ID: 961648572

View in Genome Browser
Species Human (GRCh38)
Location 3:128405896-128405918
Sequence CCTCCTTGGCAGGCAGGGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 268}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961648560_961648572 14 Left 961648560 3:128405859-128405881 CCCTTTGTGCACATGGGGAGGGG 0: 1
1: 0
2: 1
3: 19
4: 159
Right 961648572 3:128405896-128405918 CCTCCTTGGCAGGCAGGGTATGG 0: 1
1: 0
2: 1
3: 27
4: 268
961648562_961648572 13 Left 961648562 3:128405860-128405882 CCTTTGTGCACATGGGGAGGGGA 0: 1
1: 0
2: 1
3: 19
4: 200
Right 961648572 3:128405896-128405918 CCTCCTTGGCAGGCAGGGTATGG 0: 1
1: 0
2: 1
3: 27
4: 268
961648553_961648572 28 Left 961648553 3:128405845-128405867 CCAGCCTGTACAGGCCCTTTGTG 0: 1
1: 0
2: 1
3: 17
4: 114
Right 961648572 3:128405896-128405918 CCTCCTTGGCAGGCAGGGTATGG 0: 1
1: 0
2: 1
3: 27
4: 268
961648554_961648572 24 Left 961648554 3:128405849-128405871 CCTGTACAGGCCCTTTGTGCACA 0: 1
1: 0
2: 0
3: 8
4: 166
Right 961648572 3:128405896-128405918 CCTCCTTGGCAGGCAGGGTATGG 0: 1
1: 0
2: 1
3: 27
4: 268
961648552_961648572 29 Left 961648552 3:128405844-128405866 CCCAGCCTGTACAGGCCCTTTGT 0: 1
1: 0
2: 0
3: 13
4: 151
Right 961648572 3:128405896-128405918 CCTCCTTGGCAGGCAGGGTATGG 0: 1
1: 0
2: 1
3: 27
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961648572 Original CRISPR CCTCCTTGGCAGGCAGGGTA TGG Intronic
901107952 1:6772011-6772033 CCTCCTTGGAAGGAACAGTACGG - Intergenic
901494707 1:9614333-9614355 CCTCCATGGCAGGGAGAGTTGGG - Exonic
902472290 1:16657266-16657288 CCTCCTGGGAAGGCAGGCTCAGG + Intergenic
902486513 1:16750180-16750202 CCTCCTGGGAAGGCAGGCTCAGG - Intronic
902504345 1:16929790-16929812 CCTCCTGGGAAGGCAGGCTCAGG - Intronic
902515673 1:16988230-16988252 CCTCCCTGGGTGGCAGGGCACGG + Exonic
902688244 1:18092908-18092930 ATATCTTGGCAGGCAGGGTAAGG - Intergenic
903279222 1:22240829-22240851 GCTCCTTGGCAGGCTGAGGAAGG - Intergenic
903344175 1:22673734-22673756 GCCCCTTGGCAGGCAGGGGGTGG + Intergenic
904959771 1:34323232-34323254 CCTCCTTGGGAGTCTGGGCATGG + Intergenic
905884414 1:41484197-41484219 CCTCCTGTGCATGCAGGGAAGGG - Exonic
907243206 1:53091974-53091996 CCTCCTTGCCAGGCTGGGCCAGG - Intronic
907573577 1:55506027-55506049 CCCTCTGGCCAGGCAGGGTAGGG - Intergenic
907933697 1:59022972-59022994 TGTCCTTTGCAGGCAGGGGATGG + Intergenic
909532868 1:76700553-76700575 CTGGCTTGGCAGGAAGGGTAGGG - Intergenic
910333312 1:86100709-86100731 CCTCCCTGGCAGAGGGGGTAGGG - Intronic
915340857 1:155175947-155175969 TCACCTTGGCAGGCTGGGCACGG - Exonic
915358197 1:155269128-155269150 CCCCCTTGGCAGGCGGGCTTGGG - Intronic
915988601 1:160490825-160490847 CCTATGTGGCAGGCAGGGGAGGG + Intronic
916721453 1:167487412-167487434 GCTCCATGGCAGGCAGGTTCAGG + Intronic
