ID: 961647855

View in Genome Browser
Species Human (GRCh38)
Location 3:128401959-128401981
Sequence GAAAGCTCGCTGACATCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 93}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961647855_961647865 15 Left 961647855 3:128401959-128401981 CCTAGAGATGTCAGCGAGCTTTC 0: 1
1: 0
2: 0
3: 5
4: 93
Right 961647865 3:128401997-128402019 TCCCCGGCTCCTGTGTGCCATGG 0: 1
1: 0
2: 1
3: 20
4: 199
961647855_961647857 -1 Left 961647855 3:128401959-128401981 CCTAGAGATGTCAGCGAGCTTTC 0: 1
1: 0
2: 0
3: 5
4: 93
Right 961647857 3:128401981-128402003 CTGGCCCTCCCTCCCCTCCCCGG 0: 1
1: 2
2: 10
3: 167
4: 1011
961647855_961647870 25 Left 961647855 3:128401959-128401981 CCTAGAGATGTCAGCGAGCTTTC 0: 1
1: 0
2: 0
3: 5
4: 93
Right 961647870 3:128402007-128402029 CTGTGTGCCATGGATTGAGCAGG 0: 1
1: 1
2: 3
3: 38
4: 393

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961647855 Original CRISPR GAAAGCTCGCTGACATCTCT AGG (reversed) Intronic
902489418 1:16770309-16770331 GAAATCTGGGTGACAACTCTGGG - Intronic
909363931 1:74798200-74798222 AAAAGCTCCCTGAAGTCTCTGGG + Intergenic
911511262 1:98809648-98809670 CAAAGCTCTCTGACATGTCCTGG + Intergenic
911879242 1:103213550-103213572 GAAAGGTTGTTGACATTTCTTGG - Intergenic
915001052 1:152591999-152592021 GAAAGCTCCATGACATTGCTCGG - Intronic
916488669 1:165281895-165281917 GAAAACTCATTGCCATCTCTGGG - Intronic
918200630 1:182263130-182263152 GATAGCTCTGTGGCATCTCTAGG + Intergenic
919356680 1:196533547-196533569 GAAAGCTAGTTCATATCTCTTGG - Intronic
920186704 1:204163822-204163844 GAAAGCTACCTAACCTCTCTGGG + Intronic
920210155 1:204322141-204322163 GAAAGCTTCCTAACCTCTCTGGG - Intronic
920701242 1:208219402-208219424 GACAGCTCGCTGCCTTCTCCTGG - Intronic
923531020 1:234812216-234812238 GAAATCTGGGTGACAACTCTGGG + Intergenic
1068740495 10:60463462-60463484 TAAAGCTCCCTGTCATCTTTGGG + Intronic
1069293168 10:66809105-66809127 TAAAGCTTGCTGACATCATTTGG + Intronic
1069565899 10:69463280-69463302 GAAAGCTGGCTGTGATCTCCAGG + Intronic
1071813393 10:89207366-89207388 GAAAGGCAGCTGACATCACTCGG - Intergenic
1077130203 11:968235-968257 GAGTGCTCTGTGACATCTCTGGG + Intronic
1080802792 11:35623720-35623742 GACAGCTAGCTGACAGCTGTGGG - Intergenic
1084182919 11:67455578-67455600 GAAAGCGCACTGGCAGCTCTGGG + Exonic
1088908021 11:114169483-114169505 GAAACCTCGATGACTACTCTGGG + Intronic
1090746063 11:129705670-129705692 GAAAGTCCTCTGACCTCTCTGGG - Intergenic
1095512922 12:42973494-42973516 TAAAGATTGCTGACATCTATTGG + Intergenic
1100047409 12:90399416-90399438 GCCAGCTCACTCACATCTCTGGG + Intergenic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1104229864 12:126874365-126874387 GAGATTTCGCTGACATCTGTAGG + Intergenic
