + Intergenic
1018903465 6:168062629-168062651 TGCCCAGGCTTTCCAGGGCACGG + Intronic
1018955496 6:168407467-168407489 AGCACTGGCAGTCCATGGCATGG - Intergenic
1022313070 7:29215630-29215652 TGCTATGTCATTCCAGGGCAAGG + Intronic
1024857331 7:53796794-53796816 TCCTGTGGCTGTCCAGGGCATGG - Intergenic
1026282408 7:68933494-68933516 GGGCATGGCAGGGCAGGGCAGGG + Intergenic
1026850724 7:73721638-73721660 TGCTTTGGCAGTCCTGGGGAAGG - Intergenic
1027005787 7:74691816-74691838 TGCCATTGCACTCCAGCCCAGGG - Intronic
1027687422 7:81294997-81295019 TGCCCTGGCTGTCCATGCCATGG + Intergenic
1029813025 7:103068545-103068567 AGCCATGGAATTCCAGGGGAAGG + Intronic
1031861570 7:126985646-126985668 TCTCAAGGCAGTGCAGGGCAGGG + Intronic
1032019051 7:128396494-128396516 TACCATGGCAGAACAGGGCCTGG + Intronic
1032280301 7:130494467-130494489 TGCCTTTGAAGTCCTGGGCATGG + Intronic
1033595257 7:142854697-142854719 GACCGTGGCAGTTCAGGGCAGGG - Intergenic
1036650980 8:10643845-10643867 TGCCATGGAAATTCAGGGAATGG + Intronic
1037488802 8:19376578-19376600 TGCCATTGCACTCCAGGCCTGGG + Intronic
1038483011 8:27914690-27914712 CACCAAGGCAGGCCAGGGCATGG + Intronic
1038554706 8:28500800-28500822 TGCCATTGCACTCCAGGCCTGGG - Intronic
1039310377 8:36312100-36312122 TGCCATTGCAGTGCAGCTCAGGG - Intergenic
1039517990 8:38148911-38148933 TGCCATGGGAGTTGAGGGCCTGG - Intronic
1039561621 8:38516942-38516964 TGCCCTGGCATTGGAGGGCAGGG - Intronic
1039943802 8:42113242-42113264 TGCGGTGGAAGACCAGGGCAAGG - Intergenic
1040342020 8:46445912-46445934 TTCCAGGGCTGTCCCGGGCAGGG - Intergenic
1041248995 8:55916740-55916762 TGCCATTGCAGTATTGGGCATGG - Intronic
1043946524 8:86260266-86260288 TACCATGGAAGTCCAGGGATAGG - Intronic
1045198284 8:99952258-99952280 TCACATAGCAGTCCAGTGCAAGG + Intergenic
1045495822 8:102707640-102707662 TGCCATTGCACTCCAGAGCCTGG - Intergenic
1047736192 8:127767419-127767441 TGCCATTGCACTCCAGCCCATGG - Intergenic
1048381816 8:133871912-133871934 GGCCAGGGCAGGCCAAGGCAGGG + Intergenic
1048573400 8:135672781-135672803 TGCCAGGGCTGGCCAGGGCATGG - Intergenic
1049586884 8:143436435-143436457 TGTGATGGCAGTTCAGGGCCAGG - Intergenic
1050175519 9:2866191-2866213 TGCCATTGCACTCCAGCCCAGGG - Intergenic
1052230406 9:26144357-26144379 TGCCATTGCACTCCAGCGCCTGG - Intergenic
1052852629 9:33387180-33387202 TGCCAGGGAGGCCCAGGGCATGG - Intronic
1053138308 9:35665367-35665389 GGCCAAGGCAGGGCAGGGCAGGG + Intronic
1053209201 9:36213257-36213279 GGCCATGGGAGTTCAGGGGAAGG - Intronic
1053542398 9:38987735-38987757 TCCCGTGGGACTCCAGGGCAAGG - Intergenic
1053806851 9:41811253-41811275 TCCCATGGGACTCCAGGGCAAGG - Intergenic
1054623743 9:67376174-67376196 TCCCGTGGGACTCCAGGGCAAGG + Intergenic
1054713719 9:68537075-68537097 TGCCAGGGCAGGGCAGGCCAGGG - Exonic
1055920520 9:81455416-81455438 TCCCAGGGCAGGGCAGGGCAGGG - Intergenic
1056509887 9:87294265-87294287 TGGAATGGCAATCCAAGGCAAGG + Intergenic
1057747871 9:97766263-97766285 TGCCTTGGCATTCCTGGGCTGGG - Intergenic
1057925622 9:99145399-99145421 TGCTATGACAGTCCCTGGCAGGG - Intronic
1058085290 9:100741649-100741671 AGCCATGGCAGGCCATGGAAAGG + Intergenic
1059424924 9:114215060-114215082 AGCCTTGGCAGTCCTGGCCAGGG - Intronic
1061146756 9:128804174-128804196 TGCCATCCCAGCCCAGGGCGAGG + Intronic
1061507961 9:131042648-131042670 TGCCATGGCTGTGAAAGGCAAGG - Intronic
1061588924 9:131585615-131585637 AGCTATGGCAGTCCAGCGTAGGG - Intronic
1062047134 9:134429615-134429637 TGCCGTGGCAGCCCGGGGCGTGG + Intronic
1062194757 9:135266785-135266807 TCCCAGGGCAGGACAGGGCATGG - Intergenic
1062237124 9:135515646-135515668 GGCCATGGAGGCCCAGGGCATGG - Intergenic
1187245392 X:17549210-17549232 TGCCAGGCCAGGCCAGGGCCAGG + Intronic
1189160362 X:38804040-38804062 CGCCGGGGCAGGCCAGGGCAGGG - Exonic
1189473137 X:41329770-41329792 TGCCATGGCACTCCAGCCCCTGG + Intergenic
1190296253 X:49029620-49029642 TGCCTGGGCAGAGCAGGGCAGGG + Exonic
1192269119 X:69561931-69561953 TGCTATGGGAGTCCAGTGGAGGG - Intergenic
1196519603 X:116657749-116657771 TCCCATGACAGTCCTGGGCAAGG + Intergenic
1196711770 X:118770424-118770446 TGCCATGGAAGGCCAGTGCCAGG - Intronic
1198095546 X:133376664-133376686 TGCCAAGGCAATCCAGGTCATGG - Intronic
1200316010 X:155134024-155134046 AGCCAGGGCAGTTGAGGGCAGGG + Intronic