917643820 1:177009707-177009729 CCTCCAGAGCAGGCAGTGTAAGG + Intronic
918082414 1:181217824-181217846 CCACCTTGGCAGGAAAGGCATGG - Intergenic
923948631 1:238921543-238921565 CCTTCTTGACAGCCAGGGCATGG + Intergenic
1063460375 10:6211808-6211830 CCTTCTCAGCAGGCAGAGTAAGG - Intronic
1064219012 10:13423914-13423936 GCTGGTTAGCAGGCAGGGTAAGG + Intergenic
1066196369 10:33104228-33104250 TCTCCTAGGCAGACAGGGGAAGG - Intergenic
1066426952 10:35316175-35316197 ACTGCTAGGCAGGCAGAGTATGG - Intronic
1067079105 10:43203597-43203619 CCTCCTAGGTAGGCAGGGCCGGG - Intronic
1067472102 10:46544940-46544962 CCAACTTGTCAGGCAGGGCAGGG - Intergenic
1067809904 10:49418252-49418274 CCTCCTTTCCAGGGAGGGTGGGG - Intergenic
1068902955 10:62290440-62290462 CCTCCCTTGCAGCTAGGGTATGG + Intergenic
1070827174 10:79398071-79398093 GCTGCTTGGCAGGCAAGGGATGG + Intronic
1071335536 10:84597375-84597397 CCTCATTGGCAGGGAGCTTAGGG + Intergenic
1072346843 10:94515946-94515968 CCTCCTTGGCAGGAAGGAGCAGG + Intronic
1073178048 10:101568587-101568609 TCTCCTTTGCAGGCAGAGTTGGG + Intergenic
1074742071 10:116495140-116495162 GCTACTTGGGAGGCAGGGTCAGG - Intergenic
1075682957 10:124345488-124345510 CCTCTTTGCCACGCAAGGTAAGG + Intergenic
1075811205 10:125226437-125226459 CCTCCTTGGCCGGCTAGGCAAGG + Intergenic
1076067436 10:127459889-127459911 CCTCCTTGTCTCTCAGGGTAGGG - Intergenic
1076364234 10:129911593-129911615 CCTCCTTGGTGGGCACGGGATGG + Intronic
1076489902 10:130851774-130851796 CCTCTTTGGGAGGCAGAGGAGGG - Intergenic
1076737324 10:132464680-132464702 CCTCCCGGCCAGGCAGGGCAGGG + Intergenic
1077170611 11:1164348-1164370 CCCCTTTGGCAGGGAGGGCAGGG + Intronic
1077536445 11:3127023-3127045 CCACCCTGGCAGGCTGGGTAAGG + Intronic
1078255237 11:9653210-9653232 CCTCCTTGGAAAGCAGGGGAGGG + Intergenic
1078264717 11:9746187-9746209 ACCCCTTGGCAGCTAGGGTATGG - Intronic
1079114409 11:17631955-17631977 CCTCCTGGGCTGGCTGGGGATGG + Intronic
1080316465 11:30955712-30955734 CCTACCTGGCAGGGAGGTTACGG - Intronic
1080765070 11:35288393-35288415 CCTCATTTGCATGCAGGGGATGG + Intronic
1081559542 11:44200557-44200579 AGTCCTTAGCAGGCAGGGTGGGG + Intronic
1081623767 11:44634729-44634751 CCACCTTGGGAGGGAGGGGAAGG - Intergenic
1081666794 11:44921272-44921294 CTTCCATGGCAGGCAGGGGTGGG + Intronic
1082803539 11:57431989-57432011 CCTCCCAGGAAGGCTGGGTAGGG - Intergenic
1082990697 11:59205189-59205211 CCTACTTGGGAGGTGGGGTAGGG - Exonic
1083555246 11:63620946-63620968 CCTCCTTAGAAGGCAGAGAATGG - Intergenic
1083770406 11:64863930-64863952 CCTCCTTGGCAGGCTGGGGCAGG + Intronic
1084501923 11:69540148-69540170 CCTCCTGGGAAGGCAGGGAAAGG + Intergenic
1084558712 11:69890662-69890684 ACCCCTTGGCAGGCAGGCGAAGG - Intergenic
1089344803 11:117784362-117784384 CTCCCTTGGCAGGCAGGGCGAGG - Intronic