1104847831 12:131855687-131855709 GACAGCTCTCTGCCAGCTCTGGG - Intergenic
1107011833 13:35677897-35677919 GAAAGCTAGTTGACATCACTTGG + Intergenic
1113074020 13:106450619-106450641 TAAAGCTCACCGACATCTGTGGG - Intergenic
1113952291 13:114078848-114078870 GACAGCTCGCTGTCAGCACTTGG - Intronic
1113983954 13:114298992-114299014 GAAAGCACGCTCACGTCTCCTGG - Exonic
1118170191 14:63380987-63381009 GAACACTCGCACACATCTCTGGG + Intronic
1128332394 15:66764017-66764039 GAAAGAACGCTGACAGCTCAGGG + Intronic
1130678734 15:85977874-85977896 GAAAGCTGCCTGACTTCTGTGGG + Intergenic
1137476970 16:48817581-48817603 GAAAGAACGCTGACATCTTGGGG - Intergenic
1138384996 16:56630303-56630325 CACAGCTCTGTGACATCTCTGGG - Intergenic
1143628994 17:8126498-8126520 GGAAGCTCGCTGACACTTCCAGG + Intergenic
1144743101 17:17595422-17595444 GAGAGCTGGCTGACAGCTCAGGG + Intergenic
1145257868 17:21337471-21337493 GAAAGCTCGGTGCCCTCTCTGGG + Intergenic
1147887955 17:43697282-43697304 GAGAGCACGCTGCCCTCTCTGGG - Intergenic
1148047606 17:44753631-44753653 GCAAGCCCGCTGGCCTCTCTGGG - Intergenic
1153994131 18:10424928-10424950 TAAAGCTTGCTGTCTTCTCTGGG - Intergenic
1157814607 18:50721755-50721777 GGCAGGTGGCTGACATCTCTGGG - Intronic
1166260649 19:41638257-41638279 GAGAGCTGGCTGGGATCTCTGGG + Intronic
1167887378 19:52512991-52513013 GAAAACTGGCTCACATCTCTTGG - Intergenic
1167918888 19:52764920-52764942 GAAAAGTGGCTGACATCTGTTGG + Exonic
1168251292 19:55143704-55143726 GAAAGCTCACTGGCAGCTCACGG - Intronic
926870691 2:17412340-17412362 AAAAGTTCTCTGACATCACTAGG + Intergenic
928386268 2:30871153-30871175 GAAAAGTCTCTTACATCTCTTGG - Intergenic
931073182 2:58678169-58678191 AAAAGCTGGCTGTCATCTGTGGG - Intergenic
941450974 2:165659528-165659550 GATACCTTCCTGACATCTCTTGG - Intronic
1169033307 20:2430138-2430160 GAAAGCTTGGAAACATCTCTGGG + Intronic
1170580899 20:17698829-17698851 CAAAGCTGGCTGAGCTCTCTGGG - Intronic
1171428619 20:25064471-25064493 GCAAGGCCCCTGACATCTCTAGG + Intergenic
1174097133 20:48098324-48098346 GACAGCTCCCTGACATGTCTGGG - Intergenic
1178736117 21:35153336-35153358 GAAAGCCAGCTGCAATCTCTAGG + Intronic
1182061140 22:27398622-27398644 GAAAGCTAGCAGCCAACTCTGGG - Intergenic
1184944313 22:47791893-47791915 GAAAGTTCACTGAGATTTCTAGG + Intergenic
954986289 3:54796307-54796329 GAAAGCCCCCTGAGAACTCTAGG - Intronic
956221384 3:66907582-66907604 GAAAGCTTGTTGAGAACTCTTGG + Intergenic
958604317 3:96338735-96338757 AAAAGCTCTCTGACATGTCCTGG - Intergenic
959120517 3:102226874-102226896 TAAAGGTTGCTGACATCCCTTGG + Intronic
