ID: 961643404

View in Genome Browser
Species Human (GRCh38)
Location 3:128379291-128379313
Sequence GCTTCAATGGCCAAAGCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961643404 Original CRISPR GCTTCAATGGCCAAAGCGGG AGG (reversed) Intronic
903977528 1:27160735-27160757 GCTTTTAAGGCCGAAGCGGGCGG - Intronic
904319709 1:29689107-29689129 CCTTCAATGGCCAAAGTAGGGGG + Intergenic
904719693 1:32498831-32498853 GTTTGTATGGCCAAAGCAGGTGG - Intronic
905811061 1:40913558-40913580 GCTTCCAGGGCCAAGGCAGGAGG - Intergenic
906161244 1:43650501-43650523 GCTTCACTCGCCAAGGCGGCGGG + Intronic
909289287 1:73861739-73861761 ACTTCCATGGCCAGAGCAGGAGG + Intergenic
909922130 1:81395152-81395174 CTTTGAAAGGCCAAAGCGGGTGG - Intronic
911744010 1:101419251-101419273 CTTTCAAAGGCCAAAGCAGGTGG + Intergenic
915623285 1:157099105-157099127 GCTGACATGGCCAAAGAGGGGGG - Intronic
916454242 1:164954015-164954037 GCTTACATGGCCACAGAGGGTGG + Intergenic
917051843 1:170933069-170933091 TCTTACATGGCCAAAGCAGGAGG + Intergenic
917700246 1:177573434-177573456 TCTTACATGGCCAAAGCAGGAGG + Intergenic
920642118 1:207762877-207762899 GCAGCAGTGTCCAAAGCGGGGGG - Intronic
1064406596 10:15069621-15069643 CCTTCAGAGGCCAAGGCGGGCGG + Intronic
1067798323 10:49337344-49337366 GCTTTAAAGGTCAAATCGGGTGG + Intergenic
1074847763 10:117413636-117413658 ACTTCGAGGGCCAAGGCGGGTGG + Intergenic
1075816861 10:125271378-125271400 GATTCATTGGCCAAATGGGGTGG + Intergenic
1076343647 10:129766270-129766292 GCTTCATTTGCAAAAGCAGGTGG + Intronic
1079034129 11:17007815-17007837 CTTTGAATGGCCAAAGCAGGAGG - Intronic
1086468037 11:87075531-87075553 GTTTCAGTGGCCAAGGCAGGAGG - Intronic
1093062352 12:14620403-14620425 GCTTCAATGGGCAAGGTGGGCGG - Intronic
1094427907 12:30334823-30334845 CTTTCAGAGGCCAAAGCGGGCGG + Intergenic
1099587015 12:84532075-84532097 GCTTACATGGCCAGAGCAGGAGG - Intergenic
1100514309 12:95312290-95312312 ACTTCAGAGGCCAAAGCAGGCGG + Intergenic
1100640223 12:96475456-96475478 GCTTATAAGGCCAAGGCGGGCGG + Intergenic
1106113396 13:26796648-26796670 CTTTGAAAGGCCAAAGCGGGAGG + Intergenic
1107069923 13:36258198-36258220 GCTTCTTTGGCCAAATTGGGTGG + Intronic
1108395900 13:49991288-49991310 CTTTGATTGGCCAAAGCGGGTGG + Intergenic
1117426341 14:55601977-55601999 CCTTCAGAGGCCACAGCGGGTGG - Intronic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1121835928 14:97092322-97092344 GCTTCCATGGGCAGAGCTGGTGG + Intergenic
1122044497 14:99013549-99013571 CTTTCAGAGGCCAAAGCGGGCGG + Intergenic
1122690677 14:103530836-103530858 GCTTCAATCGCCACACTGGGCGG - Intronic
1122797291 14:104212428-104212450 GCTTCAGTGGCCAACACAGGTGG - Intergenic
1124026592 15:25972588-25972610 GCTTAAAAGGCCAAGGAGGGTGG + Intergenic
1132093688 15:98966322-98966344 ACTTCAGGGGCCACAGCGGGGGG + Intergenic
1133714190 16:8431155-8431177 GCTTGAAAGGCCAAAGCGTGGGG - Intergenic
1133995213 16:10742941-10742963 GCTTCACTGGCCACATCTGGGGG + Intergenic
1135471655 16:22736660-22736682 GCTGGAATGGCCAACGAGGGTGG - Intergenic
1138752216 16:59437555-59437577 CTTTGAAAGGCCAAAGCGGGTGG - Intergenic
1141656692 16:85420504-85420526 GCTTCCAGGGCCAAGGGGGGTGG + Intergenic