1089354680 11:117841922-117841944 CCTGCCTGGCAGGAGGGGTAGGG - Intronic
1089858504 11:121568131-121568153 GCTCCTTGGGAGGCAGAGGAGGG - Intronic
1090892616 11:130939084-130939106 CCTGCTTTGCTGCCAGGGTATGG - Intergenic
1091122279 11:133066119-133066141 CCTCCTTGGCAGGCAGAGGCGGG - Intronic
1092247215 12:6870398-6870420 CTGGCTTGGCAGGAAGGGTAGGG - Exonic
1092961176 12:13598142-13598164 CCTCCTTGCCAGGCAAGTTCTGG + Intronic
1093966441 12:25331893-25331915 CCTCCTAATTAGGCAGGGTATGG + Intergenic
1094480170 12:30875166-30875188 CCTCCCAGGCAGGGAGGGGAGGG + Intergenic
1094579846 12:31724426-31724448 CATCCTGGGCAGACAGGGCAGGG + Intronic
1096803144 12:54124866-54124888 CCTCCTTGGCTGGGAGGAGAGGG + Intergenic
1096871654 12:54596266-54596288 CTTCCTTGGGAGGGAGGGGATGG + Intergenic
1098888500 12:75984048-75984070 CCTGCTAGGCAGGCCGGGCATGG + Intergenic
1099164220 12:79282194-79282216 CCCTCTTACCAGGCAGGGTAAGG + Intronic
1099610939 12:84868906-84868928 CCTGCATGTCAGGCAGGATATGG + Intronic
1100813356 12:98362195-98362217 CCTTCTTCCCAGCCAGGGTAGGG + Intergenic
1101014472 12:100485332-100485354 GGTCCTTGGCAGGCTGGGTTGGG + Intronic
1102466907 12:113135399-113135421 CGTCCTTGGCAGGCAGCGCGCGG + Exonic
1102691245 12:114762877-114762899 CCTCTCTGGCAAGCAGGGGAAGG - Intergenic
1102742645 12:115221853-115221875 AATACTTGGGAGGCAGGGTAGGG + Intergenic
1106801017 13:33255739-33255761 CCTCCAGGGCAGGGAGGGGACGG + Intronic
1107008751 13:35646246-35646268 CCTCCATGGCCTGCAGGGGAAGG - Exonic
1107621638 13:42237851-42237873 TCTCCTTGGTCTGCAGGGTATGG - Intronic
1108455879 13:50612865-50612887 CCTCTGAGGCAGGCAGGGTCAGG - Intronic
1112366056 13:98756423-98756445 GCTCCCTGGCAGGCTGTGTAGGG + Intergenic
1114713937 14:24805041-24805063 CCTCTGAGGCAGGCAGGGTGGGG + Intergenic
1115448566 14:33519881-33519903 CCTCCTTGGGAGGTACGTTAGGG + Intronic
1116460682 14:45169645-45169667 CCTCCTTGGGAGGCCGAGGAGGG - Intronic
1117263022 14:54056210-54056232 CCTCCGTAGCAGGCAGGAGAAGG + Intergenic
1117316447 14:54575513-54575535 CCTCTTTGGAAGGCAGGGGGAGG + Intronic
1118817619 14:69324207-69324229 ATTCCCTGGCAGCCAGGGTAGGG + Intronic
1119437142 14:74605013-74605035 ACTCCTTGGCAGGCTGGGCCGGG + Intronic
1121075320 14:91063270-91063292 CCTCCTTTGCAGTTAGGTTAGGG + Intronic
1121434399 14:93909665-93909687 ACTCCCAGGCAGGCAGGGTGAGG + Intergenic
1122622959 14:103070253-103070275 CCTCCATGCCGGGCAGGGAAGGG - Intergenic
1123150363 14:106175634-106175656 CCTCCTTGCAAGGCAGGGGCTGG - Intergenic
1124035741 15:26052355-26052377 CTTCCTTTGCAGGCAGTGGAAGG + Intergenic
1124203533 15:27698447-27698469 CCTACCTGGCAGCCAGGGTCAGG + Intergenic
1125727377 15:41874918-41874940 CCATCTTGGCAGCCAGGGTCCGG + Exonic
1126909629 15:53403992-53404014 CCTCCTAGGAAGTCAGGGGATGG - Intergenic
1127986054 15:64071439-64071461 CCTTCTTGGCAGCCAGGACATGG + Intronic