960145861 3:114201393-114201415 GAAAGGTCAGTGACATCTGTAGG - Intergenic
961647855 3:128401959-128401981 GAAAGCTCGCTGACATCTCTAGG - Intronic
967809314 3:193743599-193743621 GACATCTCACTGACATGTCTTGG + Intergenic
975458171 4:74618079-74618101 GAAAGCCTGCTTACATTTCTGGG - Intergenic
977138820 4:93340771-93340793 GAAAGCCCTCTGAGAGCTCTAGG - Intronic
980590116 4:134875678-134875700 GGAAGCCTGCTGACCTCTCTAGG - Intergenic
984471777 4:180184939-180184961 GAATGCACGCTCACCTCTCTTGG - Intergenic
988896635 5:35681844-35681866 TAAAGCTCTCTGGCTTCTCTTGG - Intronic
992325184 5:75653364-75653386 GAAGGCTGGCTGACTTCTTTTGG + Intronic
992460248 5:76953763-76953785 GAGGGCTCGCGGACATCTCGGGG + Intronic
999012255 5:148055953-148055975 CAAAGGTCTCTGATATCTCTTGG - Intronic
999347603 5:150838318-150838340 CAAAGATTGCTGTCATCTCTAGG - Intergenic
1003382412 6:5637159-5637181 GAACGCTCCCTGTCAGCTCTGGG - Intronic
1004508463 6:16265325-16265347 GAAGGCTCCCTGAGCTCTCTAGG - Intronic
1005175611 6:23041109-23041131 GAAACCTAGGTGACATGTCTGGG + Intergenic
1007386560 6:41524087-41524109 AAAAGCTCGATGACAGCTCCAGG - Intergenic
1007557083 6:42775284-42775306 GAAAGCACACTGACATTTATTGG + Intronic
1007762359 6:44140441-44140463 CAAACCTAGCTGACACCTCTTGG - Intronic
1008520721 6:52360673-52360695 GAGAGTTCCCTGACATCTTTGGG + Intergenic
1009814671 6:68716776-68716798 GGAAGCTTGCTGACATATTTAGG + Intronic
1018484383 6:164226332-164226354 GAAAGCTTGCTGTCATTTTTGGG - Intergenic
1022387952 7:29919018-29919040 GAAAGCAAGCTGGCATTTCTGGG + Intergenic
1023184093 7:37515436-37515458 GAAACCTGGCTGAAATCTATAGG + Intergenic
1024002401 7:45199337-45199359 GAATGCTCATTGACATCACTGGG - Intergenic
1032501843 7:132405529-132405551 GAAAGATGGGTGACAGCTCTCGG + Intronic
1032612575 7:133431058-133431080 GAAAGTTACCTGACATCTCTGGG - Intronic
1034737725 7:153444535-153444557 GAAAGCTGGGTGACTTCTTTGGG + Intergenic
1035902149 8:3468648-3468670 GAATGCTCTCTGCCCTCTCTTGG + Intronic
1040460455 8:47642512-47642534 GACAGCCCGCTGACTTCTTTGGG + Intronic
1042043295 8:64619041-64619063 GAAAGCCAGCTAACATCTCCAGG - Intronic
1056886240 9:90446825-90446847 GAAAGCTCCCTGCCACCCCTTGG + Intergenic
1186100065 X:6146393-6146415 GAAAGCTCTGTGACAGCTCAGGG - Intronic
1188994109 X:36861094-36861116 GAGAACTTGCAGACATCTCTAGG - Intergenic
1191216067 X:57933420-57933442 GAATGCTCCCTGGTATCTCTGGG - Intergenic
1192717012 X:73653930-73653952 GAAAGATTGGTGACATCTTTAGG + Intronic
1193152229 X:78137948-78137970 CAAAGTTTGCTCACATCTCTTGG + Exonic
1194614599 X:96085937-96085959 GAAACCTGGCTGATATCTCAAGG + Intergenic
1195401905 X:104469828-104469850 TACAGCTCTCTGACATCTCCAGG - Intergenic