1142628325 17:1206642-1206664 TCTTGAATGGCCAAGGTGGGTGG + Intronic
1146398117 17:32484753-32484775 GTTTCAGAGGCCAAGGCGGGCGG - Intergenic
1150281321 17:63931113-63931135 CCTTCAGTGGCCAAGGCTGGAGG + Intronic
1152071557 17:78136604-78136626 GCTTCAATGTCCATAGGCGGCGG + Intronic
1154485125 18:14866895-14866917 GCTGCACTGGCCAATGCAGGGGG + Intergenic
1156426104 18:37014636-37014658 TCTTAAATGGCCAGAGCAGGAGG + Intronic
1157655673 18:49385449-49385471 ACTTCGAAGGCCAAGGCGGGTGG + Intronic
1159110863 18:64054904-64054926 GCTTCATTTCCCAAAGCAGGGGG - Intergenic
1163860510 19:19740392-19740414 GCTTCACTGGCCAGAGGGAGTGG + Intergenic
1164315739 19:24086718-24086740 CTTTCGATGGCCAAGGCGGGCGG - Intronic
1166843661 19:45713305-45713327 ACCTCAGTGGCCAAGGCGGGTGG + Exonic
926124984 2:10266497-10266519 ACTTCAGAGGCCAAGGCGGGAGG + Intergenic
928180076 2:29062633-29062655 GCTTGCATGGCCACAGCAGGGGG + Exonic
932112093 2:69011121-69011143 GCTTGAATGTGGAAAGCGGGTGG - Intergenic
932166836 2:69515570-69515592 TCTTCAGAGGCCGAAGCGGGAGG - Intronic
935798867 2:106672171-106672193 TCTTACATGGCCAAAGCAGGAGG - Intergenic
940035830 2:149311076-149311098 GCTTCTTTGGCCAAATTGGGTGG - Intergenic
941777987 2:169413616-169413638 TCTTCAAGGGCCAAAGCAGAAGG + Intergenic
943676409 2:190720153-190720175 CCTTCAGAGGCCAAAGTGGGAGG - Intergenic
944055746 2:195520319-195520341 GTTTCAGAGGCCAAGGCGGGAGG + Intergenic
944258591 2:197651373-197651395 ATTTCAATGGCCAGAGCGGGTGG + Intronic
945209613 2:207368636-207368658 GGTGAAAAGGCCAAAGCGGGGGG - Intergenic
945589779 2:211715692-211715714 TCTTCCATGGCCAGAGCAGGAGG - Intronic
948761201 2:240192233-240192255 CCTTACATGGCCAGAGCGGGAGG - Intergenic
1169022680 20:2341190-2341212 GTTTCAATGTCCAAAGGGAGTGG + Intergenic
1172162685 20:32879404-32879426 GGTTCAGTGGGCACAGCGGGTGG - Intronic
1174925121 20:54750772-54750794 TCTTAAATGGCCAGAGCAGGAGG + Intergenic
1176387172 21:6144044-6144066 TCTTCCATGGCCAGAGCAGGAGG - Intergenic
1178103683 21:29297091-29297113 CTTTCAAAGGCCAAGGCGGGCGG - Intronic
1179365621 21:40756227-40756249 GCTCCTATGGCCAGAGCGGGAGG - Intronic
1179736301 21:43394208-43394230 TCTTCCATGGCCAGAGCAGGAGG + Intergenic
1180204945 21:46254008-46254030 TCTTACATGGCCAAAGCAGGAGG - Intronic
1181335391 22:22124798-22124820 GCTTCACTGCCCATGGCGGGGGG + Intergenic
1182814116 22:33143466-33143488 GCTTCAATGCCCAGAGAGAGAGG + Intergenic
1184973303 22:48043203-48043225 GCCTCAAAGGCCAGAGCAGGCGG - Intergenic
1185169802 22:49286132-49286154 GCTTCAATATACAAACCGGGGGG + Intergenic
949535134 3:4989517-4989539 GCTTCCATGGCCAATGGGAGAGG - Intergenic
950722374 3:14892440-14892462 CCTTCAAAGGCCAACACGGGAGG - Intronic
951401077 3:22231932-22231954 TCTTCCATGGCCAGAGCAGGAGG - Intronic
951909107 3:27730650-27730672 GCGTCAAGGACCAAAGAGGGAGG - Intergenic
951936902 3:28032215-28032237 TCTTCCATGGCCAAAGCAGGAGG - Intergenic
956144447 3:66178177-66178199 GCTTCAATGGTCCTAGCTGGAGG + Intronic
961643404 3:128379291-128379313 GCTTCAATGGCCAAAGCGGGAGG - Intronic
964394312 3:156229290-156229312 GCTTACATGGCCAGAGCAGGAGG + Intronic
965702012 3:171467696-171467718 ACTTCAGTGGCCAAGGTGGGAGG - Intergenic
966202499 3:177371990-177372012 ACTTCAATAGGCAAAGGGGGTGG - Intergenic