1128443068 15:67731483-67731505 CTTCCTTGGCATGCAGTTTAGGG + Intronic
1128666261 15:69540425-69540447 CCTCCTTCCCAGGGAGGGGAGGG - Intergenic
1129467912 15:75734186-75734208 CCTCTGTGGCAGGCAGTGGAGGG - Intergenic
1129719348 15:77869545-77869567 CCTCTGTGGCAGGCAGTGGAGGG + Intergenic
1130540531 15:84817958-84817980 CCTCCCTGGCAGGAAGGGAGGGG + Intronic
1132079255 15:98851106-98851128 TCTCCCGGGCAGGCAGGGTAAGG + Intronic
1132285036 15:100656739-100656761 CCTCCAGTGCAGGCAGGGCATGG - Intergenic
1132659000 16:1053334-1053356 CATCCTTGGCAGGCTGGGTTGGG + Intergenic
1134111112 16:11516060-11516082 CCACCTGGGCAGACAGGGTTGGG + Exonic
1135078755 16:19416067-19416089 CCTCCTTGGGAGGCTGAGTGAGG + Intronic
1136679689 16:31951153-31951175 CCTCTTTGCAAGGCAGGGTCTGG + Intergenic
1136890370 16:33966948-33966970 CCTCTTTGCAAGGCAGGGTCTGG - Intergenic
1137330706 16:47492620-47492642 CAGCCTTGGCAGGGAGGGGAGGG + Intronic
1137830064 16:51535918-51535940 CCTCCTTGCCAGACAGGCTTGGG + Intergenic
1138081258 16:54093438-54093460 GCTCCCTGGCAGGCCGGGCACGG + Intronic
1139102164 16:63781459-63781481 CCTCCTTGCTAGGGAGGGCATGG - Intergenic
1139796254 16:69485360-69485382 TCTCCTTGGCAGGCAGGAGGAGG + Intergenic
1141436123 16:84000874-84000896 CATCCTTGGAGGGGAGGGTAAGG + Intronic
1141746145 16:85927798-85927820 TCTCCTTGGAAGACAGGGGAGGG - Intergenic
1142046786 16:87930598-87930620 CCTCCCTGTCAGGCTGGGTGGGG + Intronic
1203082661 16_KI270728v1_random:1156666-1156688 CCTCTTTGCAAGGCAGGGTCTGG + Intergenic
1142793068 17:2283660-2283682 TCTCCTTGGCAGTCAGGATAGGG + Exonic
1144280516 17:13721667-13721689 CTTTCTTGGCAGGTAGGGCAAGG + Intergenic
1149695178 17:58610997-58611019 TAGCCTTGGCAGACAGGGTAAGG + Intronic
1150492561 17:65584379-65584401 TCTCCCTGACAGGCAGGGGAAGG + Intronic
1151591290 17:75046723-75046745 CCTCCTTGGCGCGCGGGGTCAGG - Intronic
1151824133 17:76514166-76514188 CCTGCTAGCCAGGCAGGGGAAGG + Intergenic
1151975289 17:77480812-77480834 CCTCCCTGGGAGGCAGGATGGGG + Intronic
1152738886 17:82010628-82010650 CCCCCGTGGCAGGCTGGGCATGG - Intronic
1153529393 18:6029272-6029294 ACTCCTGGGCAGACAGGGTCAGG - Intronic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1154407580 18:14108196-14108218 ACTCCTAGGCAGGCAGGGATGGG + Intronic
1159492004 18:69148613-69148635 ACTCCCTGGCAGGCAGATTATGG + Intergenic
1160159316 18:76459428-76459450 CCTCCCTGGCCGGCAGTGGAGGG - Intronic
1160369191 18:78357170-78357192 CCTCAGTGGCAGGCAGTGTCTGG - Intergenic
1161140103 19:2642142-2642164 GCTCCCTGGCAGGCAGGCTGTGG - Intronic
1161939930 19:7395688-7395710 CCTCCCTGGCAGGGAGCGTTTGG + Intronic
1162782851 19:13015603-13015625 CTTGCCTGGCAGGCAGGGAATGG - Intronic
1164258414 19:23549267-23549289 CCTCCTTAGCAGGCTAGGTCTGG - Intronic
1164860945 19:31561777-31561799 ACTCCTTGGAAGGCTGGGCATGG - Intergenic
1168138733 19:54370182-54370204 CCTCCCAGGCAGGAAGGGTGGGG - Intronic
1168159295 19:54498315-54498337 CCTCCCAGGCAGGAAGGGTGGGG + Intronic
1168409827 19:56132762-56132784 CTGCCTTGGCAGTGAGGGTAAGG + Intronic
1168652321 19:58098998-58099020 CCCCCCTGGAAGGCAGGATAGGG + Intronic
1202704687 1_KI270713v1_random:14060-14082 CCTCCTGGGAAGGCAGGCTCAGG + Intergenic
926229654 2:10992866-10992888 CCTGCTTGGCTGGCAGGGACTGG - Intergenic
927487467 2:23498461-23498483 CCTGCTTGGCAGGGAGGGCAGGG - Intronic
928870532 2:35972514-35972536 CCTCCTTAGTAGTCAGGGAAAGG - Intergenic
929580844 2:43080993-43081015 CCTGCATGGCAGGCAGGCCATGG + Intergenic
931137270 2:59417129-59417151 CCTACTTGGGAGGCAGAGGAAGG - Intergenic
931200203 2:60090323-60090345 CCACCTTGCCAGGCAGTGTGTGG - Intergenic
937291573 2:120785195-120785217 CCTCCTGGGCATGCAGAGGAAGG + Intronic
937957001 2:127427206-127427228 GCTCCTTGTCAGGCTTGGTATGG + Exonic
938238649 2:129725829-129725851 CCTCCTTGGTAGAGAGGGGAAGG - Intergenic
938577025 2:132614527-132614549 GCTCCTTGGCTGGCTGGGTGCGG - Intronic
939991843 2:148882992-148883014 CCTCCTTGGCTGTCAGAGTTTGG + Intronic
945409952 2:209496281-209496303 CAGTCTGGGCAGGCAGGGTATGG + Intronic
946054212 2:216886825-216886847 CATCCTGGGCAGCCAGTGTAGGG - Intergenic
946075897 2:217073322-217073344 CCTCCTTGGCTGGCAGGGGCTGG + Intergenic
947653114 2:231803952-231803974 GCTCCTTGGCTGGCAGGTCAGGG + Intronic
947761070 2:232604359-232604381 TCTACTGGGCAGGTAGGGTAGGG - Intergenic
948065374 2:235074765-235074787 CATCCCTGGCAGGCAGTATAGGG + Intergenic
948219465 2:236258166-236258188 CTTCCTTCGAAGGCAGGGTGTGG + Intronic
948836183 2:240627052-240627074 CCTCCTGGGCAGGAAGTGGAAGG + Intronic
1169055703 20:2619049-2619071 CCTCATTGGCAGGCAGGGTTGGG - Intronic
1169881435 20:10351337-10351359 CCTCCTCAGCAGGCAGGGACTGG + Intergenic
1170900140 20:20454615-20454637 CATCCTTGGAAGGCAGAGTGGGG - Intronic
1171461254 20:25299283-25299305 CCTACTTGGGAGGCAGGCTGAGG + Intronic
1171854849 20:30334666-30334688 CCTCCTTGGCTGGGAGGAGAGGG + Intergenic
1172097559 20:32467760-32467782 CCTCCTTGCCAGGCAGCCTTGGG - Intronic
1173675910 20:44835585-44835607 CATACTTAGCAGGCAGGGTTGGG - Intergenic
1173998441 20:47357403-47357425 CCTCCTTGCAAGGCAGGCCAGGG + Intergenic
1177012260 21:15743735-15743757 ACTCCTAGGCAGGCAGGGACAGG - Intronic
1177889143 21:26783960-26783982 GATTCTTGGCAGGCAGAGTATGG + Intergenic
1178580245 21:33832038-33832060 CCTCCTTGCCTGCCAGGGGAAGG + Intronic
1178613719 21:34111327-34111349 CCTCCTTGGCAGGAAGCGGGTGG - Intronic
1178887142 21:36493319-36493341 CTTCCCTGGGAGGCAGGGCACGG + Intronic
1179079528 21:38158071-38158093 CCTCCTTTGAAGCCAAGGTATGG + Intronic
1179900969 21:44394154-44394176 CCACCGTGCCAGGCCGGGTATGG + Intronic