974500220 4:62689895-62689917 GCTTCTTTGTCCAAAGTGGGGGG + Intergenic
980956761 4:139436456-139436478 GCTGCCATGGCCAAAGCCGGGGG + Intergenic
986797025 5:11222695-11222717 CCTTGGATGGCCAAAGCAGGAGG + Intronic
993249407 5:85498771-85498793 TCTTCCATGGCCGAAGCAGGAGG - Intergenic
993933601 5:93973055-93973077 GCTTCAGTGGCTAAAGTGGGAGG - Intronic
994380719 5:99067841-99067863 TCTTACATGGCCAAGGCGGGAGG + Intergenic
994616992 5:102116401-102116423 GTTTCAAAGGCCAAGGAGGGTGG - Intergenic
995346577 5:111127091-111127113 CTTTCAGAGGCCAAAGCGGGAGG + Exonic
998310848 5:141129018-141129040 CCTTCAGAGGCCAAGGCGGGTGG - Intronic
999194693 5:149774034-149774056 GCTACAGTGGCCAAAGCAGGAGG - Intronic
1006731334 6:36238577-36238599 TCTTACATGGCCAAAGCAGGAGG + Intergenic
1008777844 6:55062408-55062430 GCTGCACTGGCCAGAGCAGGTGG - Intergenic
1012547034 6:100431898-100431920 CATTCATTGGCCAAAGTGGGAGG + Intronic
1015182046 6:130370853-130370875 TCTACAATGGCCAAAGTAGGGGG - Intronic
1016811452 6:148265199-148265221 GCTTCAGAGGCCAAAACAGGAGG + Intergenic
1016941259 6:149484468-149484490 TCTTCAAAGGCCACAGCAGGAGG + Intronic
1017763500 6:157589157-157589179 TCTTAAATGGCCAGAGCAGGAGG + Intronic
1018320229 6:162600772-162600794 TCTTAAATGGCCATAGCAGGAGG - Intronic
1018565152 6:165143837-165143859 TCTCCACTGGCCAAAGCAGGAGG - Intergenic
1018579315 6:165294640-165294662 CTTTGAATGGCCAAAGCAGGTGG + Intronic
1019995218 7:4719723-4719745 CCTTGAGAGGCCAAAGCGGGTGG - Intronic
1024223487 7:47305606-47305628 GCTTCAAAGGCCACACCGTGGGG + Intronic
1026342478 7:69446249-69446271 CCTTGGAAGGCCAAAGCGGGAGG + Intergenic
1028110092 7:86929880-86929902 TCTTAAATGGCCAGAGCAGGAGG - Intronic
1028870342 7:95764630-95764652 CTTTCAAAGGCCAAGGCGGGAGG - Intergenic
1029184690 7:98730208-98730230 ACTTCAGAGGCCAAGGCGGGAGG - Intergenic
1033189969 7:139268961-139268983 GGATCAAAGGCCAAGGCGGGTGG + Intronic
1035104616 7:156431827-156431849 TCTTCCATGGCCAGAGCAGGAGG - Intergenic
1035166467 7:156993332-156993354 GATTCCACGGCCAAAGCAGGGGG + Intergenic
1036120020 8:6006200-6006222 TCTTCCATGGCCAGAGCAGGAGG + Intergenic
1037580410 8:20242374-20242396 ACTTGAAAGGCCAAGGCGGGTGG + Intergenic
1039546650 8:38415543-38415565 GGTGCAGTGGCCAAGGCGGGAGG - Intronic
1041628693 8:60060560-60060582 GCTTAAAAATCCAAAGCGGGGGG - Intergenic
1042893978 8:73645785-73645807 TCTTACATGGCCAAAGCAGGAGG + Intronic
1044679732 8:94764969-94764991 CTTTCAGTGGCCAAAGTGGGTGG - Intronic
1044944420 8:97377407-97377429 GCATCACTGGCAAATGCGGGAGG + Intergenic
1046611384 8:116429457-116429479 TCTTCCATGGCCACAGCAGGAGG + Intergenic
1050827967 9:9973217-9973239 CTTTGAAAGGCCAAAGCGGGAGG + Intronic
1057982975 9:99680985-99681007 GCTTACATGGCCAGAGCAGGAGG + Intergenic
1188005400 X:25013135-25013157 GCTGCAGTGGCCACAGAGGGCGG - Exonic
1188135398 X:26488348-26488370 GCTTCAATGGCCATGACAGGAGG - Intergenic
1189532485 X:41901236-41901258 ACTTCAGAGGCCAAGGCGGGTGG + Intronic
1194269350 X:91791395-91791417 TCTTATATGGCCAAAGCAGGAGG + Intronic
1198818717 X:140622141-140622163 TCTTAGATGGCCAAAGCAGGAGG + Intergenic
1200586570 Y:5012380-5012402 TCTTATATGGCCAAAGCAGGAGG + Intronic