1179901030 21:44394604-44394626 CCACCGTGCCAGGCCGGGTATGG + Intronic
1181920435 22:26316371-26316393 CCTGCTAGGCATGCAGGGTGAGG - Intronic
1182392499 22:30010602-30010624 CCTCCTTGGCTGGCAGGTTTTGG + Intronic
1182920482 22:34074687-34074709 CAGCATTGGCAGGAAGGGTATGG + Intergenic
1183544663 22:38449075-38449097 TGGCCTTGGCAGGCAGGGGAGGG - Intronic
950221274 3:11198206-11198228 ACTCCTCGGCGGGCAAGGTAGGG - Intronic
950431101 3:12951741-12951763 CTCCCCTGGCAGGCAGGGTTTGG + Intronic
950763407 3:15255329-15255351 TCCCCTTGGCTGGCAGGATAAGG + Exonic
950964469 3:17136744-17136766 CCTCCTGGGCTGTCAGGGTGTGG - Intergenic
953021652 3:39118284-39118306 CCTCCTTGGCAGCGAGTATAGGG - Intronic
953337115 3:42102847-42102869 CTTCCTAGGCAGACAGGGGAGGG - Intronic
953691537 3:45124066-45124088 CTTCCTGGGCAGGCAGGGTTGGG + Intronic
955924255 3:63990248-63990270 GCTCAGTGGCAGGCAGGGGAGGG - Exonic
956160440 3:66345718-66345740 ACTCCTTAGCAGGCAGTGTTAGG - Intronic
956379626 3:68651854-68651876 CCTCCTTGGCAGGGTCGGGAGGG + Intergenic
956742301 3:72284853-72284875 CCTCCTTATCAGGGAGGGAAGGG - Intergenic
961360182 3:126362208-126362230 ACTATTTGGCAGGCAGGGTGGGG - Intergenic
961596449 3:128021922-128021944 CCTCCTTGCAGGGCAGGGCAGGG - Intergenic
961648572 3:128405896-128405918 CCTCCTTGGCAGGCAGGGTATGG + Intronic
967995377 3:195162256-195162278 GCTCCTGGGCAGCCAGGATACGG + Intronic
968454016 4:688272-688294 CCTCCTTTGCTGGCTGGGTATGG - Intronic
968572683 4:1350347-1350369 CCTTCGTGGCAGGTGGGGTAAGG - Intronic
969105562 4:4804787-4804809 CCTCCATTGGAGGCAGGGCAGGG + Intergenic
969248942 4:5954581-5954603 CCTCCACGGCAGGCAGCGCATGG + Intronic
969513179 4:7631380-7631402 CCTCCTGGCCAGGCAGGGAGGGG + Intronic
969570753 4:8006785-8006807 CCTCATCTGCAGGCAGGGCAAGG - Intronic
969991983 4:11274316-11274338 CCTACTTGAAAGGCAGGGGATGG + Intergenic
971119362 4:23687098-23687120 CCTACTAGGCAGGCAGAGAATGG + Intergenic
972539886 4:40030105-40030127 CCTGCTTGCCAGGCTGGGCACGG + Intergenic
973041478 4:45474979-45475001 CCTTCTTGGAAGGCTGGGTGGGG - Intergenic
973196793 4:47453818-47453840 CTTCCTTGGCAGACAGCATAGGG + Intronic
976812413 4:89111323-89111345 CCTCCCTGGCCGGCAGGGGGAGG - Intronic
983699910 4:170579315-170579337 CCTCCCTGGCTGGGAGGGTTAGG - Intergenic
985675790 5:1230680-1230702 CCACTTTGCCAGGCAGGGTCCGG - Intronic
985881569 5:2642301-2642323 CCTCCATGGCAGGCAGGGACTGG - Intergenic
986403903 5:7406482-7406504 CCACCTGGGCAGGCAGGGTGAGG + Intronic
993386514 5:87268408-87268430 GCTCCCGGGCGGGCAGGGTAGGG + Exonic
993471754 5:88315012-88315034 CCTTCTAGGAAGGCAGGGTAAGG - Intergenic
996520493 5:124420692-124420714 CCTCAGTGGCAGGCAGGGCAGGG + Intergenic
997249293 5:132376500-132376522 ACTCCTTGGCTGGCAAGGTTGGG - Intronic
997545626 5:134704689-134704711 CCTACTTGGGAGGCTGAGTAGGG + Intronic
998282219 5:140822834-140822856 CCTCTTTGACAGGCAGGAAAAGG - Exonic
1000018151 5:157296480-157296502 CCTACTTGGCAGGCTGAGTTGGG + Intronic
1001568239 5:172714143-172714165 CCTCCGGGGGAGGCAGGGGAGGG - Intergenic
1002059635 5:176618972-176618994 TCACCTTGGCCCGCAGGGTAGGG - Intergenic
1002316674 5:178348489-178348511 CTCCCTTGGCAGTCAGGGTTGGG + Intronic
1002575531 5:180171843-180171865 CCTGCTCGGCAGCCAGGGTGTGG + Intronic
1004275461 6:14231744-14231766 CATCCTTGGCAGGCAGCCCAGGG + Intergenic
1005511650 6:26517319-26517341 CCTACTTGGGAGGTAGGGTTTGG - Intergenic
1005994558 6:30923394-30923416 ACTCCTGGGCAGCCAGGGCAAGG - Exonic
1006803078 6:36771749-36771771 CCTCCAGGGTAGGCAGGGGAGGG - Intronic
1007132435 6:39488259-39488281 TTTACTTGGCAGGCAGAGTAGGG + Intronic
1010783672 6:79974726-79974748 CATCCATGGCAGGGAGGGAAAGG - Intergenic
1011432036 6:87297800-87297822 CCACCTGGACAGGCAGGGTCAGG + Intronic
1013972624 6:116039510-116039532 CTGGCTTGGCAGGAAGGGTAGGG - Intronic
1015539327 6:134298368-134298390 CCTCCTTCATAGGCAAGGTACGG - Intronic
1016391287 6:143578510-143578532 CCAGCTTGGCAAGCAGGGTATGG - Intronic
1017687072 6:156924165-156924187 CCCCCTTGTCAGCCAGGGGATGG + Intronic
1017925939 6:158911894-158911916 GCACCTTGGCAGGCAGGAAAGGG + Intergenic
1018192741 6:161324914-161324936 CCCTCTTGGCAGGTAGGGGAAGG + Intergenic
1018317169 6:162568618-162568640 CCTCCTTCATAGGCAAGGTACGG + Intronic
1018456747 6:163960358-163960380 CCTCCATGCCAGCCAGGGAAAGG - Intergenic
1019636877 7:2080805-2080827 CCTCCCTGGCAGGGAGGTTCAGG - Intronic
1019800283 7:3083332-3083354 CATCCCTGGCAGGCAGGCTGAGG - Intergenic
1020839708 7:13200303-13200325 CCTACTTAGCAGTCAGGGAAAGG + Intergenic
1022010221 7:26302355-26302377 ACTCCTTTGCAGGCAGGAGATGG + Intronic
1022815125 7:33905735-33905757 CCTTCTTGACAGGTAGGGGAGGG + Exonic
1022997123 7:35768551-35768573 GGGCCTTGGCAGGCAGGGCACGG + Intergenic
1025077732 7:55957454-55957476 CCTCCATGGCAAACAGGATATGG + Intronic
1026642633 7:72140584-72140606 CAACCTTGGCAGGCAGGGTGTGG + Intronic
1028213183 7:88100803-88100825 TCTCCTTGGGAGGCTGGGCATGG - Intronic
1029458076 7:100680946-100680968 CCTCTCTGGCTGGCAGGGTGGGG - Exonic
1031496205 7:122451239-122451261 CCTCCCTTGCCTGCAGGGTAAGG - Intronic
1032160485 7:129505766-129505788 CCTCCTTGACAGGCTGGGCATGG - Intronic
1032592206 7:133201816-133201838 CAACCTTGGGAGGCAGGTTATGG + Intergenic
1032761602 7:134948314-134948336 CCTGCATGTCAGGCACGGTATGG - Intronic
1032779009 7:135147342-135147364 CCTCCTTTGGAGGAAGGGCAAGG + Intronic
1033685153 7:143632881-143632903 ACTCCTTGGCAGGCAGAGTTGGG - Intronic
1033688326 7:143712100-143712122 ACTCCTTGGCAGGCAGAGTTGGG - Intronic
1033699461 7:143824740-143824762 ACTCCTTGGCAGGCAGAGTTGGG + Intergenic
1034532244 7:151703044-151703066 CTCCCTGGGCAGGCAGGTTAGGG - Intronic
1034931077 7:155164608-155164630 CTTCCTTGCCAGGTATGGTAGGG - Intergenic
1036496191 8:9271962-9271984 CCTCCCTGGGAGCCAGGGTAAGG + Intergenic
1036723877 8:11201570-11201592 CCATCTTGGCCGGGAGGGTAGGG - Intergenic
1039071993 8:33657292-33657314 GCTCCTAGGCAGGCAGGGGTGGG + Intergenic
1039130181 8:34255009-34255031 CCTCCTGGGGAGGTAGGGTCTGG - Intergenic
1039773464 8:40712554-40712576 CCTACTTAGCAGTCAGGGTGGGG + Intronic
1040374966 8:46816214-46816236 TCTCCTTCGCAGGCAGGGCCAGG - Intergenic
1040788289 8:51193506-51193528 ACTCATTGGCAGGAAGGGAAGGG - Intergenic
1041781048 8:61578527-61578549 CCTCCTTCACAGACAAGGTACGG + Intronic
1043949414 8:86291310-86291332 CCACCTTGGCAGGCAAAGTGTGG - Intronic
1044522790 8:93218903-93218925 CATCCTTGACAGACAGGGTCAGG + Intergenic
1044703398 8:94985047-94985069 CCTCCTTTGCAGCTAGGGGATGG + Intronic
1045799140 8:106081326-106081348 CCTACTTTGCAGGCATGTTATGG + Intergenic
1046504845 8:115124274-115124296 CATCCTGGGCAGCCAGGTTATGG + Intergenic
1048307414 8:133293937-133293959 TCTTCTTGGCAGGCAGAGTCTGG - Intronic
1049224139 8:141441625-141441647 CCTCCTTGCCAGGTACGGTGGGG - Intergenic
1049729143 8:144167092-144167114 CCTCGTTGGCAGCCTGGGTGTGG + Intronic
1049878304 8:145042602-145042624 CCTCCTTGGGAGGCTGAGTGGGG - Intergenic
1053792673 9:41697949-41697971 CCTCCTTGGCTGGGAGGAGAGGG + Intergenic
1054152507 9:61616871-61616893 CCTCCTTGGCTGGGAGGAGAGGG - Intergenic
1054181086 9:61909970-61909992 CCTCCTTGGCTGGGAGGAGAGGG + Intergenic
1054472277 9:65548019-65548041 CCTCCTTGGCTGGGAGGAGAGGG - Intergenic
1054656505 9:67671172-67671194 CCTCCTTGGCTGGGAGGAGAGGG - Intergenic
1057114146 9:92504520-92504542 TCTTTTTGGCAGGCAGGGTGGGG + Intronic
1057794456 9:98145492-98145514 CCTTCTAGAAAGGCAGGGTATGG - Intronic
1058096143 9:100862482-100862504 CCTCCTGGGAAGGCAGTGGAGGG - Intergenic
1058762425 9:108147888-108147910 GCTCCTGGGGAGGCATGGTATGG + Intergenic
1061515525 9:131087801-131087823 GCTGCTTGCCAGGCTGGGTAAGG + Exonic
1062332582 9:136051159-136051181 CCTCCCGGGCAGGTAGGGAATGG + Intronic
1062624604 9:137437078-137437100 CCAGCGTGGCAGGCAGGGTGGGG - Intronic
1189463069 X:41258202-41258224 CCTCCTTGGTAGGGAGGCTCTGG + Intergenic
1190967337 X:55313219-55313241 CCTCCTTTGCAGGGATGTTATGG + Intergenic
1192227093 X:69236930-69236952 CCCCCTTGGATGGCAGGGGAAGG - Intergenic
1192229986 X:69257887-69257909 CCTCCTTTACAGGCAGGGTCAGG - Intergenic
1195617097 X:106920932-106920954 CCTCCTTGGCATGAAGGCTCAGG + Intronic
1196144023 X:112297057-112297079 GCTCCCTGGAAGGCAGGGAAAGG - Intergenic
1196759680 X:119190123-119190145 CCTCCCTGGAAGGCAGGCTAAGG + Intergenic
1201950101 Y:19554475-19554497 CCTCCTTGGAAGGCAAGGTGGGG - Intergenic